Methylselenocysteine Potentiates Etoposide-Induced Cytotoxicity by Enhancing Gap Junction Activity

Abstract

Homomeric or heteromeric connexin (Cx) hemichannels-composed gap junction (GJ) intercellular channel can mediate direct cell-to-cell communication. Accumulating studies indicate that GJs potentiate the cytotoxicity of antitumor drugs in malignant cells. Methylselenocysteine (MSC), a selenium compound from garlic, has been reported to modulate the activity of antineoplastic drugs, but the underlying mechanism remains unclear. This study investigates the efficacy of MSC on chemotherapeutic drugs-induced cytotoxicity and the relationship between this effect and the regulation of GJ function by MSC. Firstly, a doxycycline-regulated HeLa cell line expressing heteromeric Cx26/Cx32 was used as a tool. Etoposide, but not cisplatin or 5-fluorouracil, showed remarkable cytotoxicity in high-density (with GJ formation) cultures than in low-density (without GJ formation) in transformed HeLa cells. And cell density had no effect on etoposide-mediated cytotoxicity in the absence of Cx expression. MSC substantially enhanced etoposide-induced cytotoxicity, and this effect was only detected in the presence of functional GJs. Subsequently, MSC potentiated structural Cx expression as evidenced by increased dye coupling, but no alteration in Cx mRNA expression level in either transformed or primary cancer cell lines. Finally, a redox mechanism involving glutathione (GSH) was found to be related to the posttranscriptional modulation of Cx expression by MSC in HeLa cells. In conclusion, we provide the novel finding that MSC increases etoposide-mediated cytotoxicity by enhancing GJ activity, due to elevated Cx expression through a GSH-dependent posttranscriptional mechanism. More generally, the study highlights potential benefit of the combination of GJ modulators and chemotherapeutic agents in anticancer treatment.

INTRODUCTION

Selenium, an essential micronutrient for humans, and its functional selenium compounds have pleiotropic effects, such as antioxidant and anti-inflammatory effects.¹⁾ Recently, the main focus has been on the impact of selenoproteins on maintaining cellular redox balance and anticancerogenic function, while the data on selenium anticancer properties remains controversial.²⁾ Methylselenocysteine (MSC), which occurs naturally in selenium-enriched garlic, onions and broccoli, is an effective noncarcinogenic form of selenium that is cytotoxic to tumor cells in vitro at concentrations greater than 50–100 μM.^3–5) However, at minimally toxic concentrations, MSC alters the efficacy of chemotherapeutic agents in vitro or in vivo,^6,7) including increasing the cytotoxicity of etoposide, a topoisomerase II inhibitor. The cytotoxic effect of etoposide was increased up to 2.5-fold when administered in combination with nontoxic concentrations of methylseleninic acid (MSA), one active product of MSC that represents the main intracellular species.⁸⁾ Pretreatment with MSC prior to the initiation of cytotoxic drug treatment is essential for optimal therapeutic synergy.⁷⁾ However, the mechanism underlying the modulation of drug activity by MSC remains unclear.

Gap junctions (GJs), consisting of homomeric or heteromeric connexin (Cx) protein, connect the cytoplasm of adjacent cells, therefore mediating the direct intercellular movement of cytoplasmic signaling molecules. Cell-to-cell communication mediated by GJs has been implicated in many cellular events, including cancer biology and chemotherapy.^9,10) He et al.¹¹⁾ showed that Cx32-containing GJs are required components of bystander toxicity induced by cisplatin. Similarly, Cx26 overexpression was shown in our previous study to enhance oxaliplatin cytotoxicity in human hepatocellular carcinoma cells.¹²⁾ In addition, Cx gene transfection exerted an additive effect with etoposide on promoting apoptosis and cell cycle arrest.^13,14) One main mechanism underlying this effect includes a GJ-mediated cell interdependent pathway. Damage induced by cytotoxic agents in one cell triggers death-related signals, and the signaling molecule is small enough to be transmitted by GJs to neighboring cells, leading to a “bystander effect.” In support of this hypothesis, drugs with the ability to enhance GJ activity in tumor cells have the potential to increase the antineoplastic therapeutic effects of cytotoxic compounds, including etoposide.^15–17)

However, few studies implicating an involvement of selenium or selenium-containing compound in the regulation of Cx expression and GJs have been available. Lu et al.¹⁸⁾ once found that elevated expression of Cx43, a protein that constitutes GJs, was related to MSC-induced apoptosis in prostate cancer cells. Based on those findings, we hypothesize that MSC may enhance GJ activity and further modulate the GJ-mediated cytotoxicity of chemotherapeutic drugs, indicating the chemomodulatory activity of MSC. The present study was designed to test this hypothesis and to explore the underlying mechanisms.

MATERIALS AND METHODS

Materials

MSC, etoposide, cisplatin, 5-fluorouracil, all-trans retinoic acid (RA), anti-hemagglutinin (HA) clone HA-7 mouse immunoglobulin G (IgG) and anti-Cx32 mouse IgG were obtained from Sigma (St. Louis, MO, U.S.A.). G418, hygromycin B, and doxycycline (Dox) were purchased from Calbiochem (San Diego, CA, U.S.A.). Dulbecco’s modified Eagle’s medium (DMEM), RPMI-1640, fetal bovine serum (FBS), TRIzol, and the cell labeling dyes CM-DiI and calcein-acetoxymethyl ester (calcein-AM) were purchased from Invitrogen (Carlsbad, CA, U.S.A.). Secondary antibodies used for Western blot were obtained from Amersham Biosciences Corp. (Piscataway, NJ, U.S.A.). All other reagents were obtained from Sigma, unless indicated otherwise.

Cell Lines and Cell Culture

The HeLa cell line that was stably transfected to express heteromeric Cx26/Cx32 channels was described and characterized in a previous study.¹⁹⁾ In this cell line, the expression of both Cxs is controlled by a single bidirectional tetracycline-inducible promoter. rCx26 contains a thrombin-cleavable C-terminal epitope tag (3.2 kDa) that includes a HA epitope. HeLa cells were grown at 37 °C in DMEM supplemented with 10% FBS, G418 sulfate (100 µg/mL), and hygromycin B (200 µg/mL). Dox (1 µg/mL) was added for 48 h to induce Cx expression. The Hep3B hepatoma cell line was obtained from Chinese Type Culture Collection (Shanghai, China). Cells were routinely cultured in RPMI-1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin at 37 °C in a humidified atmosphere with 5% CO₂. The medium was changed every two days.

3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium Bromide (MTT) Assay

MSC was dissolved in dimethyl sulfoxide (DMSO) to a stock concentration of 50 mM and stored frozen. Aliquots were thawed and diluted to the desired concentration with DMSO before use in the experiment. HeLa cells were seeded in 96-well plates at a density of 4000 cells/well. After 24 h, exponentially growing cells were exposed to various concentrations of MSC for 48 h. Cells treated with the same concentration of DMSO (always less than 0.1% (v/v)) were used as a control group. Next, MTT (5 mg/mL in phosphate buffered saline (PBS)) was added to each well, incubated at 37 °C for 4 h, and then the medium containing MTT was removed. DMSO (100 µL) was used to solubilize the formazan crystals in the viable cells, and a microplate ELISA reader (MRX II, Dynex Technologies, Chantilly, VA, U.S.A.) was used to read the absorbance at 490 nm of each well. The viability of MSC-treated cells was normalized to that of vehicle-treated control cultures.

Cytotoxicity Assay

The three chemotherapeutic agents, etoposide, cisplatin and 5-fluorouracil, were prepared as stock solutions of 5 mM, 5 mM and 5 M (etoposide and 5-fluorouracil in DMSO, and cisplatin in PBS), respectively, and stored at −20 °C. HeLa cells exposed to these agents and Hep3B cells exposed to etoposide were performed for 1 h in the dark. Cytotoxicity was assessed using the colony formation assay reported by Jensen and Glazer,²⁰⁾ which was applied to high and low cell densities, corresponding to conditions that allowed or disallowed GJ formation, respectively. Cells were inoculated at 30000 cells/cm² under high-density conditions, resulting in 70–100% confluent cultures during drug exposure. Cells were treated with toxic drugs for 1 h in the dark, washed with PBS, collected by trypsin digestion, counted, diluted, and inoculated into six-well culture dishes at a density of 100 cells/cm². After 5 to 7 d, colony formation was assessed by fixation and crystal violet staining. Colonies containing 50 or more cells were scored. Under low-density conditions, cells were inoculated directly into six-well culture dishes at a density of 100 cells/cm² and treated with toxic drugs after attachment. They were rinsed, and colony formation was assessed as described above. Colony formation was normalized to the colony-forming efficiency of untreated cells. For experiments using MSC and etoposide in combination, MSC was added to cells at the highest nontoxic concentration for the indicated periods before etoposide exposure and remained in the medium during treatment with etoposide.

“Parachute” Dye-Coupling Assay

GJ function was assessed using a “parachute” technique.^11,21,22) Cells were cultured in plastic dishes to confluence. Donor cells were incubated with a freshly prepared solution of calcein-AM (2.5 µM) and CM-DiI (5 µM) in pH 7.4 growth medium at 37 °C for 30 min. CM-DiI is a membrane dye that does not diffuse into coupled cells. Calcein-AM is converted intracellularly into the GJ-permeable dye calcein. The unbound dye was removed by three successive rinses with culture medium. Donor cells were then trypsinized and seeded onto receiver cells at a donor/receiver ratio of 1 : 150 to attach to the monolayer of receiver cells and form GJs at 37 °C and pH 7.4 for 4 h and then examined with a fluorescence microscope. For every experimental condition, the average number of receiver cells containing dye per donor cell was visually determined and normalized to that of vehicle control cultures. For studies involving MSC or RA, receiver cells were preincubated with MSC or RA for the corresponding times before performing the parachute experiment.

Western Blot

Cells were washed and harvested with cold PBS and lysis buffer (20 mM Tris·HCl, pH 7.4, 150 mM NaCl, 1 mM ethylenediaminetetraacetic acid (EDTA), 1 mM ethylene glycol bis(2-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA), 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM Na₃VO₄, 1 mM β-glycerophosphate, and a 1 : 1000 dilution of protease inhibitors). In addition, the cell lysate was sonicated and centrifuged at 12000 rpm for 30 min at 4 °C. Protein concentrations were determined using a protein assay kit (Bio-Rad DC, Bio-Rad Co., Hercules, CA, U.S.A.). Samples (20 µg) from cells were loaded in the wells of sodium dodecyl sulfate (SDS)-polyacrylamide gels composed of 10% (w/v) acrylamide, followed by electrophoresis and blotting. Immunodetection was performed using the following antibodies at the dilution recommended by the suppliers: mouse anti-HA clone HA-7 IgG as the primary antibody for HeLa cells at a 1 : 1500 dilution and mouse anti-Cx32 for Hep3B cells at a 1 : 500 dilution; alkaline phosphatase-conjugated goat anti-mouse IgG was used as the secondary antibody for HeLa cells at a 1 : 3000 dilution and for Hep3B cells at a 1 : 1000 dilution. The immunoreactive bands were visualized using an Amersham ECL™ Plus Western blot Detection Kit (GE Healthcare, Piscataway, NJ, U.S.A.). Blots were then washed, re-probed with an anti-β-actin antibody, and developed in an identical manner for assessing β-actin protein levels to ensure even loading. All Western blot exposures were within the linear detection range, and the intensity of the resulting bands was quantified using Quantity One software with a GS-800 densitometer (Bio-Rad).

RNA Isolation and RT-PCR

Total RNA was extracted using TRIzol according to the manufacturer’s instructions. The cDNA (20 µL) templates were generated from 1 µg of RNA using the standard procedure for AMV reverse transcriptase (Promega) at 42 °C for 60 min. For PCR quantification, 2 µL of cDNAs were amplified in a 20 µL standard PCR. PCR was initiated at 94 °C for 3 min followed by 36 cycles consisting of 45 s at 94 °C, 45 s at 55 °C (for rat Cx26) or 60 °C (for human Cx32), and 45 s at 72 °C, with the final cycle extended to 10 min at 72 °C, followed by termination at 4 °C. The primers for the RT-PCR assay are listed in Table 1. The detection of β-actin transcripts provided an internal control in PCR that normalized the amount of input cDNAs. Aliquots of 3 µL of the PCR products were analyzed on an ethidium bromide-stained 1.5% agarose gel. The stained gels were scanned, and the results are shown as electropherograms.

Table 1. The Primers Used for RT-PCR Analysis

Gene	Sequence		Product size (bps)
	Sense (5′–3′)	Antisense (5′–3′)
Rat Cx26	TCTCTCACATCCGGCTCTGG	TCCGTTTCTTTTCGTGTCTCC	102
Human Cx32	TCCCTGCAGCTCATCCTAGT	CCCTGAGATGTGGACCTTGT	156
Human β-actin	CGTGGACATCCGCAAAGAC	GCATTTGCGGTGGACGAT	256

Real-Time Quantitative RT-PCR for Analyzing the Expression of Cx26 and Cx32 Genes

Real-time quantitative RT-PCR analysis with a LightCycler 480 System (Roche Diagnostics, Meylan, France) and SYBR Premix Ex Taq (Toyobo) was performed according to the manufacturer’s protocol. The amplifications were performed using the same primer sets as described above. For each cDNA sample, three separate measurements were performed with a 1 µL aliquot. The real-time RT-PCR cycles started with initial denaturation at 95 °C for 30 s, followed by 45 cycles of denaturation at 95 °C for 15 s, annealing at 55 °C for 15 s, and elongation at 72 °C for 45 s. Data for target genes were normalized to β-actin, and the 2^−△△Ct method was used to calculate the relative mRNA level of target genes.

Detection of Intracellular Glutathione (GSH)

5-Chloromethylfluorescein diacetate (CMFDA, Invitrogen Molecular Probes) a membrane-permeable dye, was used to measure intracellular GSH levels.²³⁾ Briefly, cells were incubated with the designated concentrations of MSC with or without GSH modulators for 48 h. Cells were then washed with PBS and incubated with CMFDA (5 µM) at 37 °C for 30 min according to the manufacturer’s instructions. Cytoplasmic esterase converts nonfluorescent CMFDA to the fluorescent molecule 5-chloromethylfluorescein (CMF), which then reacts with cellular GSH. The CMF fluorescence intensity was determined using a Cary Eclipse spectrofluorometer (Varian, San Diego, CA, U.S.A.) at an excitation wavelength of 492 nm and an emission wavelength of 517 nm.

Statistical Analysis

All statistical analyses were performed using SigmaPlot software (Jandel Scientific) with unpaired Student’s t test. Data are reported as means ± standard error (S.E.), and differences at p < 0.05 were considered significant.

RESULTS

Validation of the Experimental Model

Prior to the commencement of the main study, we confirmed that the HeLa cell line exhibited Dox-regulated expression of Cx26/Cx32 and formed functional GJs by performing RT-PCR, Western blot and parachute assays. The induction of Cx26 and Cx32 expression (Supplementary Figs. S1A, B) and dye coupling (Supplementary Fig. S1C) by Dox is shown in Supplementary Fig. S1. In addition, no evidence of toxicity or alteration in cell morphology induced by Dox was observed under any of the experimental conditions investigated (data not shown).

The Cytotoxicity of Etoposide Depends on GJs

The effect of short-term exposure to chemotherapeutic agents on the clonogenic survival of HeLa cells expressing Cx26/Cx32 cultured at low- and high-density, was assessed using the colony formation assay. As shown in Fig. 1A, the toxicities of etoposide and cisplatin were substantially greater in high-density cultures where the cells were in contact with each other than in low-density cultures where no cell–cell communication formed. However, no remarkable difference in 5-fluorouracil cytotoxicity was observed between the low- and high-density cultures. Notably, the difference induced by etoposide was the most significant, and we thus focused on etoposide cytotoxicity in subsequent experiments. As evidenced in Fig. 1B, etoposide decreased the clonogenic survival of cells cultured not only at low density but also at high density in a concentration-dependent manner (from 1 to 8 µM) after 1 h. The toxicity of etoposide was generally greater in high-density cultures than in low-density cultures, with the concentration of 4 µM inducing the most significant toxicity. The cell density dependence of the etoposide response in Cx-expressed cells suggests a possible role for GJs in mediating etoposide cytotoxicity.

Fig. 1. GJ-Dependent Cytotoxicity of Etoposide in Cx26/Cx32-Expressed HeLa Cells

(A) Effect of cell density on the cytotoxicity of chemotherapeutic agents. Cells were treated with etoposide (4 µM), cisplatin (5 µM) or 5-fluorouracil (0.5 mM) for 1 h. The fraction of surviving cells was determined using a standard colony-forming assay, as described in Materials and Methods. (B) Inhibition of clonogenic survival of cells by etoposide depends on the cell density. The clonogenic survival of cells exposed to a range of etoposide concentrations after culture at a low cell density (-●-, 100 cells/cm²) or a high cell density (-○-, 30000 cells/cm²). (C) The clonogenic survival of cells cultured at low and high densities before and after the induction of Cx expression by 1 µg/mL Dox upon treatment with 4 µM etoposide. * p < 0.05, significantly different from the low-density group treated with etoposide (A), the low-density group (B) and the not-induced group cultured at a high density (C). # p < 0.05, significantly different from the low-density group treated with cisplatin (A).

Figure 1C presents the clonogenic survival of Cx26/Cx32 (Dox-induced) and non-Cx26/Cx32 (not-induced) expressed HeLa cells at low- and high-density in response to etoposide. Dox itself did not alter the survival of cells cultured at either a low or high cell density, as previously described.^11,24) Here, we focus on the effect of Cx expression induced by Dox on the toxicity of etoposide. At a low cell density, the induction of Cx expression had no relationship with etoposide toxicity. In contrast, at a high cell density, the cells treated with 1.0 µg/mL Dox were more sensitive to etoposide than cells treated without Dox (Fig. 1C). These results support the hypothesis that the increased etoposide toxicity toward cells cultured at a high density requires functional GJs, as increased toxicity is dramatically reduced in high-density cultures lacking Cx expression. Generally, the data indicate that the density-dependent increase in etoposide cytotoxicity is mediated by GJs.

Effect of MSC on the Cytotoxicity of Etoposide

We determined the nontoxic concentrations of MSC for Cx26/Cx32-expressed HeLa cells by examining the effect of increasing concentrations of MSC on cell viability using the MTT assay. After 48 h of exposure, MSC at concentrations up to 50 µM exerted no significant toxicity, whereas 100 µM MSC caused a 15% decrease in cell viability (Fig. 2A). The data are consistent with previous studies showing that MSC is cytotoxic to tumor cells in vitro at concentrations greater than 50–100 µM.

Fig. 2. Effect of Nontoxic MSC Concentrations on the Cytotoxicity of Etoposide in Cx26/Cx32-Expressed HeLa Cells

(A) Cells were treated with the indicated concentrations of MSC for 48 h one day after being seeded into 96-well plates, and cell viability was subsequently determined using the MTT assay. (B) Cells were pretreated with 50 µM MSC for 3 h, followed by etoposide (4 µM) exposure for another 1 h. The fraction of surviving cells was determined by performing a standard colony-forming assay, as described in Materials and Methods. (C) The clonogenic survival of cells treated with 4 µM etoposide with or without 50 µM MSC pretreatment in noninduced and Dox-induced cultures. Cells were cultured for 48 h in the presence and absence of Dox (1 µg/mL) before MSC treatment. * p < 0.05, significantly different from the vehicle control (A, B). # p < 0.05, significantly different from the etoposide group cultured at a high density (B) and Dox-induced cultures (C).

We further examined the effect of MSC on etoposide-induced cytotoxicity in Cx26/Cx32-expressed HeLa cells. Cells seeded at a high or low cell density were treated with MSC at the highest nontoxic concentration of 50 µM for 3 h, followed by exposure to 4 µM etoposide plus MSC for 1 h. The clonogenic survival of HeLa cells was assessed 7 d after exposure to etoposide and MSC. As shown in Fig. 2B, MSC itself did not exert a cytotoxic effect on the survival of cells cultured at either low or high cell densities, confirming the absence of toxicity, as evidenced by the MTT assay. MSC had no effect on etoposide toxicity in low-density cultures, while in high-density cultures, MSC substantially increased etoposide toxicity. Pretreatment of Dox-induced cultures with MSC at the same concentration potentiated the cytotoxicity of etoposide, leading to substantially decreased survival. In contrast, in Dox not-induced cultures, MSC had little effect on survival after exposure to etoposide (Fig. 2C). Thus, MSC increased the toxicity of etoposide only in high-density cultures with Cx expression, where GJs have the opportunity to form.

Effect of MSC on GJ Function

The finding that MSC modulated etoposide toxicity only at a high cell density suggested that its chemomodulatory effect is mediated by GJs. We tested this hypothesis by examining the effect of MSC on dye coupling between cultured cells. As shown in Fig. 3A, MSC increased the dye spread from donor cells to receiver cells in a concentration-dependent manner in a short period of 4 h, and the effect increased when cells were incubated concentrations ranging from 12.5 to 50 µM. Treatment with 50 µM MSC caused up to a 44% increase in the number of cells exhibiting calcine fluorescence. As the treatment time was prolonged to 24 or 48 h, the percentage increased to approximately 54 and 83%, respectively (Fig. 3B). In addition, RA, an enhancer of GJ activity,^25,26) was also tested to increase the GJ activity in the target cells; however, 10 µM RA was less potent than 50 µM MSC after the same treatment time (Fig. 3B). Representative images showing dye spread to numerous cells adjacent and distant to the “donor cell” are shown in Fig. 3C. Based on these findings, MSC enhances GJ function in Cx26/Cx32-expressed HeLa cells in both a concentration- and time-dependent manner.

Fig. 3. Effect of MSC on Dye Coupling through GJs in Cx26/Cx32-Expressed HeLa Cells

GJ function was assessed by calculating the average number of receiver cells containing calcein from each donor cell normalized to vehicle control cells treated with DMSO. (A, B) The dye spread of cells treated with a range of MSC concentrations for 4 h (A) or 50 µM MSC for the indicated periods (B). HeLa cells were treated with 10 µM RA, the positive control, for 48 h. (C) Representative images showing dye spread to numerous cells adjacent and distant to the “donor cell” in various groups. * p < 0.05, significantly different from the vehicle control. # p < 0.05, significantly different from the 12.5 µM group (A) or 4 h group (B).

Fig. 4. Effect of MSC on Structural Cx Expression in Cx26/Cx32-Expressed HeLa Cells

Cells were treated with 50 µM MSC for the indicated times, after which Cx26/Cx32 protein expression was determined using Western blot assay with mouse anti-HA IgG (A), and mRNA expression was assessed using semiquantitative RT-PCR (B) and real-time quantitative RT-PCR (C). * p < 0.05, significantly different from the vehicle control. # p < 0.05, significantly different from the result at 4 h.

Effect of MSC on Cx Expression

Western blot was performed to determine the effect of MSC on Cx protein levels. As shown in Fig. 4A, exposure of cells to 50 µM MSC increased Cx26 and Cx32 expression compared to the control, and this stimulation was consistent with the treatment time. We further tested whether the modulation of Cx26 expression by MSC occurred at the transcriptional level by first measuring the expression of the Cx26 mRNA in cells treated with MSC for the indicated periods using semiquantitative endpoint RT-PCR. Figure 4B shows that MSC did not elicit a noticeable change in the amplified PCR product for the Cx26 transcript in either sample. Real-time quantitative RT-PCR, which provides more precision and a greater dynamic range than endpoint RT-PCR,²⁷⁾ was further conducted and validated the absence of transcriptional alterations (Fig. 4C). Thus, the enhanced GJ function observed in Cx26/Cx32-expressed HeLa cells exposed to MSC was due to increased structural Cx expression and was not attributable to effects on gene transcription.

Effect of MSC on the Primary Cancer Cell Line Hep3B

The human hepatoma cell line Hep3B mainly expressing Cx32 was also studied to exclude a specific effect on the HeLa cells. The data in Fig. 5A illustrate that treatment of Hep3B cells with 50 µM MSC led to a time-dependent increase in GJ levels. The increased GJ activity was associated with increased Cx32 expression, as evidenced by Western blot analysis (Fig. 5B). Subsequent semiquantitative endpoint RT-PCR and real-time quantitative RT-PCR data uniformly revealed no change in the level of the Cx32 transcript (Figs. 5C, D), suggesting that the MSC-induced increase in Cx32 expression in Hep3B cells occurred at the posttranscriptional level. Thus, MSC increased GJ function in both transformed and cancerous cell lines due to increased structural Cx expression through a posttranscriptional mechanism. Subsequently, we further assessed the effects of cell density and MSC on etoposide cytotoxicity in primary Hep3B cell line, and results showed MSC sensitized these cells to etoposide with a cell density-dependent fashion (Figs. 5E, F).

Fig. 5. Effect of MSC on Functional GJs, Cx32 Expression and Etoposide Cytotoxicity in Hep3B Cells

(A) Functional GJ activity measured using the “parachute” dye coupling assay after exposure to 50 µM MSC for the indicated times. (B) Cx32 protein expression determined using Western blot after exposure to 50 µM MSC for the indicated periods. (C) Agarose gel electrophoresis of RT-PCR products indicates that MSC exposure does not alter the expression of the Cx32 mRNA (Lanes 3–5 vs. Lanes 1 and 2). (D) Quantification of the Cx32 mRNA using real-time quantitative RT-PCR assay confirmed the results of the semiquantitative RT-PCR assay. (E) Effect of cell density on the cytotoxicity of etoposide in Hep3B. Cells were treated with etoposide (4 µM) for 1 h, and the fraction of surviving cells was determined using the standard colony-forming assay. (F) The clonogenic survival of Hep3B cells treated with 4 µM etoposide with or without 50 µM MSC pretreatment cultures. Hep3B cells were cultured for 48 h before MSC treatment. * p < 0.05, significantly different from the vehicle control (A, B and F) and the low-density group treated with etoposide (E). # p < 0.05, significantly different from the 4 h group (A) and the etoposide group cultured at a high density (B).

A GSH-Dependent Mechanism Is Involved in the MSC-induced Increase in GJ Function

We postulated a possible role of the redox state of the cells involved to explore the mechanism by which MSC posttranscriptionally altered Cx26 expression. This hypothesis was first tested by applying oxidizing and reducing agents that modify the cellular redox status. Dithiothreitol (DTT, 250 µM) and reduced glutathione (GSH, 50 µM), two reducing agents that increase the GSH content, mimicked the effect of MSC and their co-application with MSC did not further increase GJ levels, whereas oxidizing agents such as arsenic trioxide (As₂O₃, 2 µM) and diethyl maleate (DEM, 500 µM), a depleting agent of cellular GSH, counteracted the effect of MSC on GJ intercellular communications (Fig. 6A).

Fig. 6. The GSH Status Is Involved in the MSC-Induced Increase in Cx Expression and GJ Function in Cx26/Cx32-Expressed HeLa Cells

(A) GJ function was measured in the absence (control) and presence of MSC (50 µM) with or without either arsenic trioxide (As₂O₃; 2 µM), diethyl maleate (DEM; 500 µM), reduced glutathione (GSH; 50 µM), or dithiothreitol (DTT; 250 µM) for 4 h. (B–D) BSO (10 µM) was used to deplete GSH in cells. Cells were treated with either drug or the combined agents concomitantly for 48 h, after which GSH levels were measured with the dye CMFDA, as described in Materials and Methods (B). The inhibitory effect of BSO on the MSC-induced increase in Cx26 expression (C) and GJ activity (D) in GSH-deficient HeLa cells was detected using Western blot and the “parachute” dye coupling assay, respectively. * p < 0.05, significantly different from the control. # p < 0.05, significantly different from MSC treatment alone.

L-Buthionine sulfoximine (BSO), a specific inhibitor of γ-glutamylcysteine synthetase that catalyzes the rate-limiting step of GSH biosynthesis, was used to obtain additional insights into the mechanism involving the modulation of the GSH redox system.²⁸⁾ As illustrated in Fig. 6B, treatment of Cx26/Cx32-expressed HeLa cells with 10 µM BSO for 48 h caused a 46% decrease in intracellular GSH levels. When these GSH-deficient cells were treated with MSC, no effect on Cx26 expression was observed, and BSO alone did not alter Cx26 expression (Fig. 6C). Consistent with these observations, decreasing intracellular GSH by treatment with BSO alone did not affect GJs, whereas the increased activity of GJs induced by MSC was prevented in these cells deficient in GSH (Fig. 6D). Therefore, the MSC-induced increases in Cx expression and GJs required the presence of abundant GSH in these cells.

DISCUSSION

Based on previous reports,^13,29) we identified an important GJ-dependent component of toxicity induced by toxic agents. This component is not present in low-density cultures that lack cell-cell contacts. Essentially, most cytotoxic anticancer drugs (including etoposide) commonly used to treat human malignancies ultimately kill cancer cells primarily by inducing apoptosis. Etoposide-induced apoptosis occurs between 3 and 4 h after etoposide treatment.^30,31) Etoposide was also shown to rapidly downregulate the expression of several caspases and Bcl-2-related genes³²⁾ and cause the dephosphorylation of replicative DNA ligase I as early as 1 h after etoposide exposure,³⁰⁾ which causes an early cellular response that may further lead to remarkable GJ-dependent cytotoxicity compared to cisplatin and 5-fluorouracil. Nevertheless, the cellular events triggered by etoposide within the timeframe examined were not determined in the present study, and ample opportunity exists for the GJ transmission of the chemical signals that promote toxicity in response to short-term treatment with etoposide. Unlike etoposide, fluorouracil cytotoxicity was not remarkedly affected by cell density as observed in our study. We speculated this phenomenon may be related to the distinct identities of the indicated chemotherapeutic agents, as they possess different molecular mechanisms and cell response pattern to the same stimuli. A component of fluorouracil-mediated cytotoxicity independent on GJ intercellular communication was previously reported,³³⁾ thus the possibility that the cell density-induced cytotoxicity for fluorouracil may not be significant enough to be observed cannot be ruled out.

The concentration of etoposide used in our study was much lower than^13,14) (15–50 µM) or the same as¹⁶⁾ (0–8 µM) that used in most in vitro studies, and within the peak plasma concentration (3–5 µg/mL) that avoids severe toxicity during chemotherapy.³⁴⁾ The use of this paradigm leads to moderate cell killing by etoposide and allows us to reveal a clinically relevant regulatory role for etoposide that would be obscured by the use of higher, supra-therapeutic concentrations. As etoposide kills all cells directly when administered at higher, clinically irrelevant concentrations, one would not expect GJs to play a significant role in the endpoint. At clinically appropriate concentrations for use, however, toxic products produced in one cell can pass through the GJs into another cell, promoting the death of adjacent cells that might not otherwise be affected by this drug, and in turn, these cells may generate their own toxic products through a positive feedback mechanism.

Specifically, the present study investigates the effect of MSC on the cytotoxic action of etoposide in a transformed HeLa cell line. An enhanced cytotoxic effect of etoposide was observed when it was administered in combination with a nontoxic concentration of MSC in vitro. The MSC-induced increase in etoposide toxicity was only observed in cells with functional GJs and not in high-density cultures with no Cx expression or in low-density cultures. This observation establishes a GJ-dependent mechanism for the effect of MSC on etoposide toxicity. The mechanism was further revealed by studies showing that MSC enhanced GJ function in these cells. This enhancement of GJ function is a novel effect of MSC, which may at least partially explain the role of MSC as chemotherapeutic modulators.

According to previous studies, pretreatment with MSC is crucial to enhance the antitumor activity of chemotherapeutic agents.^6,7) Our results are consistent with these published data. For cytotoxicity experiments, cells were pre-exposed to MSC for 3 h, followed by 1 h of exposure to both MSC and etoposide, with toxicity assessed by measuring clonogenic survival 7 d later. Therefore, any modulation of etoposide toxicity by changes in GJs must occur during the 1 h exposure to etoposide. Following pre-exposure to MSC, a substantial increase in the toxic effect of etoposide was observed. We hypothesize that the stimulation of GJs during the MSC pre-exposure facilitates the intercellular transmission of etoposide-induced toxic signaling within or shortly after 1 h of etoposide exposure.

Furthermore, treatment of Cx26/Cx32-expressed HeLa cells with nontoxic concentrations of MSC increased the amount of the structural Cx protein but not the level of the Cx mRNA. Additional support is provided by experiments using the hepatoma cell line Hep3B. Thus, MSC enhanced GJ function by modulating structural Cx expression through a posttranscriptional mechanism in both transformed and primary cancer cell lines, suggesting a common characteristic of the cellular response to MSC treatment. GSH is intimately involved in the metabolism and bioactivity of selenium and its compounds.^35,36) For example, at low concentrations, MSC acts as an antioxidant; however, after the conversion of high concentrations of MSC to methylselenol, it is directly oxidized to methylseleninic acid or may react with O₂ to produce superoxide and reactive oxygen species (ROS), resulting in the oxidation of the sulfhydryl groups in cysteine clusters within the catalytic domains of cellular enzymes (e.g., protein kinase C).^3,37) GSH is the main intracellular thiol-based antioxidant and plays an important role in these reduction–oxidation reactions. Although MSC had little effect on the cellular GSH level in HeLa cells, as shown in Fig. 6B, the effect of MSC on Cx expression was lost upon the induction of oxidative stress by BSO treatment, arguing that the onset of the proper action of MSC requires the facilitating role of reduction within the cell to be maintained.

Cxs are redox-sensitive proteins^38,39); thus, changes in the redox state byproducts of selenium metabolism generated by MSC treatment are proposed as possible explanations. Therefore, a redox-dependent mechanism of Cx posttranscriptional regulation due to the maintenance of cellular thiol was proposed. We hypothesized that MSC is metabolized to a certain form in the reduced state in the presence of GSH that then interacts with the Cx protein at three cysteine sites existing in the extracellular loops of Cxs⁴⁰⁾ to stabilize the rigid tertiary structure of proteins, resulting in decreased Cx degradation and enhanced GJ activity. Another possible mechanism may be the inhibition of proteolytic activity of lysosomes by selenometabolites. Studies have supported the involvement of the lysosome in the degradation of Cxs present in GJ plaques.^41,42) The lysosome contains a number of different proteases, and most of the proteolytic activity is due to cysteine proteases known as cathepsins, which are redox-sensitive proteins.⁴³⁾ Taken together, the results suggest that GSH is an integral component of the mechanism underlying the MSC-induced increases in Cx expression and GJ activity in HeLa cells. Future studies are needed to determine the cellular molecules targeted by MSC in the GSH-related signaling pathway.

In conclusion, we identified GJs as novel targets of MSC and, for the first time, provided a mechanistic link between the chemomodulatory activity of MSC and GJ modulation. If translatable to in vivo studies, our findings will have important implications for improving the therapeutic efficacy of these and possibly other chemotherapeutic modalities based on the biology of different cells and highlight the potential clinical benefit of selenium as a promising selective modulator of cancer chemotherapy.

Acknowledgments

This work was supported by the Natural Science Foundation of Anhui Province (Grant No. 2008085MH238), the Translational Medicine Key Project of Bengbu Medical College (Grant No. BYTM2019009), the 512 Talent Cultivation Plan of Bengbu Medical College (Grant No. by51202208) and the Science Fund for Distinguished Young Scholars of the First Affiliated Hospital of Bengbu Medical College (No. 2019byyfyjq02).

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Rayman MP. Selenium and human health. Lancet, 379, 1256–1268 (2012).
• 2) Kuršvietienė L, Mongirdienė A, Bernatonienė J, Šulinskienė J, Stanevičienė I. Selenium anticancer properties and impact on cellular redox status. Antioxidants (Basel), 9, 80 (2020).
• 3) Weekley CM, Harris HH. Which form is that? The importance of selenium speciation and metabolism in the prevention and treatment of disease. Chem. Soc. Rev., 42, 8870–8894 (2013).
• 4) Last K, Maharaj L, Perry J, Strauss S, Fitzgibbon J, Lister TA, Joel S. The activity of methylated and non-methylated selenium species in lymphoma cell lines and primary tumours. Ann. Oncol., 17, 773–779 (2006).
• 5) Marschall TA, Bornhorst J, Kuehnelt D, Schwerdtle T. Differing cytotoxicity and bioavailability of selenite, methylselenocysteine, selenomethionine, selenosugar 1 and trimethylselenonium ion and their underlying metabolic transformations in human cells. Mol. Nutr. Food Res., 60, 2622–2632 (2016).
• 6) Cao S, Durrani FA, Tóth K, Rustum YM. Se-methylselenocysteine offers selective protection against toxicity and potentiates the antitumour activity of anticancer drugs in preclinical animal models. Br. J. Cancer, 110, 1733–1743 (2014).
• 7) Rustum YM, Chintala S, Durrani FA, Bhattacharya A. Non-coding micro RNAs and hypoxia-inducible factors are selenium targets for development of a mechanism-based combination strategy in clear-cell renal cell carcinoma-bench-to-bedside therapy. Int. J. Mol. Sci., 19, 3378 (2018).
• 8) Jüliger S, Goenaga-Infante H, Lister TA, Fitzgibbon J, Joel SP. Chemosensitization of B-cell lymphomas by methylseleninic acid involves nuclear factor-kappaB inhibition and the rapid generation of other selenium species. Cancer Res., 67, 10984–10992 (2007).
• 9) Wu JI, Wang LH. Emerging roles of gap junction proteins connexins in cancer metastasis, chemoresistance and clinical application. J. Biomed. Sci., 26, 8 (2019).
• 10) Aasen T, Leithe E, Graham SV, Kameritsch P, Mayán MD, Mesnil M, Pogoda K, Tabernero A. Connexins in cancer: bridging the gap to the clinic. Oncogene, 38, 4429–4451 (2019).
• 11) He B, Tong X, Wang L, Wang Q, Ye H, Liu B, Hong X, Tao L, Harris AL. Tramadol and flurbiprofen depress the cytotoxicity of cisplatin via their effects on gap junctions. Clin. Cancer Res., 15, 5803–5810 (2009).
• 12) Yang Y, Zhu J, Zhang N, Zhao Y, Li WY, Zhao FY, Ou YR, Qin SK, Wu Q. Impaired gap junctions in human hepatocellular carcinoma limit intrinsic oxaliplatin chemosensitivity: a key role of connexin 26. Int. J. Oncol., 48, 703–713 (2016).
• 13) Kalvelyte A, Imbrasaite A, Bukauskiene A, Verselis VK, Bukauskas FF. Connexins and apoptotic transformation. Biochem. Pharmacol., 66, 1661–1672 (2003).
• 14) Huang RP, Hossain MZ, Huang R, Gano J, Fan Y, Boynton AL. Connexin 43 (cx43) enhances chemotherapy-induced apoptosis in human glioblastoma cells. Int. J. Cancer, 92, 130–138 (2001).
• 15) Shishido S, Nguyen TA. Combinational treatment of gap junction enhancers and paclitaxel attenuates mammary tumor growth. Anticancer Drugs, 31, 353–358 (2020).
• 16) Wang L, Fu Y, Peng J, Wu D, Yu M, Xu C, Wang Q, Tao L. Simvastatin-induced up-regulation of gap junctions composed of connexin 43 sensitize Leydig tumor cells to etoposide: an involvement of PKC pathway. Toxicology, 312, 149–157 (2013).
• 17) Yang CJ, Kuo CT, Wu LH, Chen MC, Pangilinan CR, Phacharapiyangkul N, Liu W, Chen YH, Lee CH. Eicosapentaenoic acids enhance chemosensitivity through connexin 43 upregulation in murine melanoma models. Int. J. Med. Sci., 16, 636–643 (2019).
• 18) Lu Z, Qi L, Li GX, Bo XJ, Liu GD, Wang JM. Se-methylselenocysteine suppresses the growth of prostate cancer cell DU145 through connexin 43-induced apoptosis. J. Cancer Res. Ther., 11, 840–845 (2015).
• 19) Koreen IV, Elsayed WA, Liu YJ, Harris AL. Tetracycline-regulated expression enables purification and functional analysis of recombinant connexin channels from mammalian cells. Biochem. J., 383, 111–119 (2004).
• 20) Jensen R, Glazer PM. Cell-interdependent cisplatin killing by Ku/DNA-dependent protein kinase signaling transduced through gap junctions. Proc. Natl. Acad. Sci. U.S.A., 101, 6134–6139 (2004).
• 21) Hong X, Wang Q, Yang Y, Zheng S, Tong X, Zhang S, Tao L, Harris AL. Gap junctions propagate opposite effects in normal and tumor testicular cells in response to cisplatin. Cancer Lett., 317, 165–171 (2012).
• 22) Yang Y, Qin SK, Wu Q, Wang ZS, Zheng RS, Tong XH, Liu H, Tao L, He XD. Connexin-dependent gap junction enhancement is involved in the synergistic effect of sorafenib and all-trans retinoic acid on HCC growth inhibition. Oncol. Rep., 31, 540–550 (2014).
• 23) Khamphio M, Barusrux S, Weerapreeyakul N. Sesamol induces mitochondrial apoptosis pathway in HCT116 human colon cancer cells via pro-oxidant effect. Life Sci., 158, 46–56 (2016).
• 24) Wang Q, You T, Yuan D, Han X, Hong X, He B, Wang L, Tong X, Tao L, Harris AL. Cisplatin and oxaliplatin inhibit gap junctional communication by direct action and by reduction of connexin expression, thereby counteracting cytotoxic efficacy. J. Pharmacol. Exp. Ther., 333, 903–911 (2010).
• 25) Shi G, Zheng X, Wu X, Wang S, Wang Y, Xing F. All-trans retinoic acid reverses epithelial-mesenchymal transition in paclitaxel-resistant cells by inhibiting nuclear factor kappa B and upregulating gap junctions. Cancer Sci., 110, 379–388 (2019).
• 26) Liu Y, Wen Q, Chen XL, Yang SJ, Gao L, Gao L, Zhang C, Li JL, Xiang XX, Wan K, Chen XH, Zhang X, Zhong JF. All-trans retinoic acid arrests cell cycle in leukemic bone marrow stromal cells by increasing intercellular communication through connexin 43-mediated gap junction. J. Hematol. Oncol., 8, 110 (2015).
• 27) Schmittgen TD, Zakrajsek BA, Mills AG, Gorn V, Singer MJ, Reed MW. Quantitative reverse transcription-polymerase chain reaction to study mRNA decay: comparison of endpoint and real-time methods. Anal. Biochem., 285, 194–204 (2000).
• 28) Pasternak T, Palme K, Paponov IA. Glutathione enhances auxin sensitivity in arabidopsis roots. Biomolecules, 10, 1550 (2020).
• 29) Yang Y, Cao MH, Wang Q, Yuan DD, Li L, Tao L. The effects of 2-aminoethoxydiphenyl borate and diphenylboronic anhydride on gap junctions composed of Connexin43 in TM₄ sertoli cells. Biol. Pharm. Bull., 34, 1390–1397 (2011).
• 30) Rossi R, Montecucco A, Donzelli M, Denegri M, Biamonti G, Scovassi A. DNA ligase I is dephosphorylated during the execution step of etoposide-induced apoptosis. Cell Death Differ., 9, 89–90 (2002).
• 31) Soldani C, Bottone MG, Pellicciari C, Scovassi AI. Two-color fluorescence detection of Poly (ADP-Ribose) Polymerase-1 (PARP-1) cleavage and DNA strand breaks in etoposide-induced apoptotic cells. Eur. J. Histochem., 45, 389–392 (2001).
• 32) Rincheval V, Bergeaud M, Mathieu L, Leroy J, Guillaume A, Mignotte B, Le Floch N, Vayssière JL. Differential effects of Bcl-2 and caspases on mitochondrial permeabilization during endogenous or exogenous reactive oxygen species-induced cell death: a comparative study of H₂O₂, paraquat, t-BHP, etoposide and TNF-α-induced cell death. Cell Biol. Toxicol., 28, 239–253 (2012).
• 33) Lawrence TS, Rehemtulla A, Ng EY, Wilson M, Trosko JE, Stetson PL. Preferential cytotoxicity of cells transduced with cytosine deaminase compared to bystander cells after treatment with 5-flucytosine. Cancer Res., 58, 2588–2593 (1998).
• 34) Toffoli G, Corona G, Basso B, Boiocchi M. Pharmacokinetic optimisation of treatment with oral etoposide. Clin. Pharmacokinet., 43, 441–466 (2004).
• 35) Baltaci AK, Mogulkoc R, Akil M, Bicer M. Review—selenium—its metabolism and relation to exercise. Pak. J. Pharm. Sci., 29, 1719–1725 (2016).
• 36) Tsutsumi R, Saito Y. Selenoprotein P; P for plasma, prognosis, prophylaxis, and more. Biol. Pharm. Bull., 43, 366–374 (2020).
• 37) Drake EN. Cancer chemoprevention: selenium as a prooxidant, not an antioxidant. Med. Hypotheses, 67, 318–322 (2006).
• 38) Zhang K, Guan QW, Zhou XY, Xia QX, Yin XX, Zhou HH, Mao XY. The mutual interplay of redox signaling and connexins. J. Mol. Med., 99, 933–941 (2021).
• 39) Quan Y, Du Y, Wu C, Gu S, Jiang JX. Connexin hemichannels regulate redox potential via metabolite exchange and protect lens against cellular oxidative damage. Redox Biol., 46, 102102 (2021).
• 40) Beyer EC, Berthoud VM. Gap junction gene and protein families: Connexins, innexins, and pannexins. Biochim. Biophys. Acta Biomembr., 1860, 5–8 (2018).
• 41) Falk MM, Kells RM, Berthoud VM. Degradation of connexins and gap junctions. FEBS Lett., 588, 1221–1229 (2014).
• 42) Kam CY, Dubash AD, Magistrati E, Polo S, Satchell KJF, Sheikh F, Lampe PD, Green KJ. Desmoplakin maintains gap junctions by inhibiting Ras/MAPK and lysosomal degradation of connexin-43. J. Cell Biol., 217, 3219–3235 (2018).
• 43) Lalmanach G, Saidi A, Bigot P, Chazeirat T, Lecaille F, Wartenberg M. Regulation of the proteolytic activity of cysteine cathepsins by oxidants. Int. J. Mol. Sci., 21, 1944 (2020).