Transient ETV2 Expression Promotes the Generation of Mature Endothelial Cells from Human Pluripotent Stem Cells

Abstract

Differentiation protocols are used for induced pluripotent stem cells (iPSCs) in in vitro disease modeling and clinical applications. Transplantation of endothelial cells (ECs) is an important treatment strategy for ischemic diseases. For example, in vitro generated ECs can be used to provide the vascular plexus to regenerate organs such as the liver. Here, we demonstrate that the E-twenty-six (ETS) transcription factor ETV2 alone can directly convert iPSCs into vascular endothelial cells (iPS-ETV2-ECs) with an efficiency of over 90% within 5 d. Although the stable overexpression of ETV2 induced the expression of multiple key factors for endothelial development, the induced ECs were less mature. Furthermore, doxycycline-inducible transient ETV2 expression could upregulate the expression of von Willebrand factor (vWF) in iPS-ETV2-ECs, leading to a mature phenotype. The findings of this study on generation of mature iPS-ETV2-ECs provide further insights into the exploration of cell reprogramming from iPSCs. Here, we provide a new protocol for differentiation of iPSCs, thus providing a new source of ECs for in vitro disease modeling and clinical applications.

INTRODUCTION

Induced pluripotent stem cells (iPSCs) have an unlimited proliferation capacity and the potential to differentiate into somatic cell types.^1,2) Ideally, they can provide an inexhaustible source of various cells for clinical and scientific research. Patient-specific iPSCs have the ability to reveal the molecular and genetic mechanisms of the particular disease.^3–5) However, effective, stable, and rapid differentiation methods are needed for the application of iPSCs to disease modeling, cell therapy, and drug research.

Endothelial cells (ECs) are a key component of the vasculature and are essential for repair of injured or ischemic tissues.^6–8) However, the number of cells is limited, and the function of primary ECs deteriorates over time in an in vitro environment.⁹⁾ This necessitates the exploration of alternative EC sources in vitro.

Recently, several methods for generating ECs from human pluripotent stem cells have been reported. Adams et al. developed a method to differentiate human iPSCs into embryoid bodies (EBs) and isolate the endothelial population on day 10.¹⁰⁾ Harding et al. generated ECs from human iPSCs through mesoderm and early vascular progenitors within 8 d.¹¹⁾ Vilà-González et al. cultured iPS cells in EGM-2 media with vascular endothelial growth factor (VEGF), fibroblast growth factor 2 (FGF2), and LY364947, and obtained iPS-ECs after cell sorting.¹²⁾ However, all these methods contain a mesoderm stage or require cell sorting to obtain a pure population of ECs, leading to a long and complex differentiation process requiring 10 d or more.

ETV2, a member of the E-twenty-six (ETS) family of transcription factors, regulates vascular development and angiogenesis,^13–15) drives the expression of genes associated with EC development and function.¹⁶⁾ Recently, several studies have shown that ETV2 can directly convert somatic cells into ECs.^17–20) However, differentiation procedures are complex and time consuming. Here, we demonstrated an efficient protocol for the generation of mature ECs from iPSCs using doxycycline-inducible transient ETV2 expression.

MATERIALS AND METHODS

Cell Cultures

The human iPS cell line iMR90-4²⁾ was cultured in mTeSR1 medium (StemCell Technologies, Inc., Bancouver, Canada), with the medium replaced daily. The cells were passaged into a growth factor-reduced BD Matrigel basement membrane matrix (BD Biosciences, Franklin Lakes, NJ, U.S.A.) with TrypLE Select Enzyme (ThermoFisher Scientific, Waltham, MA, U.S.A.). Human umbilical vein endothelial cells from Lonza (Basel, Switzerland) were grown in basal medium (EGM-2, Lonza).

Lentivirus Production

Human ETV2 cDNA was subcloned into the NotI/BamHI sites of the CSII-EF-MCS-IRES2-Venus lentivirus vector (RIKEN BioResource Center, Ibaraki, Japan). For the inducible ETV2 expression system, the EF-1α promoter, which is derived from CSII-EF-MCS-IRES2-Venus, was inserted into the AgeI site of CSIV-TRE-RfA-CMV-KT (RIKEN BioResource Center), creating CSIV-TRE-RfA-EF-KT, which has a Tet-responsive promoter. pENTR1A-ETV2 was generated by subcloning the CSII-EF-ETV2-IRES2-Venus into the pENTR1A (ThermoFisher Scientific) vector using EcoRI/BamHI sites. The LR recombination reaction between the entry plasmid vector pENTR1A-ETV2 and gateway destination vector CSIV-TRE-RfA-EF-KT was performed to generate the CSIV-TRE-EF-ETV2-KT using the Gateway LR Clonase Plus enzyme mix according to the instructions of manufacturer (ThermoFisher Scientific).

To generate lentiviruses, 293T cells were transfected by the vectors (CSII-EF-MCS-IRES2-Venus, CSII-EF-ETV2-IRES2-Venus, or CSIV-TRE-EF-ETV2-KT) with packaging plasmids (pCMV-VSV-G-RSV-Rev and pCAG-HIVgp) using Lipofectamine 2000 (ThermoFisher Scientific). After 24 h, the culture medium containing vector was changed with fresh culture medium, following which the medium containing lentivirus was collected by a 0.45μm filter after 48 h, and concentrated by centrifugation (20000 rpm at 20 °C for 2h). Lentivirus particles were collected in HBSS (NACALAI TESQUE, Kyoto, Japan).

Generation of Doxycycline-Inducible ETV2-iPS Cells

The iMR90-4 cells were infected with lentivirus, dissociated using Accutase (Merk-Millipore, Burlington, MA, U.S.A.), and resuspended in mTeSR1 supplemented with 10 μm Y27632 (Wako, Osaka, Japan). Kusabira-Orange⁺ cells were collected using an SH800 cell sorter (SONY, Tokyo, Japan). The transient ETV2 induced iPSCs-ECs differentiation was conducted in Dox-inducible ETV2- iPS cells Clone #11, #13, #23, and we described the results of Clone #11 here.

Generation of Endothelial Cells from iPS Cells

The differentiation protocol for the induction of ECs from iPSCs is described below. The single iPS cells in mTeSR1 medium were seeded onto Matrigel using Accutase. After 24 h, the cells were infected with lentivirus particles (MOI: 5) for 24 h in the medium of human endothelial serum-free medium (hESFM; ThermoFisher Scientific) with 1% of human platelet-derived serum (PDS; Sigma) and 20 ng/mL human fibroblast growth factor (bFGF; Katayama Kagaku Kogyo, Osaka, Japan) supplementation, and then maintained for 4 d.

Flow Cytometric Analysis

Cells (3 × 10⁴ to 1 × 10⁵) suspension containing an APC anti-human CD31 Antibody (clone: WM59, Biolegend, San Diego, CA, U.S.A.) and a Phycoerythrin (PE)-conjugated mouse monoclonal antibody to human VE Cadherin (CD144/CDH5) (clone: 16B1, e-Bioscience, San Diego, CA, U.S.A.) were incubated at 4 °C for 30 min. Then cells were washed twice using FACS buffer (2% fetal bovine serum (FBS) in phosphate buffered saline (PBS)). Data acquisition was conducted on an LSRFortessa Cell Analyzer flow cytometer (BD Bioscience), and the data analysis was performed using FlowJo software (ThermoFisher Scientific).

Reverse Transcription and Quantitative PCR (RT-qPCR)

SuperScript VILO cDNA Synthesis Kit (ThermoFisher Scientific) was used to generate first-strand cDNA. The resulting RNA was isolated using the normal protocol for RNAiso Plus (TaKaRa, Shiga, Japan). The mRNA quantification of ETV2, kinase insert domain receptor (KDR, vascular endothelial growth factor receptor (VEGFR)-2), tunica internal endothelial cell kinase (Tie2), vascular endothelial cadherin (VE-cad), platelet endothelial cell adhesion molecule (PECAM1, CD31), CD34, von Willebrand factor (vWF), Nanog, and octamer-binding transcription factor (Oct3/4) were performed using the SYBR Green detection system (Applied-Biosystems, Waltham, MA, U.S.A.). Quantitative gene expression data were normalized to the expression levels of control gene, the housekeeping gene glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The primer sequences used in this study are listed in Table 1.

Table 1. Primer List Used in Quantitative Real-Time PCR

Gene name	(5′) Forward primers (3′)	(5′) Reverse primers (3′)
GAPDH	GGTGGTCTCCTCTGACTTCAACGT	GTGGTCGTTGAGGGCAATG
ETV2	AGGGAACAAGCTGGCAGGGCTTGAA	TCCAGCATGTCTCTGCTGTCGCTGT
KDR	ACTTTGGAAGACAGAACCAAATTATCTC	TGGGCACCATTCCACCA
Tie2	GCTAGAGTCAACACCAAGGCC	TCCAAGAAATCACAGCTGAGGA
VE-cad	TCACGATAACACGGCCAACA	TGGCATCCCATTGTCTGAGA
PECAM1	GAGTATTACTGCACAGCCTTCA	AACCACTGCAATAAGTCCTTTC
CD34	CTACAACACCTAGTACCCTTGGA	GGTGAACACTGTGCTGATTACA
vWF	AGTGCAGACCCAACTTCACC	GTGGGGACACTCTTTTGCAC
Nanog	AGAAGGCCTCAGCACCTAC	GGCCTGATTGTTCCAGGATT
Oct3/4	CTTGAATCCCGAATGGAAAGGG	GTGTATATCCCAGGGTGATCCTC

Immunocytochemistry

Wash the cells with PBS at room temperature, and fix them using 4% paraformaldehyde (PFA: Wako) for 10 min. After PBS washing, the cells were incubated with Normal Goat Serum (10%, Wako) in PBS supplemented with 0.1% Triton-X for 1 h at room temperature. Then cells were stained with a rabbit anti-vWF antibody (diluted 1 : 200; Dako, Jena, Germany) at 4 °C overnight.

Incubate the cells with Alexa Fluor 594-conjugated secondary antibodies (1 : 1000; ThermoFisher Scientific) for 1 h at room temperature. The cells were washed and labeled with 4′6-diamidino-2-phenylindol (DAPI: Sigma). The green fluorescent images in the cells were monitored using a BZ-X700 microscope (KEYENCE, Osaka, Japan).

Tube-Formation Assay

Cells were seeded on 96-well flat-bottom plates coated with Matrigel at a density of 2 × 10⁴ cells/mL and cultured in EBM-2 medium supplemented with 100 ng/mL VEGF (Peprotech). After 18 h of incubation, the cells were observed under a microscope.

Western Blot Analysis

The resulting cells were washed 3 times with sterile PBS and lysed in Radio-Immunoprecipitation assay buffer (RIPA buffer, ThermoFisher Scientific) plus Protease Inhibitor Cocktail Tablets (Roche, Basel, Switzerland). The solubilized proteins were separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (Wako) and transferred to polyvinylidene fluoride membranes (Merk-Millipore) membranes. The nitrocellulose membrane was blocked with 5% skim milk in TBS containing 0.1% Tween 20 for 1 h at room temperature. And then incubate the membrane with a mouse anti-ETV2 antibody (diluted 1 : 1000; Abcam, Cambridge, U.K.), or a mouse monoclonal beta Actin antibody (diluted 1 : 5000; Sigma-Aldrich) at 4 °C overnight, followed by incubation with Rabbit immunoglobulin G (IgG) horseradish peroxidase (HRP)-conjugated Antibody (Cell Signaling Technology) or Mouse IgG HRP-conjugated Antibody (Cell Signaling Technology) for 1 h at room temperature. ECL Plus Western blotting detection reagents (ThermoFisher Scientific) were used to detect target protein bands, and the Immunoreactivity signals were visualized to acquire the images using a LAS-4000 imaging system (FUJIFILM, Tokyo, Japan).

Statistical Analysis

One-way ANOVA followed by Tukey’s post hoc test was used for comparisons between more than two groups. Unpaired parametric two-tailed t tests were used for comparisons between two groups.

RESULTS

Efficient Differentiation of iPSCs to ECs Using ETV2

Prior to differentiation, iPS cells were passaged onto Matrigel in mTeSR1 medium to maintain undifferentiated state. To generate ECs from iPSCs, cultured iPSCs were transduced with lentiviral vectors containing cDNA for ETV2 or no insert (control), as illustrated in Fig. 1A. Based on Stem cells-derived ECs differentiations under serum-free conditions supplemented,^21,22) we conducted the differentiation in EC medium with bFGF for 4 d. EC-like morphology in ETV2 transduced cells was observed, whereas this change was not evident in the control group (Fig. 1B). Flow cytometry analysis revealed that the ETV2 transduced cells were positive for Venus expression, and the CD31⁺CD144⁺ population in the cells reached 95% on day 5 (Fig. 1C), suggesting that ETV2 is sufficient for the rapid, high efficiency conversion of iPSCs into ECs (iPS-ETV2-ECs).

Fig. 1. Differentiation of Human iPSCs into ECs with ETV2

(A) Schematic of the EC differentiation protocol. (B) Images of the two representative colonies at day 5 after culture with transduction of Mock or ETV2. One representative image from five independent experiments is shown. Scale bar = 300 μm. (C) Flow cytometry analysis of iPSCs with transduction of Mock or ETV2 (day 5) after staining with anti-CD31 and anti-CD144 antibodies Viable cells were gating to analyze the expression of surface markers using Forward Versus Side Scatter (FSC vs. SSC). The dot plot analysis, representative of one out of five independent experiments is shown.

Furthermore, 5 d after transduction, gene expression levels of ETV2 and multiple endothelial development factors (KDR, Tie2, VE-Cad, PECAM1, CD34, and vWF) were measured using quantitative RT-PCR. ETV2 expression level was significantly increased in iPS-ETV2-ECs compared to the control group (Fig. 2A). Gene expression levels of KDR, Tie2, VE-Cad, PECAM1, and CD34 were upregulated in ETV2 transduced cells compared to those in the control group (Fig. 2A). The expressions of KDR, Tie2 and CD34 in iPS-ETV2-ECs were higher than those in HUVECs, consistent with the primary reports that the enforced ETV2 expression would upregulate genes expression in the endothelial lineage.^23–25) No significant differences were observed in the mRNA expression of PECAM1 and VE-Cad between iPS-ETV2-ECs and HUVECs (Fig. 2A). In contrast, the mRNA expression level of vWF (a mature endothelial marker)^26,27) was significantly lower in iPS-ETV2-ECs than in HUVECs (Fig. 2A). Immunocytochemistry revealed that the expression of vWF protein in iPS-ETV2-ECs was significantly lower than that in HUVECs (Fig. 2B), consistent with the formation of capillary-like structures on Matrigel-coated plates (Fig. 2C). Overall, these results demonstrate that iPSC-derived ECs were less mature with stable overexpression of ETV2.

Fig. 2. Endothelial Characterization of iPS-ETV2-ECs

(A) qRT-PCR analysis of purified RNA from HUVECs, Control and iPS-ETV2-ECs (day 5). Gene expression levels are relative to GAPDH. Data are represented as the mean +/− standard deviation (S.D.) from three independent experiments (* p < 0.05). (B) Immunohistochemistry showing expression of vWF protein (Red) in iPS-ETV2-ECs (day 5) compared to HUVECs. One representative image from three independent experiments is shown. Scale bar = 100 μm. (C) In vitro tube formation assay of iPS-ETV2-ECs and HUVECs cultured on Matrigel in hESFM supplemented with PDS, bFGF, and VEGF for 18 h. One representative image from three independent experiments is shown. Scale bar = 300 μm.

Maturation of iPSCs-Derived ECs with Transient ETV2 Expression

Several studies have shown that ETV2 is the main regulator of EC development in the primordial mesoderm. However, its expression is transient in early mouse embryos, and mature ECs do not express ETV2.¹⁰⁾ Thus, we believed that the stable overexpression of ETV2 inhibited the maturation of iPSC-derived ECs.

ETV2 expression was regulated using a doxycycline-inducible system based on a reverse tetracycline-controlled transactivator (rtTA) and tetracycline-responsive element promoter (TRE) (Fig. 3A). iPSCs transfected with DOX-inducible lentiviral showed Kusabira orange (KO)-positive in Clone #11, indicating that interest gene had been readily inserted to iPSC (Figs. 3B, C). The clone maintained the iPSC identity for expression of undifferentiation marker genes, such as Nanog and Oct-3/4, while expressing ETV2 functionally with the Dox-inducible system (Figs. 3D, E).

Fig. 3. The Expression of Undifferentiation Markers in Dox-Inducible ETV2-iPS Cells

(A) The doxycycline-inducible system with reverse tetracycline-controlled transactivator (rtTA) and tetracycline-responsive element promoter (TRE). (B) Phase-contrast micrographs of undifferentiation in Dox-inducible ETV2-iPS cells. One representative image from five independent experiments is shown. Scale bar = 300 μm. (C) Kusabira-orange (KO) expression levels were analyzed using Flow Cytometry (FC). Viable cells were gating to analyze the expression of surface markers using Forward Versus Side Scatter (FSC vs. SSC). A representative data from one out of five independent experiments is shown. (D) Nanog and Oct3/4 expression level were analyzed using Reverse Transcription Quantitative PCR. In the cells of control group (no transduction) expression level of gene were set to 1.0. Data are represented as the mean +/− S.D. from three independent experiments. (E) Cells were treated with 0.05 ng/mL and 0.1 ng/mL Dox, and ETV2 expression level was analyzed using real-time PCR. Data are represented as the mean +/− S.D. from three independent experiments (* p < 0.05).

Dox-inducible iPS cells were cultured in the presence of Dox for 1 d (d1), 2 d (d2), 3 d (d3), 4 d (d4), 5 d (d5), and collected on the day5 for data analysis (Fig. 4A). We checked the conversion efficiency of transient ETV2 induced iPSCS-ECs on the day5 and observed the similar ratio of CD31 +/CD144+ cells with ETV2 overexpression group (data not shown). Western blotting analysis showed that the d5 group had a significant accumulation of ETV2 protein, whereas the d1, d2 and d3 groups almost had no ETV2 protein without DOX treatment on day 5 (Fig. 4B). While d2, d3 and d4 groups had a low expression of ETV2 on day5, the vWF, PECAM1 and VE-Cad expression was upregulated with transient ETV2 expression (Fig. 4C), indicating that transient ETV2 expression was capable to induce the endothelial cells differentiation from the iPSCs. When the expression level of vWF in the d4 group was significantly higher than that in the d5 group on day 5, the PECAM1 and VE-Cad expression remained similar (Fig. 4C). In addition, capillary-like structure formation on Matrigel-coated plates was clearly observed in the d4 group but not in the d5 group or control, and showed the same pattern as the vWF expression in quantitative RT-PCR (Fig. 4D). Collectively, these results suggest that transient ETV2 expression can convert iPSCs into mature ECs.

Fig. 4. Reprogramming of iPSs to ECs with Transient Expression of ETV2

(A) Dox-inducible iPS cells were cultured in the presence of Dox for 1 d (d1), 2 d (d2), 3 d (d3), 4 d (d4), 5 d (d5), and collected on the day5 for data analysis. (B) Western blotting analysis of ETV2 protein levels in Dox-inducible ETV2-ECs with Dox for 1 d (d1), 2 d (d2), 3 d (d3), 4 d (d4), and 5 d (d5). β-Actin was used as an internal control. One representative image from three independent experiments is shown. (C) The expression levels of ETV2, vWF, PECAM1 and VE-cad in Dox-inducible ETV2-ECs with Dox for 1 d (d1), 2 d (d2), 3 d (d3), 4 d (d4), and 5 d (d5) measured using quantitative RT-PCR. Data are represented as the mean +/− S.D. from three independent experiments. (D) In vitro tube formation assay of Dox-inducible iPS-ETV2-ECs cultured on Matrigel in EBM-2 supplemented with VEGF for 18 h. One representative image from three independent experiments is shown. Scale bar = 300 μm.

DISCUSSION

ETV2 is a member of the ETS transcription factor family. It was first discovered at the embryonic stage and regulates blood vessel development and angiogenesis.^13–15) The lack of vasculature in embryos of ETV2-deficient mice proves its indispensable role in vascular development.^28–30) Moreover, multiple studies have shown that adult ECs constitutively express several ETS factors, such as Friend leukemia virus integration 1(FLI1) and the ETS-related gene (ERG), while the expression of ETV2 is transient in embryonic development and absent in mature ECs.^31,32)

Recently, ETV2 has been reported to reprogram somatic cells into functional ECs. Ginsberg et al. converted amniotic cells into vascular endothelial cells with constitutive co-expression of FLI1/ERG1 in combination with transient expression of ETV2 and transforming growth factor β (TGF-β) pathway inhibition.¹⁸⁾ Morita et al. reported that the single factor ETV2 directly converted primary human adult skin fibroblasts into functional ECs.³³⁾ Lee et al. directly reprogrammed human postnatal cells into functional ECs by inducing the generation of ECs from somatic cells with ETV2 alone.³⁴⁾ In this study, iPS cells were used to explore the mechanism of the induction of stem cells into ECs, and to enable the development of a high-efficiency method to generate mature ECs in vitro in 5 d without VEGF.

Our study provides a new protocol for the differentiation of iPSCs into ECs using ETV2. We found that ETV2 was able to induce the direct differentiation of iPSCs into ECs with high efficiency (CD31⁺CD144⁺ > 90%). In the iPSCs-ECs with ETV2 overexpression we observed the ETV2-mediated strong induction of KDR, Tie2 and CD34. Previously, Lee et al. reported that ETV2 was the genuine Ets transcription factor regulating KDR expression during early embryonic development.²³⁾ Wood et al. demonstrated that CD34 expression was strong in pre-endothelial cells.³⁵⁾ The Tie2 gene was reported to be a direct downstream target of ETV2, with its promoter-enhancer region shown to contain ETS binding sites.³⁶⁾ The expressions of KDR, Tie2 and CD34 in iPS-ETV2-ECs were higher than those in HUVECs, consistent with the primary reports. However, compared to HUVECs, stable ETV2-transduced cells showed low expression of vWF and could not form tubular structures on Matrigel, indicating that these iPSC-ETV2-ECs were immature. Subsequently, we controlled the expression of ETV2 in iPSCs using a Dox-inducible system. Consequently, transient ETV2 expression upregulated vWF expression, allowed tube formation on Matrigel. Besides, the Dox-inducible ETV2 expression period or the differentiation pattern need more investigation on other iPS cell lines to obtain the similar results.

Comparing the two types of ETV2 expression patterns involved in EC generation, we can infer that the expression of ETV2 has an inhibitory effect on the maturation of ECs, which is consistent with the previous finding that the expression of ETV2 is transient during embryonic development and absent in mature ECs.^32,33) However, the detailed relationship between ETV2 expression and maturation of ECs requires further investigation. In summary, we used a brief 5 d protocol to generate ECs from hiPSCs using transient expression of ETV2, which enabled the generation of nearly pure ECs with high efficiency without cell sorting. In addition, our study partly validates the role of ETV2 in angiogenesis, as well as facilitates the exploration of innovative strategies that use stem cells to target patient-specific therapeutic angiogenesis.

Acknowledgments

We thank Mary S. Saldon (National Institutes of Biomedical Innovation, Health and Nutrition) for English proof reading.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, Yamanaka S. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell, 131, 861–872 (2007).
• 2) Yu J, Vodyanik MA, Smuga-Otto K, Antosiewicz-Bourget J, Frane JL, Tian S, Nie J, Jonsdottir GA, Ruotti V, Stewart R, Slukvin II, Thomson JA. Induced pluripotent stem cell lines derived from human somatic cells. Science, 318, 1917–1920 (2007).
• 3) Grskovic M, Javaherian A, Strulovici B, Daley GQ. Induced pluripotent stem cells—opportunities for disease modelling and drug discovery. Nat. Rev. Drug Discov., 10, 915–929 (2011).
• 4) Tiscornia G, Vivas EL, Izpisua Belmonte JC. Diseases in a dish: modeling human genetic disorders using induced pluripotent cells. Nat. Med., 17, 1570–1576 (2011).
• 5) Asahara T, Murohara T, Sullivan A, Silver M, van der Zee R, Li T, Witzenbichler B, Schatteman G, Isner JM. Isolation of putative progenitor endothelial cells for angiogenesis. Science, 275, 964–966 (1997).
• 6) Zhu H, Lensch MW, Cahan P, Daley GQ. Investigating monogenic and complex diseases with pluripotent stem cells. Nat. Rev. Genet., 12, 266–275 (2011).
• 7) Lin Y, Weisdorf DJ, Solovey A, Hebbel RP. Origins of circulating endothelial cells and endothelial outgrowth from blood. J. Clin. Invest., 105, 71–77 (2000).
• 8) Kawamoto A, Iwasaki H, Kusano K, Murayama T, Oyamada A, Silver M, Hulbert C, Gavin M, Hanley A, Ma H, Kearney M, Zak V, Asahara T, Losordo DW. CD34-positive cells exhibit increased potency and safety for therapeutic neovascularization after myocardial infarction compared with total mononuclear cells. Circulation, 114, 2163–2169 (2006).
• 9) Kalka C, Masuda H, Takahashi T, Kalka-Moll WM, Silver M, Kearney M, Li T, Isner JM, Asahara T. Transplantation of ex vivo expanded endothelial progenitor cells for therapeutic neovascularization. Proc. Natl. Acad. Sci. U.S.A., 97, 3422–3427 (2000).
• 10) Adams WJ, Zhang Y, Cloutier J, Kuchimanchi P, Newton G, Sehrawat S, Aird WC, Mayadas TN, Luscinskas FW, Garcia-Cardena G. Functional vascular endothelium derived from human induced pluripotent stem cells. Stem Cell Reports, 1, 105–113 (2013).
• 11) Harding A, Cortez-Toledo E, Magner NL, Beegle JR, Coleal-Bergum DP, Hao D, Wang A, Nolta JA, Zhou P. Highly efficient differentiation of endothelial cells from pluripotent stem cells requires the MAPK and the PI3K pathways. Stem Cells, 35, 909–919 (2017).
• 12) Vilà-González M, Kelaini S, Magee C, et al. Enhanced function of induced pluripotent stem cell-derived endothelial cells through ESM1 signaling. Stem Cells, 37, 226–239 (2019).
• 13) Lee D, Park C, Lee H, Lugus JJ, Kim SH, Arentson E, Chung YS, Gomez G, Kyba M, Lin S, Janknecht R, Lim DS, Choi K. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Cell Stem Cell, 2, 497–507 (2008).
• 14) De Val S, Black BL. Transcriptional control of endothelial cell development. Dev. Cell, 16, 180–195 (2009).
• 15) Liu F, Kang I, Park C, Chang LW, Wang W, Lee D, Lim DS, Vittet D, Nerbonne JM, Choi K. ER71 specifies Flk-1+ hemangiogenic mesoderm by inhibiting cardiac mesoderm and Wnt signaling. Blood, 119, 3295–3305 (2012).
• 16) Wong KS, Proulx K, Rost MS, Sumanas S. Identification of vasculature-specific genes by microarray analysis of Etsrp/Etv2 overexpressing zebrafish embryos. Dev. Dyn., 238, 1836–1850 (2009).
• 17) Veldman MB, Zhao C, Gomez GA, Lindgren AG, Huang H, Yang H, Yao S, Martin BL, Kimelman D, Lin S. Transdifferentiation of fast skeletal muscle into functional endothelium in vivo by transcription factor Etv2. PLoS Biol., 11, e1001590 (2013).
• 18) Ginsberg M, James D, Ding BS, Nolan D, Geng F, Butler JM, Schachterle W, Pulijaal VR, Mathew S, Chasen ST, Xiang J, Rosenwaks Z, Shido K, Elemento O, Rabbany SY, Rafii S. Efficient direct reprogramming of mature amniotic cells into endothelial cells by ETS factors and TGFbeta suppression. Cell, 151, 559–575 (2012).
• 19) Kurian L, Sancho-Martinez I, Nivet E, et al. Conversion of human fibroblasts to angioblast-like progenitor cells. Nat. Methods, 10, 77–83 (2013).
• 20) Han JK, Chang SH, Cho HJ, Choi SB, Ahn HS, Lee J, Jeong H, Youn SW, Lee HJ, Kwon YW, Cho HJ, Oh BH, Oettgen P, Park YB, Kim HS. Direct conversion of adult skin fibroblasts to endothelial cells by defined factors. Circulation, 130, 1168–1178 (2014).
• 21) Lippmann ES, Azarin SM, Kay JE, Nessler RA, Wilson HK, Al-Ahmad A, Palecek SP, Shusta EV. Derivation of blood–brain barrier endothelial cells from human pluripotent stem cells. Nat. Biotechnol., 30, 783–791 (2012).
• 22) Sriram G, Tan JY, Islam I, Rufaihah AJ, Cao T. Efficient differentiation of human embryonic stem cells to arterial and venous endothelial cells under feeder- and serum-free conditions. Stem Cell Res. Ther., 6, 261 (2015).
• 23) Lee D, Park C, Lee H, Lugus JJ, Kim SH, Arentson E, Chung YS, Gomez G, Kyba M, Lin S, Janknecht R, Lim DS, Choi K. ER71 acts downstream of BMP, Notch, and Wnt signaling in blood and vessel progenitor specification. Cell Stem Cell, 2, 497–507 (2008).
• 24) Abedin MJ, Nguyen A, Jiang N, Perry CE, Shelton JM, Watson DK, Ferdous A. Fli1 acts downstream of Etv2 to govern cell survival and vascular homeostasis via positive autoregulation. Circ. Res., 114, 1690–1699 (2014).
• 25) Kim JJ, Kim DH, Lee JY, Lee BC, Kang I, Kook MG, Kong D, Choi SW, Woo HM, Kim DI, Kang KS. cAMP/EPAC signaling enables ETV2 to induce endothelial cells with high angiogenesis potential. Mol. Ther., 28, 466–478 (2020).
• 26) Lin Y, Weisdorf DJ, Solovey A, Hebbel RP. Origins of circulating endothelial cells and endothelial outgrowth from blood. J. Clin. Invest., 105, 71–77 (2000).
• 27) Quirici N, Soligo D, Caneva L, Servida F, Bossolasco P, Deliliers GL. Differentiation and expansion of endothelial cells from human bone marrow CD133(+) cells. Br. J. Haematol., 115, 186–194 (2001).
• 28) Pham VN, Lawson ND, Mugford JW, Dye L, Castranova D, Lo B, Weinstein BM. Combinatorial function of ETS transcription factors in the developing vasculature. Dev. Biol., 303, 772–783 (2007).
• 29) Park C, Lee TJ, Bhang SH, Liu F, Nakamura R, Oladipupo SS, Pitha-Rowe I, Capoccia B, Choi HS, Kim TM, Urao N, Ushio-Fukai M, Lee DJ, Miyoshi H, Kim BS, Lim DS, Apte RS, Ornitz DM, Choi K. Injury-mediated vascular regeneration requires endothelial ER71/ETV2. Arterioscler. Thromb. Vasc. Biol., 36, 86–96 (2016).
• 30) Oh SY, Kim JY, Park C. The ETS Factor, ETV2: a master regulator for vascular endothelial cell development. Mol. Cells, 38, 1029–1036 (2015).
• 31) Hollenhorst PC, Shah AA, Hopkins C, Graves BJ. Genome-wide analyses reveal properties of redundant and specific promoter occupancy within the ETS gene family. Genes Dev., 21, 1882–1894 (2007).
• 32) Hayashi M, Pluchinotta M, Momiyama A, Tanaka Y, Nishikawa S, Kataoka H. Endothelialization and altered hematopoiesis by persistent Etv2 expression in mice. Exp. Hematol., 40, 738–750.e11 (2012).
• 33) Morita R, Suzuki M, Kasahara H, Shimizu N, Shichita T, Sekiya T, Kimura A, Sasaki K, Yasukawa H, Yoshimura A. ETS transcription factor ETV2 directly converts human fibroblasts into functional endothelial cells. Proc. Natl. Acad. Sci. U.S.A., 112, 160–165 (2015).
• 34) Lee S, Park C, Han JW, Kim JY, Cho K, Kim EJ, Kim S, Lee SJ, Oh SY, Tanaka Y, Park IH, An HJ, Shin CM, Sharma S, Yoon YS. Direct reprogramming of human dermal fibroblasts into endothelial cells using ER71/ETV2. Circ. Res., 120, 848–861 (2017).
• 35) Wood HB, May G, Healy L, Enver T, Morriss-Kay GM. CD34 expression patterns during early mouse development are related to modes of blood vessel formation and reveal additional sites of hematopoiesis. Blood, 90, 2300–2311 (1997).
• 36) Fadel BM, Boutet SC, Quertermous T. Functional analysis of the endothelial cell-specific Tie2/Tek promoter identifies unique protein-binding elements. Biochem. J., 330, 335–343 (1998).