Nobiletin and 3′-Demethyl Nobiletin Activate Brown Adipocytes upon β-Adrenergic Stimulation

Abstract

Brown adipose tissue (BAT) specifically regulates energy expenditure via heat production. Nobiletin (NOB), a natural polymethoxylated flavone present in citrus fruits, can activate thermogenesis in the BAT of high-fat diet-induced obese mice. The activity of BAT is directly regulated by β-adrenergic stimulation. In this study, we report the effects of NOB on BAT activation using β-adrenergic agonists. We observed that when HB2 brown adipocyte cell lines are stimulated with β-adrenergic agonists, NOB enhances the expression of uncoupling protein 1 (UCP1), which is associated with the mitochondrial energy metabolism in these cells. Moreover, NOB increases the mRNA expression of the brown adipokines neuregulin-4 (Nrg4) and fibroblast growth factor-21 (FGF-21) and the secretion of FGF-21. These results suggest that NOB can enhance the thermogenic functions of brown adipocytes and promote brown adipokine secretion due to enhanced β-adrenergic stimulation. In addition, 3′-demethyl nobiletin (3′-DMN), an NOB CYP-enzyme metabolite, can increase UCP1 mRNA expression. Both NOB and 3′-DMN significantly promoted mitochondrial membrane potential in HB2 adipocytes following β-adrenergic stimulation. Therefore, we believe that NOB could be a promising candidate for activating BAT under β-adrenergic stimulation and preventing the onset of obesity.

INTRODUCTION

Obesity is associated with numerous diseases, including diabetes, hypertension, hyperlipidemia, atherosclerosis, and cardiovascular disorders.¹⁾ Anti-obesity strategies are mainly based on reducing energy uptake and restricting energy absorption. Previously, studies exploring anti-obesity strategies have mainly focused on white adipose tissue (WAT), an energy storage organ.^2,3) However, obesity usually results from a long period of excess energy intake combined with low energy expenditure.⁴⁾ Currently, there is increasing evidence that supports the role of adaptive thermogenesis in promoting body energy expenditure and regulating the balance between energy intake and expenditure.^5,6) Unlike WAT, brown adipose tissue (BAT) dissipates significant amounts of chemical energy and produces heat through adaptive thermogenesis in response to environmental changes. Hence, BAT may have the potential to combat obesity and diabetes in humans.⁷⁾

Previously, animal studies have reported that the BAT is densely innervated by the sympathetic nervous system, and it is regulated by the hypothalamus.⁸⁾ When thermogenesis is required, sympathetic neurons release norepinephrine (NE) that interacts with cell-surface β-adrenergic receptors (β-ARs), thereby activating the uncoupling protein-1 (UCP1).⁸⁾ Located in the inner mitochondrial membrane, UCP1 is responsible for uncoupling respiration from ATP synthesis, thereby leading to heat generation.⁹⁾ In recent years, researchers have identified multiple, soluble, novel noradrenergic molecules that are capable of inducing BAT activity for energy expenditure.¹⁰⁾

Nobiletin (NOB) is a polymethoxylated flavone compound derived from citrus fruits, such as Citrus depress and Citrus sinensis. It has multiple biological properties, such as anti-inflammatory, anti-tumor, and neuroprotective effects.^11–14) Moreover, NOB has the potential of preventing obesity in diet-induced obese mice.¹⁵⁾ In vitro studies that were performed on 3T3-L1 cells to understand the underlying mechanisms of the anti-obesity effects of NOB focused exclusively on WAT activity. These reports demonstrated that NOB enhanced differentiation and lipolysis¹⁶⁾ in 3T3-L1 adipocytes and induced a brown adipocyte-like phenotype as well as ameliorated cellular stress.¹⁷⁾ Furthermore, in high-fat-fed mice, NOB activated thermogenesis of BAT and induced the browning of WAT by shaping the gut microbiota.¹⁸⁾ However, studies have not yet explored whether these effects of NOB on BAT depend on β-adrenergic stimulation. In this study, we aimed to demonstrate the impact of β-adrenergic stimulation on the effects of NOB and 3′-demethyl nobiletin (3′-DMN), a CYP-enzyme metabolite of NOB, on BAT activity in HB2 adipocytes.

MATERIALS AND METHODS

Materials

We purchased NOB from INDOFINE Chemical Company, Inc. (Hillsborough, NJ, U.S.A.). The NOB metabolites (Table 1) were synthesized, following a previously reported protocol.^19,20) These compounds were dissolved in dimethyl sulfoxide (DMSO), according to the concentration described in the manuscripts.

Table 1. Structures of Nobiletin (NOB) and Its Metabolites

		R1	R2	R3
Nob	Nobiletin	CH3	CH3	CH3
3′-DMN	3′-Demethylnobiletin	H	CH3	CH3
4′-DMN	4′-Demethylnobiletin	CH3	H	CH3
3′,4′-DMN	3′,4′-Didemethylnobiletin	H	H	CH3
5-DMN	5-Demethylnobiletin	CH3	CH3	H
5,3′-dmn	5,3′-Didemethylnobiletin	H	CH3	H
5,4′-dmn	5,4′-Didemethylnobiletin	CH3	H	H

Cell Culture and Treatment

Professor M. Saito, Hokkaido University, kindly provided us with HB2 cells, which are brown preadipocytes.²¹⁾ These cells were plated on collagen-coated dishes (IWAKI, Shizuoka, Japan) and induced to develop into brown adipocytes by treating with 1 mM dexamethasone (DEX) and 0.5 mM 3-isobutyl-1-methylxanthine (IBMX) for 48 h. The cells were maintained in Dulbecco’s modified Eagle medium (DMEM) containing 10 mg/mL insulin and 50 nM 3,3′,5-triiodo-L-thyronine (T₃) for 72 h, after which they were fully differentiated. Thereafter, the HB2 adipocytes were treated with NOB or NOB metabolites for 24 h, followed by 1 µM β-adrenergic agonist treatment for 4 h, after which their mRNA expression was analyzed. For the mitochondrial membrane potential assay and fibroblast growth factor-21 (FGF-21) enzyme-linked immunosorbent assay (ELISA), the cells were subjected to 1 µM NE stimulation and 10 µM NOB or 3′-DMN treatment for 24 and 48 h, respectively.

Real-Time PCR

Total RNA was obtained from each of the HB2 brown adipocyte treatment groups using ISOGEN reagent (Nippon Gene, Tokyo, Japan). Subsequently, cDNA was synthesized from the total RNA using a PrimeScript RT Kit (TaKaRa Bio Inc., Otsu, Japan). Real-time PCR was performed using SYBR Select Master Mix (Applied Biosystems, MA, U.S.A.) and a 7500 Fast Real-Time PCR System (Life Technologies, MA, U.S.A.). Primer sequences for UCP1 and other genes were synthesized based on a previous report²²⁾ and online resources (https://pga.mgh.harvard.dus/primerbank/), respectively. Target mRNA expression was normalized using the expression of glyceraldehyde 3-phosphate dehydrogenase (GAPDH). The sequences of the primers used for the PCR analysis are listed in Table 2.

Table 2. Sequences of Primers Used for Real-Time PCR

Gene	Forward	Reverse
GAPDH	TGTGTCCGTCGTGGATCTGA	CCTGCTTCACCACCTTCTTGA
UCP1	ACTGCCACACCTCCAGTCATT	CTTTGCCTCACTCAGGATTGG
PGC-1α	AGCAGAAAGCAATTGAAGAG	AGGTGTAACGGTAGGTGATG
Nrg4	GAGACAAACAATACCAGAAC	GGACTGCCATAGAAATGA
FGF-21	GATGACGACCAAGACACTG	CGGCCCTGTAAAGGCTCT
βKlotho	ACGACCCGACGAGGGCTGTT	GGAGGAGACCGTAAACTCGGGCTTA
PPAR-α	ATGCCAGTACTGCCGTTTTC	CCGAATCTTTCAGGTCGTGT
RPDM16	ACCTGCCACAGCAAAGAA	CCATCCAAGCAGAGAAGTAGAC

FGF-21 ELISA

The concentration of FGF-21 in the culture medium was measured using a commercial kit (Proteintech, Rosemont, IL, U.S.A.), following the manufactuer’s instruction.

Mitochondrial Membrane Potential Assay

Mitochondrial membrane potential was examined with tetramethylrhodamine ethyl ester (TMRE) Mitochondrial Membrane Potential Assay kit (Abcam, Eugene, OR, U.S.A.). The HB2 cells were plated on a collagen-coated 96-well microplate (CORNING, Tokyo, Japan), where they differentiated into brown adipocytes. After treatment with 1 µM NE and 10 µM NOB or 3′-DMN, the cells were incubated with 300 nM TMRE for 20 min at 37 °C in a CO₂ incubator to label active mitochondria. The TMRE staining was analyzed by microplate spectrophotometry at Ex/Em = 549/575 nm.

Statistical Analyses

Data are expressed as mean ± standard deviation (S.D.). Statistical significance was assessed by Student’s t-test (Figs. 1a, 2b) and Dunnett’s test (Figs. 1b, 2a, 3, 4, Supplementary Fig. S1). Statistical significance was set at p < 0.05. Data were analyzed using IBM SPSS Statistics 24.

Fig. 1. Nobiletin (NOB) Enhances Thermogenesis in β-Adrenergic-Stimulated HB2 Adipocytes by Increasing the mRNA Expression of Uncoupling Protein 1 (UCP1)

(a) Treatment with NOB increases UCP1 mRNA expression in HB2 adipocytes activated by norepinephrine (NE), isoproterenol (IS), and CL31643. The HB2 adipocytes were stimulated by 1 µM β-adrenergic agonists for 4 h after treatment with 10 µM NOB for 24 h. Data are expressed as mean ± standard deviation (S.D.; n = 6). Statistically significant differences are noted between β-adrenergic agonist+, NOB− cells and β-adrenergic antagonist+ NOB+ cells (* p < 0.05) (b) Treatment with NOB increases UCP1 and peroxisome proliferator-activated receptor γ coactivator 1-alpha (PGC-1α) mRNA expression in a dose-dependent manner in HB2 adipocytes activated by NE stimulation. The HB2 adipocytes were stimulated by 1 µM β-adrenergic agonists for 4 h after treatment with 3 or 10 µM of NOB for 24 h. Data are expressed as mean ± S.D. (n = 6). Statistically significant differences are noted between NE-treated and NE + NOB-treated cells (* p < 0.05 and ^† p < 0.01).

Fig. 2. Nobiletin (NOB) Induces Brown Adipokines, Neuregulin-4 (Nrg4) and Fibroblast Growth Factor-21 (FGF-21) mRNA Expression (a) and FGF-21 Secretion (b) in HB2 Adipocytes Activated by Norepinephrine (NE) Stimulation

Data are expressed as mean ± S.D. (n = 6). Statistically significant differences are noted between NE-treated and NE + NOB-treated cells (* p < 0.05 and ^†p < 0.01).

RESULTS

NOB Enhances Thermogenesis in β-Adrenergic-Stimulated HB2 Adipocytes by Increasing mRNA Levels of UCP1 and Peroxisome Proliferator-Activated Receptor Gamma Coactivator 1-Alpha (PGC1-α)

The UCP1 is a molecular marker of brown adipocytes associated with thermogenesis,⁹⁾ and its expression increases due to β-adrenergic stimulation both in vivo and in vitro.^23,24) There are three subtypes of β-ARs. Among them, β₁AR and β₂AR are generally expressed throughout the tissues of the body, while β₃AR is predominantly found in adipocytes.²⁵⁾ While NE and isoproterenol (IS) are non-specific β-AR agonists, CL31643 is a specific agonist of β₃AR. Therefore, to examine the effects of NOB on β-adrenergic activation of HB2 adipocytes, the cells were treated with 10 µM NOB, followed by NE, IS, or CL31643 treatment. The expression of UCP1 mRNA was increased 1,111-fold, 604-fold, and 577-fold in HB2 adipocytes treated with NE, IS, and CL31643, respectively, as compared to that in the control (NE-, NOB-) cells (Fig. 1a). Furthermore, the effect of NOB on HB2 adipocytes was lower (1.23-folds) in the absence of β-AR agonists (Fig. 1a); the UCP1 mRNA levels were predominantly upregulated with NOB treatment in NE stimulation (3.06-fold), IS stimulation (3.14-fold), and CL31643 stimulation (1.70-fold). In fact, NOB also increased the expression of PGC-1α mRNA, which is involved in the transcriptional activation of UCP1²⁶⁾ and mitochondrial energy metabolism in a dose-dependent manner (Fig. 1b). These results indicate that NOB promotes β-adrenergic stimulation of brown adipocytes by increasing the mRNA levels of thermogenic genes.

NOB Induces mRNA Expression of Brown Adipokines Neuregulin-4 (Nrg4) and FGF-21 and the Secretion of FGF-21 in β-Adrenergic-Stimulated HB2 Adipocytes

The BAT secretes certain factors called brown adipokines that play important roles in autocrine and endocrine functions.²⁷⁾ To investigate the effects of NOB on brown adipokine secretion, we determined the mRNA levels of Nrg4 and FGF-21, which are key brown adipokines, in β-adrenergic-stimulated HB2 adipocytes. Both Nrg4 and FGF-21 mRNA expressions exhibited a marked increase in the β-adrenergic-stimulated HB2 adipocytes treated with NOB, as compared to that in the HB2 adipocytes treated with only NE; in fact, the mRNA expressions increased in a dose-dependent manner (Fig. 2a). On the contrary, βKlotho mRNA expression, which is a receptor of FGF-21, did not change with the addition of NOB (Fig. 2a). Furthermore, NOB increases FGF-21 secretion in the β-adrenergic-stimulated HB2 adipocytes (Fig. 2b). These results suggest that NOB promotes the secretion of the brown adipokines Nrg4 and FGF-21 in brown adipocytes following β-adrenergic stimulation.

3′-DMN Increases UCP1 mRNA Expression in β-Adrenergic-Stimulated HB2 Adipocytes

Interestingly, NOB is metabolized by CYP-1A1, CYP-1A2, CYP-1B1, and CYP-3A5 enzymes, and its metabolites show more beneficial effects than NOB.^28–31) We have investigated the effects of six NOB metabolites (Table 1) on UCP1 mRNA expression in β-adrenergic-stimulated HB2 adipocytes. As shown in Fig. 3, among the six NOB metabolites, only 3′-DMN could increase the UCP1 mRNA expression. In addition to the expression of UCP1, we analyzed the mRNA expression of peroxisome proliferator-activated receptor alpha (PPAR α) and PR domain containing 16 (PRDM 16), whicn are related to that of FGF-21 and UCP1. NOB and 3′-DMN increased the mRNA expression of PPAR α; however, they had no effect on the mRNA expression of PRDM 16. 4′-DMN decreased the mRNA expression of PRDM 16 (Supplementary Fig. S1). These results revealed that along with NOB, 3′-DMN can also induce thermogenesis in brown adipocytes under β-adrenergic stimulation.

Fig. 3. Effects of Nobiletin (NOB)-Metabolites on Uncoupled Protein-1 (UCP1) mRNA Expression in HB2 Adipocytes Activated by Norepinephrine (NE) Stimulation

Data are expressed as mean ± S.D. (n = 3). The HB2 adipocytes were stimulated by 1 µM β-adrenergic agonists for 4 h after treatment with 10 µM of NOB or NOB metabolites for 24 h. Statistically significant differences are noted between NE-treated and NE + NOB- or NE + NOB metabolite-treated cells (^†p < 0.01).

NOB and 3′-DMN Promotes Mitochondrial Biogenesis in β-Adrenergic-Stimulated HB2 Adipocytes

The UCP1, located on the mitochondrial membrane, contributes to heat production by disrupting the proton gradient, and it is associated with mitochondrial biological activity.⁹⁾ The mitochondrial membrane potential is a key indicator of mitochondrial activity because it reflects various mitochondrial processes, such as electron transport and oxidative phosphorylation, which are the driving forces behind ATP production.³²⁾ Since both NOB and 3′-DMN increased the UCP1 mRNA expression (Fig. 3) in β-adrenergic-stimulated HB2 adipocytes, we examined the mitochondrial membrane potential of these cells (Fig. 4). We observed that both NOB and 3′-DMN significantly increases the mitochondrial membrane potential in the HB2 adipocytes activated by β-adrenergic stimulation. These results suggest that both NOB and 3′-DMN can enhance mitochondrial activity and increase heat production in brown adipocytes under β-adrenergic stimulation.

Fig. 4. Treatment with Nobiletin (NOB) and 3′-Demethyl Nobiletin (3′-DMN) Increases Mitochondrial Membrane Potential in HB2 Adipocytes Activated by Norepinephrine (NE) Stimulation

The HB2 adipocytes were stimulated by 1 µM β-adrenergic agonists for 24 h after treatment with 10 µM NOB or NOB metabolites for 24 h. Data are expressed as mean ± S.D. (n = 6). “None” denotes the cells that were not treated with NE, NOB, or NOB metabolites. Statistically significant differences are noted between NE-treated and NE + NOB- or NE + 3′-DMN-treated cells (^† p < 0.01).

DISCUSSION

In the present study, we have demonstrated that NOB predominantly enhances UCP1 and PGC-1α mRNA expression in β-adrenergic-stimulated brown adipocytes. Moreover, both NOB and 3′-DMN promote mitochondrial membrane potential in HB2 adipocytes following β-adrenergic stimulation. These results suggest that NOB can enhance the thermogenic functions of BAT. Since β-adrenergic stimulation usually triggers signaling cascades involving protein kinase A (PKA) and p38 mitogen activated protein kinase (MAPK) pathways,³³⁾ we assumed that the NOB-induced upregulation of UCP1 and PGC-1α in the β-adrenergic-stimulated brown adipocytes may be associated with PKA and p38 MAPK pathways, although the direct target molecules of NOB are still uncertain.

Furthermore, we found that NOB induced the upregulation of brown adipokines, such as FGF-21 and Nrg4, and PPAR α, which is associated with the transcription of FGF-21, in β-adrenergic-stimulated HB2 adipocytes. Brown adipokines are autocrine and endocrine factors secreted by BAT that can enhance its thermogenic capacity and exhibit various biological functions in other tissues.²⁷⁾ Both FGF-21 and Nrg4 function as endocrine factors that may link the activation of BAT through sympathetic innervation and increasing the number of preadipocytes in BAT.^34–36) Therefore, they may induce BAT thermogenesis in an endocrine manner owing to NOB treatment with β-adrenergic stimulation. In fact, FGF-21 acts on BAT in an autocrine manner, thereby increasing the expression of thermogenic genes, such as UCP1, and enhancing its heat-producing capacity.³⁷⁾ Hence, we assumed that the NOB-induced increase in the FGF-21 expression might increase the UCP1 mRNA expression in an autocrine manner in the sympathetic-stimulated brown adipocytes. In conclusion, the upregulation of FGF-21 and Nrg4 by NOB enhances the thermogenic capacity of BAT under physiological conditions through autocrine and endocrine mechanisms.

After absorption, NOB generally undergoes phase I and phase II metabolism. In vivo tests have identified seven NOB metabolites generated by CYP-enzyme action, of which 3′-DMN, 4′-demethylnobiletin, and 3′,4′-demethylnobiletin are the major ones.³⁸⁾ Previously, reports have indicated that these NOB metabolites have significant anti-inflammatory and anti-cancer properties.^28–31) Our analyses revealed that 3′-DMN can enhance UCP1 mRNA expression and mitochondrial membrane potential. These results suggest that both the methoxyl groups of R² and R³ (Table 1) play important roles in BAT activation. If the direct target molecules of NOB are identified, the mechanism underlying the strong upregulation by only 3′-DMN compared with other metabolites could be better understood.

With respect to beneficial effects of food intake, it has been reported in animal experiments as well as in clinical studies that capsaicin or dihydrocapsaicin can inhibit the onset of obesity by enhancing energy expenditure and reducing body fat accumulation.^39,40) Similarly, combining our data with these reports, we suggest that the intake of NOB through diet may be effective for increasing the energy expenditure and preventing obesity through sympathetic nervous system activation.

Acknowledgments

The authors would like to thank Dr. Masayuki Saito for providing the HB2 cells and Dr. Ken Karasawa and Dr. Masaru Doshi for helpful suggestion.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Piché ME, Tchernof A, Després JP. Obesity phenotypes, diabetes, and cardiovascular diseases. Circ. Res., 126, 1477–1500 (2020).
• 2) Longo M, Zatterale F, Naderi J, Parrillo L, Formisano P, Raciti GA, Beguinot F, Miele C. Adipose tissue dysfunction as determinant of obesity-associated metabolic complications. Int. J. Mol. Sci., 20, 2358 (2019).
• 3) Giralt M, Villarroya F. White, brown, beige/brite: different adipose cells for different functions? Endocrinology, 154, 2992–3000 (2013).
• 4) Schwartz MW, Seeley RJ, Zeltser LM, Drewnowski A, Ravussin E, Redman LM, Leibel RL. Obesity pathogenesis: an endocrine society scientific statement. Endocr. Rev., 38, 267–296 (2017).
• 5) Bartelt A, Heeren J. Adipose tissue browning and metabolic health. Nat. Rev. Endocrinol., 10, 24–36 (2014).
• 6) Wu J, Boström P, Sparks LM, Ye L, Choi JH, Giang AH, Khandekar M, Virtanen KA, Nuutila P, Schaart G, Huang K, Tu H, van Marken Lichtenbelt WD, Hoeks J, Enerbäck S, Schrauwen P, Spiegelman BM. Beige adipocytes are a distinct type of thermogenic fat cell in mouse and human. Cell, 150, 366–376 (2012).
• 7) Tan CY, Ishikawa K, Virtue S, Vidal-Puig A. Brown adipose tissue in the treatment of obesity and diabetes: are we hot enough? J. Diabetes Investig., 2, 341–350 (2011).
• 8) Fenzl A, Kiefer FW. Brown adipose tissue and thermogenesis. Horm. Mol. Biol. Clin. Investig., 19, 25–37 (2014).
• 9) Chouchani ET, Kazak L, Spiegelman BM. New advances in adaptive thermogenesis: UCP1 and beyond. Cell Metab., 29, 27–37 (2019).
• 10) Villarroya F, Vidal-Puig A. Beyond the sympathetic tone: the new brown fat activators. Cell Metab., 17, 638–643 (2013).
• 11) Murakami A, Nakamura Y, Torikai K, Tanaka T, Koshiba T, Koshimizu K, Kuwahara S, Takahashi Y, Ogawa K, Yano M, Tokuda H, Nishino H, Mimaki Y, Sashida Y, Kitanaka S, Ohigashi H. Inhibitory effect of citrus nobiletin on phorbol ester-induced skin inflammation, oxidative stress, and tumor promotion in mice. Cancer Res., 60, 5059–5066 (2000).
• 12) Meiyanto E, Hermawan A, Anindyajati. Natural products for cancer-targeted therapy: citrus flavonoids as potent chemopreventive agents. Asian Pac. J. Cancer Prev., 13, 427–436 (2012).
• 13) Yasuda N, Ishii T, Oyama D, Fukuta T, Agato Y, Sato A, Shimizu K, Asai T, Asakawa T, Kan T, Yamada S, Ohizumi Y, Oku N. Neuroprotective effect of nobiletin on cerebral ischemia-reperfusion injury in transient middle cerebral artery-occluded rats. Brain Res., 1559, 46–54 (2014).
• 14) Nakajima A, Ohizumi Y. Potential benefits of nobiletin, a citrus flavonoid, against Alzheimer’s disease and Parkinson’s disease. Int. J. Mol. Sci., 20, 3380 (2019).
• 15) Lee YS, Cha BY, Choi SS, Choi BK, Yonezawa T, Teruya T, Nagai K, Woo JT. Nobiletin improves obesity and insulin resistance in high-fat diet-induced obese mice. J. Nutr. Biochem., 24, 156–162 (2013).
• 16) Saito T, Abe D, Sekiya K. Nobiletin enhances differentiation and lipolysis of 3T3-L1 adipocytes. Biochem. Biophys. Res. Commun., 357, 371–376 (2007).
• 17) Lone J, Parray HA, Yun JW. Nobiletin induces brown adipocyte-like phenotype and ameliorates stress in 3T3-L1 adipocytes. Biochimie, 146, 97–104 (2018).
• 18) Kou G, Li P, Hu Y, Chen H, Nyantakyiwaa Amoah A, Seydou Traore S, Cui Z, Lyu Q. Nobiletin activates thermogenesis of brown and white adipose tissue in high-fat diet-fed C57BL/6 mice by shaping the gut microbiota. FASEB J., 35, e21267 (2021).
• 19) Oshitari T, Okuyama Y, Miyata Y, Kosano H, Takahashi H, Natsugari H. Nobiletin metabolites: synthesis and inhibitory activity against matrix metalloproteinase-9 production. Bioorg. Med. Chem. Lett., 21, 4540–4544 (2011).
• 20) Oshitari T, Okuyama Y, Miyata Y, Kosano H, Takahashi H, Natsugari H. B-Ring-modified and/or 5-demethylated nobiletin congeners: inhibitory activity against pro-MMP-9 production. Bioorg. Med. Chem., 19, 7085–7092 (2011).
• 21) Irie Y, Asano A, Cañas X, Nikami H, Aizawa S, Saito M. Immortal brown adipocytes from p53-knockout mice: differentiation and expression of uncoupling proteins. Biochem. Biophys. Res. Commun., 255, 221–225 (1999).
• 22) Sakamoto T, Takahashi N, Sawaragi Y, Naknukool S, Yu R, Goto T, Kawada T. Inflammation induced by RAW macrophages suppresses UCP1 mRNA induction via ERK activation in 10T1/2 adipocytes. Am. J. Physiol. Cell Physiol., 304, C729–C738 (2013).
• 23) Silva JE, Rabelo R. Regulation of the uncoupling protein gene expression. Eur. J. Endocrinol., 136, 251–264 (1997).
• 24) Mory G, Bouillaud F, Combes-George M, Ricquier D. Noradrenaline controls the concentration of the uncoupling protein in brown adipose tissue. FEBS Lett., 166, 393–396 (1984).
• 25) Collins S, Surwit RS. The beta-adrenergic receptors and the control of adipose tissue metabolism and thermogenesis. Recent Prog. Horm. Res., 56, 309–328 (2001).
• 26) Puigserver P, Spiegelman BM. Peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1 alpha): transcriptional coactivator and metabolic regulator. Endocr. Rev., 24, 78–90 (2003).
• 27) Villarroya J, Cereijo R, Gavaldà-Navarro A, Peyrou M, Giralt M, Villarroya F. New insights into the secretory functions of brown adipose tissue. J. Endocrinol., 243, R19–R27 (2019).
• 28) Huang H, Li L, Shi W, Liu H, Yang J, Yuan X, Wu L. The multifunctional effects of nobiletin and its metabolites in vivo and in vitro. Evid. Based Complement. Alternat. Med., 2016, 2918796 (2016).
• 29) Li S, Sang S, Pan MH, Lai CS, Lo CY, Yang CS, Ho CT. Anti-inflammatory property of the urinary metabolites of nobiletin in mouse. Bioorg. Med. Chem. Lett., 17, 5177–5181 (2007).
• 30) Goh JXH, Tan LT, Goh JK, Chan KG, Pusparajah P, Lee LH, Goh BH. Nobiletin and derivatives: functional compounds from citrus fruit peel for colon cancer chemoprevention. Cancers (Basel), 11, 867 (2019).
• 31) Lo YH, Pan MH, Li S, Yen JH, Kou MC, Ho CT, Wu MJ. Nobiletin metabolite, 3′,4′-dihydroxy-5,6,7,8-tetramethoxyflavone, inhibits LDL oxidation and down-regulates scavenger receptor expression and activity in THP-1 cells. Biochim. Biophys. Acta, 1801, 114–126 (2010).
• 32) Lee YX, Lin PH, Rahmawati E, Ma YY, Chan C, Tzeng CR. Mitochondria research in human reproduction. Chapter 20, The ovary 3rd ed., Academic Press, California, pp. 327–335 (2019).
• 33) Collins S, Yehuda-Shnaidman E, Wang H. Positive and negative control of Ucp1 gene transcription and the role of β-adrenergic signaling networks. Int. J. Obes. (Lond.), 34 (suppl. 1), S28–S33 (2010).
• 34) Néchad M, Ruka E, Thibault J. Production of nerve growth factor by brown fat in culture: relation with the in vivo developmental stage of the tissue. Comp. Biochem. Physiol. Comp. Physiol., 107, 381–388 (1994).
• 35) Nisoli E, Tonello C, Benarese M, Liberini P, Carruba MO. Expression of nerve growth factor in brown adipose tissue: implications for thermogenesis and obesity. Endocrinology, 137, 495–503 (1996).
• 36) Douris N, Stevanovic DM, Fisher FM, Cisu TI, Chee MJ, Nguyen NL, Zarebidaki E, Adams AC, Kharitonenkov A, Flier JS, Bartness TJ, Maratos-Flier E. Central fibroblast growth factor 21 browns white fat via sympathetic action in male mice. Endocrinology, 156, 2470–2481 (2015).
• 37) Hondares E, Iglesias R, Giralt A, Gonzalez FJ, Giralt M, Mampel T, Villarroya F. Thermogenic activation induces FGF21 expression and release in brown adipose tissue. J. Biol. Chem., 286, 12983–12990 (2011).
• 38) Wang Z, Li S, Jonca M, Lambros T, Ferguson S, Goodnow R, Ho CT. Comparison of supercritical fluid chromatography and liquid chromatography for the separation of urinary metabolites of nobiletin with chiral and non-chiral stationary phases. Biomed. Chromatogr., 20, 1206–1215 (2006).
• 39) Reinbach HC, Smeets A, Martinussen T, Møller P, Westerterp-Plantenga MS. Effects of capsaicin, green tea and CH-19 sweet pepper on appetite and energy intake in humans in negative and positive energy balance. Clin. Nutr., 28, 260–265 (2009).
• 40) Shin KO, Moritani T. Alterations of autonomic nervous activity and energy metabolism by capsaicin ingestion during aerobic exercise in healthy men. J. Nutr. Sci. Vitaminol. (Tokyo), 53, 124–132 (2007).