Sex, Organ, and Breed Differences in the mRNA Expression of Drug Transporters in the Liver and Kidney of Pigs

Abstract

Domestic pigs are attractive as an animal model for humans because of their anatomical and physiological similarities to humans. In this study, sex, organ, and breed differences in the mRNA expression of drug transporters such as breast cancer resistance protein (BCRP), multidrug resistance protein 1 (MDR1), multidrug resistance associated protein 2 (MRP2), organic anion porting polypeptide 1B3 (OATP1B3), organic anion transporters (OAT1, OAT2, and OAT3), and organic cation transporters (OCT1 and OCT2) were examined by RT-PCR in the liver and kidney of 5-month-old Meishan and Landrace pigs. No sex differences in the amount of BCRP mRNA were observed in both breeds. In Meishan pigs, sex differences (male < female) in the mRNA amounts of MDR1, OATP1B3, and OCT1 were observed in the liver. Similarly, sex differences in the mRNA amounts of MRP2, OAT1, OAT2, OAT3, and OCT2 were observed in the kidney of Meishan pigs: male > female for MRP2, OAT3, and OCT2, and male < female for OAT1 and OAT2. However, no such sex differences were observed in Landrace pigs. In addition, regardless of breed, hepatic OAT1, OAT3, and OCT2 mRNAs and renal OATP1B3 mRNA were not detected. Thus, organ and breed differences in the expression of drug transporters suggest the existence of genetically controlled organ-selective factors. Furthermore, additional experiments in castrated and/or testosterone propionate-treated pigs strongly suggested that sex and breed differences in the gene expression of drug transporters, especially hepatic OCT1 and renal OAT1, were primarily due to the difference in serum testosterone concentration.

INTRODUCTION

Pharmacokinetics is determined by the absorption, distribution, metabolism, and excretion of xenobiotics including drugs, and the expression levels of drug transporters in target organs are the factors that determine their drug sensitivity and resistance. Drug transporters consist of two superfamilies: the solute carrier (SLC) family containing organic anion/cation transporters (OAT/OCT) and organic anion transporting polypeptide (OATP); and the ATP-binding cassette (ABC) family containing multidrug resistance proteins (MDR), multidrug resistance-associated proteins (MRP), and breast cancer resistance protein (BCRP).^1,2) Sex differences in the expression of drug transporters such as OCT2, OAT1, and OAT2 in rodents have been reported, and as the causes of these sex differences, sex hormones and/or physiological factors have been considered.^1,3,4) Furthermore, sex and organ differences in the expression of drug transporters have been reported to vary in different animal species.

Domestic pigs (Sus scrofa domesticus), including mini pigs, are attractive as an animal model for humans because their anatomical and physiological characteristics are similar to those of humans.^5–7) Particularly, pigs are valuable for pharmacological and toxicological studies for humans because of the accumulation of information about the similarities and differences between pigs and humans concerning the expression of drug-metabolizing enzymes (DMEs), especially CYPs, and their enzymatic activities.^8–13) To date, we have identified sex and breed differences in the expression of DMEs such as CYPs, sulfotransferases, and uridine 5′-diphosphate (UDP)-glucuronosyltransferases in the liver and kidney of Landrace and Meishan pigs, and further demonstrated that serum androgen is one of the critical factors producing these differences.^14–16) However, no information is available on the sex and organ differences of the gene expression of drug transporters in pigs.

In the present study, we examined the sex, organ, and breed differences in the mRNA expression of BCRP, MDR1, MRP2, OATP1B3, OAT1, OAT2, OAT3, OCT1, and OCT2 in the liver and kidney of Meishan, Landrace, and their crossbred F₁ pigs with genetically differing levels of serum androgen in males.¹⁷⁾ Furthermore, we examined whether androgen is a critical factor determining the mRNA levels of these transporters.

MATERIALS AND METHODS

Animals and Testosterone Administration

Five-month-old Meishan, Landrace, and their crossbred F₁ (ML, female Meishan × male Landrace; LM, female Landrace × male Meishan) pigs, the same as those used in our previous studies,^15,18) were used. Some of the male Meishan and Landrace pigs were castrated at 1-month-old and killed at 5-month-old. A portion of the kidney or liver from each pig was quickly removed, frozen in liquid nitrogen, and stored at −80 °C for subsequent analyses. Administration of testosterone was performed as described previously.^19,20) Briefly, testosterone propionate (TP; Sigma Chemical Co., St. Louis, MO, U.S.A.) dissolved in corn oil was injected intramuscularly (10 mg/kg body weight) five times every 48 h into the rear leg of each pig. The pigs were killed 24 h after the final injection.

All animal experiments in the present study were conducted under the guidelines of the Animal Care Committee of the National Institute of Livestock and Grassland Science (Approved Nos. 1911B068, 20B005NILGS, and 21B006ILGS).

Serum Testosterone Level

The serum testosterone level in each pig was measured using a Testosterone ELISA Kit (Enzo Life Sciences Inc., Famingdale, NY, U.S.A.) following the manufacturer’s instructions, as previously described.²⁰⁾ For the data excluding some of female pigs, previously obtained data were used.^15,18)

Expression of Drug Transporter mRNA

Total RNA was prepared from each tissue using TRIzol Reagent (Invitrogen Corp., Carlsbad, CA, U.S.A.), and mRNA expression was measured by real-time RT-PCR using a 7500 Real Time PCR System and Power SYBR green master mix (PE Applied Systems, Tokyo, Japan), as previously described.¹⁷⁾ The primer sets used in this study are indicated in Table 1. Ribosomal protein L7 (RPL7) was used as an internal standard. The amount of each cDNA was determined by the relative standard curve method according to PE Applied Biosystems User Bulletin #2 (1997). RT-reaction mixtures with total RNA from the liver of female Landrace pigs or from the kidney of female Landrace pigs were used for generation of standard curves to determine the BCRP, MDR1, MRP2, OAT2, OATP1B3, and OCT1 mRNA expression or the OAT1, OAT3, and OCT2 mRNA expression, respectively.

Table 1. Primer Pairs Used in This Study

Protein	Gene	Forward primer (5′–3′)	Reverse primer (5′–3′)	Accession no.
BCRP	ABCG2	agataattgtgacgatcatcctggg	gctgctgaaacactggttgg	NM_214010
MDR1	ABCB1	tcaggatgttctcttagtcttctcag	gatgccgacactttggctttg	NM_0010308246
MRP2	ABCC2	ccatcatggacagtgacaaggtaa	cagaaggctgtgctgtgtgtatt	XM_021073710
OAT1	SLC22A6	gctcgtctccgtgcccttt	cccagaggaagagtaccagcg	NM_001001261
OAT2	SLC22A7	cccagaggaagagtaccagcg	cccagaggaagagtaccagcg	NM_001044617
OAT3	SLC22A8	ggctccagctcaccgtgt	gaggactttccagacaggaccat	NM_214455
OATP1B3	SLCO1B3	ggttgcttcataatgggacttgga	agcctgatgttgaattctctaatgga	NM_001315607
OCT1	SLC22A1	tccttctgctctgctactggtt	cggtccattatctttattgcttgagt	NM_001348975
OCT2	SLC22A2	tcaccgacatctggcacga	caatggtctcaggcaaagtctt	NM_213902
RPL7	RPL7	tcttcgcctccgtcagatctt	tggatacccccaggcgatata	NM_001113217

Statistical Analysis

Significant differences were assessed by Tukey’s post hoc test after ANOVA or Student’s t-test. Correlations between the indicated parameters were examined by regression analysis.

RESULTS

Expression of Drug Transporter mRNA in the Liver and Kidney

The mRNA expression levels of drug transporters in the liver are indicated in Table 2. In Meishan pigs, there were clear sex differences in the mRNA amounts of MDR1, OATP1B3, and OCT1, and these amounts in females were 2.3-, 1.7-, and 2.9-fold higher, respectively, compared with those in males. The mRNA amounts of MDR1 and OCT1 in males were >2-fold higher in Landrace pigs than in Meishan pigs, but such breed differences were not observed in females. However, no sex differences in the amounts of all transporter mRNAs herein examined were observed in Landrace pigs. Furthermore, no sex differences in the mRNA expression of BCRP, MRP2, and OAT2 were observed in Meishan pigs. Among these mRNAs, the amounts of BCRP mRNA in Meishan pigs were approximately 60% of those in the sex-matched Landrace pigs. In addition, OAT1, OAT3, and OCT2 mRNAs were not detected in the liver of either breed of pig.

Table 2. Sex and Breed Differences in the mRNA Expression of Drug Trasnporters in the Liver of Meishan and Landrace Pigs

Transporters	Meishan pigs		Landrace pigs
	Male	Female	Male	Female
BCRP	0.727 ± 0.256c)	0.670 ± 0.072c)	1.142 ± 0.173	1.164 ± 0.127
MDR1	0.485 ± 0.167b,c)	1.149 ± 0.256	1.401 ± 0.286	1.500 ± 0.331
MRP2	1.156 ± 0.220	1.053 ± 0.265	1.231 ± 0.280	1.138 ± 0.280
OAT1	nd*	nd	nd	nd
OAT2	0.941 ± 0.135	1.146 ± 0.239	1.068 ± 0.280	1.173 ± 0.200
OAT3	nd	nd	nd	nd
OATP1B3	0.850 ± 0.164a)	1.404 ± 0.329	1.045 ± 0.399	1.262 ± 0.431
OCT1	0.444 ± 0.197 b,c)	1.290 ± 0.220	0.997 ± 0.150	1.206 ± 0.237
OCT2	nd	nd	nd	nd

The amount of each mRNA was expressed as the relative ratio to the amount of RPL7 mRNA in individual livers, and each datum represents the mean ± S.D. (n = 8 for both sexes of Meishan pigs and female Landrace pigs; n = 7 for male Landrace pigs). Significant differences were assessed using Tukey’s post hoc test. ^{a, b)} Significant sex differences in each breed: ^a) p < 0.05, ^b) p < 0.01. ^c) Significant breed differences between sex matched Meishan and Landrace pigs: ^c) p < 0.01. * nd, not detected.

The mRNA amounts of drug transporters in the kidney are shown in Table 3. Only OATP1B3 mRNA was undetected in either Landrace or Meishan pigs. Breed differences in the mRNA amounts of BCRP and OAT1 in the kidney were observed between Meishan and Landrace pigs. Moreover, the amounts of BCRP mRNA in Meishan pigs were higher than those of the sex-matched Landrace pigs. However, the amounts of OAT1 mRNA in Landrace pigs were approximately five-fold higher in males and two-fold higher in females compared with those in the sex-matched Meishan pigs. In addition, the amounts of OAT2 mRNA in female Meishan pigs were significantly high compared with those in female Landrace pigs. In Meishan kidneys, the mRNA amounts of MRP2, OAT3, and OCT2 in males were 1.7-, 1.4-, and 2.7-fold higher, respectively, compared with the corresponding amounts in females, whereas those of OAT1 and OAT2 in females were 2.5- and 2.9-fold higher, respectively, compared with the corresponding amounts in males. Such sex differences were not observed in Landrace pigs. In addition, no sex differences in the kidney were observed in either Meishan pigs or Landrace pigs regarding the mRNA expression of BCRP, MDR1, or OCT1.

Table 3. Sex and Breed Differences in the mRNA Expression of Drug Trasnporters in the Kidney of Meishan and Landrace Pigs

Transporters	Meishan pigs		Landrace pigs
	Male	Female	Male	Female
BCRP	0.810 ± 0.114c)	0.856 ± 0.121c)	0.581 ± 0.110	0.621 ± 0.183
MDR1	0.062 ± 0.004	0.069 ± 0.004	0.076 ± 0.012	0.067 ± 0.016
MRP2	0.819 ± 0.151b,d)	0.476 ± 0.055	0.528 ± 0.118	0.549 ± 0.118
OAT1	0.285 ± 0.129 a,d)	0.714 ± 0.124d)	1.390 ± 0.290	1.512 ± 0.290
OAT2	0.010 ± 0.004b)	0.029 ± 0.015d)	0.005 ± 0.002	0.003 ± 0.001
OAT3	1.372 ± 0.310a)	0.959 ± 0.087	1.340 ± 0.181	1.321 ± 0.266
OATP1B3	nd*	nd	nd	nd
OCT1	0.728 ± 0.109	0.785 ± 0.294	0.909 ± 0.386	0.853 ± 0.401
OCT2	2.885 ± 0.938b)	1.088 ± 0.346	2.197 ± 0.761	1.487 ± 0.579

The amount of each mRNA was expressed as the relative ratio to the amount of RPL7 mRNA in individual kidneys, and each datum represents the mean ± S.D. (n = 6 in all the experimental groups). Significant differences were assessed using Tukey’s post hoc test. ^{a, b)} Significant sex differences in each breed: ^a) p < 0.05, ^b) p < 0.01. ^{c, d)} Significant breed differences between sex matched Meishan and Landrace pigs: ^c) p < 0.05, ^d) p < 0.01. * nd, not detected.

Next, organ differences between the liver and the kidney were examined based on the data shown in Tables 2 and 3. In both sexes of Meishan and Landrace pigs, the mRNA amounts of MDR1, MRP2, and OAT2 in the liver were higher than the corresponding amounts in the kidney, while the organ difference in the amount of OCT2 mRNA was the opposite (Table 4). Regarding OCT1 mRNA expression, organ differences (liver < kidney in males and liver > kidney in females) were observed in Meishan pigs, and thus sex-related differences were derived from a clear sex difference in its amount in the liver (Table 2 and Fig. 1). However, no such sex-related difference was observed in Landrace pigs.

Table 4. Organ Differences between Liver and Kidney in the mRNA Expression of Drug Transporters in Both Sexes of Meishan and Landrace Pigs

Transporters	Meishan		Landrace
	Male	Female	Male	Female
BCRP	Li = Ki	Li < Ki	Li > Ki	Li > Ki
MDR1	Li > Ki	Li > Ki	Li > Ki	Li > Ki
MRP2	Li > Ki	Li > Ki	Li > Ki	Li > Ki
OAT1a)	Ki	Ki	Ki	Ki
OAT2	Li > Ki	Li > Ki	Li > Ki	Li > Ki
OAT3a)	Ki	Ki	Ki	Ki
OATP1B3b)	Li	Li	Li	Li
OCT1	Li < Ki	Li > Ki	Li = Ki	Li = Ki
OCT2a)	Ki	Ki	Ki	Ki

Organ differences were determined based on the data shown in Tables 2 and 3: Li, liver; Ki, kidney. ^a) Clearly detected in the kidney, but not in the liver. ^b) Clearly detected in the liver, but not in the kidney.

Fig. 1. Effects of Castration and/or TP Administration on the mRNA Expression of MDR1, OATP1B3, and OCT1 in the Liver

Each column represents the mean of each experimental group, and each bar represents the standard deviation (S.D.) of the mean (n = 8 for intact male and female Meishan pigs; n = 7 and n = 8 for intact male and female Landrace pigs, respectively; n = 3 for others). M, male; CM, castrated male; F, female. * Significant differences from the corresponding intact male pigs were assessed by Tukey’s post hoc test: * p < 0.01. ^+,++ Significant differences from the corresponding TP untreated pigs, as assessed by Student’s t-test: ⁺ p < 0.05, ⁺⁺ p < 0.01.

Androgen Involvement in the Gene Expression of Representative Sex-Related Transporters

To clarify whether androgen is involved in the sex-related gene expression of hepatic drug transporters such as MDR1, OATP1B3, and OCT1, the effects of castration and/or TP administration were examined in Meishan and Landrace pigs (Fig. 1). In Meishan pig liver, castration resulted in a significant increase in the mRNA expression of OATP1B3 and OCT1, and TP administration to castrated males and intact females resulted in considerable reductions in the mRNA expression. Nonetheless, no such castration effects were observed in Landrace pigs; however, TP administration to castrated males and intact females resulted in a clear decrease in the amount of OCT1 mRNA but not OATP1B3 mRNA. No such effects of TP administration were obtained in either breed for MDR1 mRNA, although MDR1 mRNA expression was increased by castration in male Meishan pigs.

Similarly, the effects of castration and/or TP administration on the sex-related gene expression of transporters (MRP2, OAT1, OAT2, OAT3, and OCT2) in the kidney were examined (Fig. 2). In Meishan pigs, castration resulted in a significant increase in the amount of OAT1 mRNA, and TP administration to castrated males and intact females resulted in considerable decrease in its amount. In Landrace pigs, TP administration to castrated males and intact females also resulted in decrease in the amount of OAT1 mRNA, whereas castration had no significant effect on its amount. Regarding the expression of OCT2 mRNA in males, no significant effect of castration was observed in either breed of pig. Furthermore, TP administration to castrated male and intact female Landrace pigs resulted in increase in the amount of OCT2 mRNA, whereas in Meishan pigs, this effect was only observed in intact females. In females of both breeds of pig, TP administration resulted in a significant decrease in the amount of OAT2 mRNA. Castration and TP administration to castrated males had no significant effects on the amount of OAT2 mRNA in either breed of pigs, although it was decreased by TP administration in castrated Landrace pigs. A significant increase in MRP2 mRNA expression was only observed in female Meishan pigs following TP administration. In addition, no significant effects of castration and TP administration on OAT3 mRNA expression were observed in either breed of pig.

Fig. 2. Effects of Castration and/or TP Administration on the mRNA Expression of MRP2, OAT1, OAT2, OAT3, and OCT2 in the Kidney

Each column represents the mean of each experimental group, and each bar represents the S.D. of the mean (n = 6 for intact male and female of Meishan and Landrace pigs; n = 3 for others). M, male; CM, castrated male; F, female. *^,** Significant differences from the corresponding intact male pigs were assessed by Tukey’s post hoc test: * p < 0.05, ** p < 0.01. ^+,++ Significant differences from the corresponding TP untreated pigs, as assessed by Student’s t-test: ⁺ p < 0.05, ⁺⁺ p < 0.01.

Genetic Factors Responsible for Sex-Related Gene Expression of Transporters

We previously reported that sex-related expression of CYP mRNA in pig liver and kidney is, at least in part, regulated by the serum testosterone level,^14,15) which is determined by autosomal dominant inheritance.¹⁷⁾ Therefore, using F₁ progeny (ML and LM) between Meishan and Landrace pigs, sex-related transporter mRNAs in the liver and kidney were examined. Incidentally, the serum testosterone levels in male ML and LM pigs, as well as in male Meishan pigs, were >40 ng/mL serum, while those in the corresponding Landrace pigs were <23 ng/mL.

The mRNA expression of sex-related transporters such as MDR1, OATP1B3, and OCT1 in the liver of ML and LM pigs is shown in Fig. 3. In both breeds, the mRNA amounts of OCT1 and MDR1 in males were significantly low compared with the corresponding females. Similarly, OATP1B3 mRNA expression in male ML pigs, but not in male LM pigs, was significantly low compared with the corresponding females.

Fig. 3. Sex Differences in the mRNA Expression of MDR1, OATP1B3, and OCT1 in the Liver of ML and LM Pigs

Each circle shows an individual pig (n = 8 and 11 for male and female ML pigs, respectively; n = 7 and n = 9 for male and female LM pigs, respectively). The bar indicates the average in each group. ^a Significant differences between males and females of each breed were assessed by Student’s t-test: ^a p < 0.01.

The mRNA amounts of sex-related transporters including MRP2, OAT1, OAT2, and OCT2 in the kidney of ML and LM pigs are shown in Fig. 4. In both ML and LM pigs, OCT2 mRNA expression in males was significantly high compared with that of the corresponding females. Similarly, MRP2 mRNA expression was high in male LM pigs, but not in male ML pigs, compared with the corresponding females. Conversely, the mRNA amounts of OAT1 and OAT2 in female ML pigs were significantly high compared with those in the corresponding males, while significant sex differences were not observed in LM pigs. In addition, analysis of renal OAT3 mRNA was not performed because castration and TP administration had no effects on its expression, as described above (Fig. 2).

Fig. 4. Sex Differences in the mRNA Expression of MRP2, OAT1, OAT2, and OCT2 in the Kidney of ML and LM Pigs

Each circle shows an individual pig (n = 8 and n = 11 for male and female ML pigs, respectively; n = 7 and n = 9 for male and female LM pigs, respectively). The bar indicates the average in each group. ^a,b Significant differences between males and females of each breed were assessed by Student’s t-test: ^a p < 0.05, ^b p < 0.01.

Relationship between Serum Testosterone Concentration and Gene Expression of Sex-Related Transporters

We have demonstrated that the serum androgen level is one of the critical factors promoting sex and breed differences in the mRNA expression of several DMEs in pigs.^15–20) Therefore, the relationship between serum testosterone concentration and the sex-related expression of transporter mRNAs was further examined.

In the liver, negative correlations between serum testosterone concentrations and amounts of MDR1, OATP1B3, and OCT1 mRNAs were observed (Fig. 5). In the kidney, there were positive correlations between serum testosterone concentrations and amounts of MRP2 and OCT2 mRNAs, while there were negative correlations concerning those of OAT1 and OAT2 (Fig. 6). In addition, in Figs. 5 and 6, the data from all female pigs examined were plotted without distinguishing the breeds because the serum testosterone concentrations in the females of all breeds were less than 8 ng/mL.

Fig. 5. Correlations between Serum Testosterone Concentrations and the mRNA Amounts of MDR2, OATP1B3, and OCT1 in the Pig Liver

Each symbol represents each individual pig. Open circles, female pigs (n = 8 for Meishan and Landrace pigs; n = 11 for ML pigs; n = 9 for LM pigs); closed circles, male Meishan pigs (n = 8); closed squares, male Landrace pigs (n = 7); closed reverse triangles, male ML pigs (n = 8); and closed triangles, male LM pigs (n = 7). Correlations were examined using data from all animals tested and were determined by regression analysis, where r is the correlation coefficient.

Fig. 6. Correlations between Serum Testosterone Concentrations and mRNA Amounts of MRP2, OAT1, OAT2, and OCT2 in the Pig Kidney

Each symbol represents an individual pig. Open circles, female pigs (n = 6 for Meishan and Landrace pigs; n = 11 for ML pigs; n = 9 for LM pigs); closed circles, male Meishan pigs (n = 6); closed squares, male Landrace pigs (n = 6); closed reverse triangles, male ML pigs (n = 8); and closed triangles, male LM pigs (n = 7). The correlations were examined using data from all animals tested and were determined by regression analysis, where r is the correlation coefficient.

DISCUSSION

In the present study, we examined the sex, organ, and breed differences in the gene expression of drug transporters (BCRP, MDR1, MRP2, OAT1, OAT2, OAT3, OATP1B3, OCT1, and OCT2) in the liver and kidney of 5-month-old Landrace, Meishan, and their crossbred F₁ (ML and LM) pigs. There are considerable differences between Landrace pigs and other breeds regarding the serum testosterone level in males: <23 ng/mL in Landrace pigs and >40 ng/mL in Meishan, ML, and LM pigs.^15,17) Incidentally, we previously demonstrated that the serum testosterone concentration in pigs is determined by autosomal dominant inheritance.¹⁷⁾

Regarding the expression of drug transporters, organ differences between the liver and the kidney were identified in Meishan and Landrace pigs (Table 4) for OAT1, OAT3, OATP1B3, and OCT2 mRNAs. OATP1B3 mRNA was clearly detected in the liver but was undetected in the kidney, while other mRNAs were clearly detected in the kidney but not in the liver. Organ differences (liver > kidney) in the mRNA amounts of MDR1, MRP2, and OAT2 were also identified. Furthermore, the organ difference (liver > kidney) in the amount of MDR1 mRNA in pigs was consistent with previous results reported in pigs.²¹⁾

Organ differences between the liver and the kidney in several drug transporters have been reported in mice, rats, and humans. The organ differences (liver > kidney) in the mRNA amounts of MRP2, OAT2, and OATP1B3 herein identified in pigs were consistent with the results previously reported in humans,^22–24) while the organ differences in the amount of OAT2 mRNA was the opposite in mice.^25,26) Furthermore, sex-related organ differences in the amount of OAT2 mRNA (liver > kidney in males and liver < kidney in females) were observed in rats,^27,28) and this is due to a clear sex difference (female > male) in its amount in the kidney but not in the liver. The organ difference (liver > kidney) in MDR1 mRNA expression in pigs was the opposite in mice and humans.^1,29,30) Furthermore, the organ differences (liver > kidney) in the BCRP mRNA expression in humans³¹⁾ and Landrace pigs were the opposite in mice and rats.³²⁾ With respect to OCT1 mRNA, there was a clear organ difference (liver ≫ kidney) in its amount in humans,^1,33) while there were no such differences in pigs as well as mice^1,34) and rats.^35,36) The organ differences (kidney ≫ liver) in the mRNA amounts of OAT1, OAT3, and OCT2 herein found in pigs were consistent with the results previously reported in mice,^25,34) rats,^27,28,37) and humans.^23,33) Thus, organ and species differences strongly suggest the existence of genetically controlled organ-selective factors regulating the gene expression of drug transporters. In addition, we have previously found such organ and breed differences in the expression of CYPs in pigs.¹⁵⁾

Sex differences in the mRNA amounts of MDR1, OATP1B3, and OCT1 in the liver and in those of MRP2, OAT1, OAT2, OAT3, and OCT2 in the kidney were observed in Meishan, ML, and/or LM pigs, but not in Landrace pigs. Incidentally, strain-related sex differences between B6 and 129J mice concerning the expression of renal Oat3 mRNA have been reported.²⁵⁾ The sex differences concerning the amounts of hepatic OCT1 mRNA and renal OAT1 mRNA seem to originate from the differences in serum testosterone concentration. This hypothesis is supported by the findings that the amounts of hepatic OCT1 mRNA and renal OAT1 mRNA decreased in a serum testosterone concentration-dependent manner (Figs. 5, 6) and that there was a positive correlation (r = 0.5784, p < 0.0001) between the amounts of hepatic OCT1 mRNA and renal OAT1 mRNA (data not shown). Thus effects of testosterone on the amounts of those mRNAs were also observed in the castrated males and intact females of Meishan and Landrace pigs.

The sex differences in the mRNA expression of hepatic MDR1 and OATP1B3 and in those of renal MRP2, OAT2, OAT3, and OCT2 may be due to the sex-dependent factors, which express under genetic and organ-selective control, together with/rather than serum testosterone concentration; this is because the expected effects of castration and TP administration on their gene expression were not necessarily obtained. As a representative example, there was a sex difference (male < female) in the expression of MDR1 mRNA in the liver of Meishan, ML, and LM pigs with high concentrations of serum testosterone in males. There was a good correlation between serum testosterone concentration and hepatic MDR1 mRNA amount, but no significant effects of TP administration on its amount in castrated males and intact females were observed. Similarly, no significant effects of castration and TP administration on the amounts of hepatic OATP1B3 mRNA and renal MRP2 and OAT3 mRNAs were observed in Landrace and/or Meishan pigs. Furthermore, no significant effect of TP administration on the amount of renal OCT2 mRNA was observed in castrated Meishan pigs.

Sex differences in the mRNA/protein amounts of hepatic and renal drug transporters have been reported in mice, rats, and humans,^1,3,4) and these data, together with the present findings, are summarized in Table 5. The pattern of sex differences in the mRNA/protein expression of each drug transporter was not necessarily identified among the animal species. For example, there were sex differences (male > female) concerning hepatic BCRP/Bcrp in mice^32,38) and humans,³⁸⁾ while no such sex differences were observed in either pigs or rats.³²⁾ Furthermore, a sex difference in the amount of Bcrp mRNA in the kidney of rats, but not in pigs and mice, was observed.³²⁾ Sex difference (male < female) in the amount of hepatic MDR1 mRNA in pigs was consistent with that in the Mdr1 protein amount in rats,³⁹⁾ whereas the opposite sex difference was observed in humans.⁴⁰⁾ In mice, there was a sex difference (male < female) in the kidney,^30,41) but not in the liver.³⁰⁾ Concerning hepatic MRP2/Mrp2 mRNA, no sex difference was observed in either pigs or mice,⁴²⁾ while a sex difference (male < female) has been reported in rats.⁴³⁾ In addition, sex differences in the mRNA amounts of OCT1 and OATP1B3 in the pig liver were first identified in the present study. With regards to OCT2 mRNA being predominantly expressed in the kidney, there was a clear sex difference (male > female) in pigs as well as in mice³⁴⁾ and rats.^36,44,45) Sex difference (male < female) in the amount of renal OAT1 mRNA was observed in pigs, while the converse sex difference was observed in mice^25,46) and rats.^27,47,48) Furthermore, the sex difference (male < female) in the amount of renal OAT2 mRNA in pigs was consistent with those in mice⁴⁹⁾ and rats.^27,28,48,49) Furthermore, the sex difference (male > female) in the amount of renal OAT3 mRNA in pigs was consistent with that in rats,^22,47) while its difference was the opposite in mice.^25,46)

Table 5. Sex Differences in the mRNA/Protein Amounts of Hepatic and Renal Drug Transporters Identified in the Present and Previous Studies of Pigs, Mice, Rats, and Humans

Transporters	Liver				Kidney
	Pigsa)	Mice	Rats	Humans	Pigsa)	Mice	Rats	Humans
BCRP/Bcrp	♂ = ♀	♂ > ♀32,38)	♂ = ♀32)	♂ > ♀38)	♂ = ♀	♂ = ♀32)	♂ > ♀32)	nr*
MDR1/Mdr1b)	♂ < ♀	♂ = ♀30)	♂ < ♀39)	♂ > ♀40)	♂ = ♀	♂ < ♀30,41)	nr	nr
MRP2/Mrp2	♂ = ♀	♂ = ♀42)	♂ < ♀43)	nr	♂ = ♀	♂ = ♀42)	nr	nr
OAT1/Oat1	—**	—25)	—27)	nr	♂ < ♀	♂ > ♀25,46)	♂ > ♀27,47,48)	nr
OAT2/Oat2	♂ = ♀	♂ < ♀26)	♂ = ♀27,28)	nr	♂ < ♀	♂ < ♀49)	♂ < ♀27,28,48,49)	nr
OAT3/Oat3	—	♂ > ♀25)	♂ > ♀27,28,48)	nr	♂ > ♀	♂ < ♀25,46)	♂ > ♀27,47)	nr
OATP1B3	♂ < ♀			nr	—			nr
OCT1/Oct1	♂ < ♀	♂ = ♀34)	nr	nr	♂ = ♀	♂ = ♀34)	♂ = ♀44,45)	nr
OCT2/Oct2	—	—34)	♂ = ♀36)	nr	♂ > ♀	♂ > ♀34)	♂ > ♀36,44,45)	nr

Superscript numbers represent the reference numbers. ^a) Meishan pigs with sex differences in the expression of several molecular species. ^b) Without distinction of Mdr1a and Mdr1b. *nr: not reported. ** —: not detected.

As the causes of sex differences in the expression of drug transporters, sex hormones and growth hormone (GH) secretion pattern have previously been reported.^1,3,4) As the molecular species of drug transporters whose expression amount is increased by androgen, hepatic Bcrp mRNA in mice,³²⁾ renal Oct2 mRNA/protein in mice^34,50) and rats,⁵¹⁾ renal Oat1 mRNA/protein in mice⁴⁶⁾ and rats,^47,48) and hepatic²⁸⁾ and renal⁴⁷⁾ Oat3 mRNA/protein in rats have been reported. In addition, the existence of an androgen response element responsible for testosterone was demonstrated in the Oct2 promoter region in rats.⁵²⁾ On the other hand, as the molecular species whose expression amount is decreased by androgen, renal Oat2 mRNA/protein in rats,^28,49) renal Oat2⁴⁹⁾ and Oat3⁴⁶⁾ proteins in mice, and renal Mdr1a/Mdr1b mRNA in mice³⁰⁾ have been reported. Regarding the mRNA/protein expression of Bcrp,³²⁾ Oct2,⁵¹⁾ Oat1 and Oat3,⁴⁷⁾ inhibitory effects of estrogen have been reported in the rat kidney. More recently, estrogen-stimulated expression of renal Mdr1 protein has also been reported in cultured renal tissues from mice.⁴¹⁾ In addition, the combination effects of GH secretory patterns and sex hormones/thyroxin on the expression of hepatic Oat3⁴⁸⁾ and Mrp2⁴³⁾ and of renal Oat2⁴⁸⁾ in rats have been reported. In addition, it is considered that GH secretory patterns have little to do with the sex difference in the expression of drug transporters in pigs because no sex differences in those expressions were observed in Landrace pigs with a sex difference in GH secretory profile.⁵³⁾

In conclusion, to our knowledge, we reveal for the first time that there are sex, organ, and breed differences in the expression levels of several drug transporters in the liver and kidney of pigs, and further demonstrate that the mRNA expression of hepatic OCT1 and renal OAT1 is decreased in a serum testosterone concentration-dependent manner. Furthermore, we suggest that the organ and breed (species) differences in the expression of drug transporters may be dependent on differences in genetically controlled organ-selective factors including serum testosterone concentration. Given the findings thus far, it seems difficult to predict the expression levels of drug transporters and DMEs in individual humans from research using experimental animals. However, further studies of the relationship between serum sex hormone levels and drug treatment effects are necessary for the establishment of individual drug treatments; this is because some drug transporters and DMEs are expressed in a serum sex hormone concentration-dependent manner.

Acknowledgments

This work was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (No. 19K06463, M.K.). The authors thank the Tsukuba Operation Unit 7, Technical Support Center of Central Region, NARO, Tsukuba, Japan for the care of animals and for collecting tissues.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Klaassen CD, Aleksunes LM. Xenobiotic, bile acid, and cholesterol transporters: function and regulation. Pharmacol. Rev., 62, 1–96 (2010).
• 2) Nigam SK. What do drug transporters rellay do? Nat. Rev. Drug Discov., 14, 29–44 (2015).
• 3) Morris ME, Lee H-J, Predko LM. Gender differences in the membrane transport of endogenous and exogenous compounds. Pharmacol. Rev., 55, 229–240 (2003).
• 4) Yacovino LL, Aleksunes LM. Endocrine and metabolic regulation of renal drug transporters. J. Biochem. Mol. Toxicol., 26, 402–421 (2012).
• 5) Henze LJ, Koehl NJ, O’Shea JP, Kostewicz ES, Holm R, Griffin BT. The pigs as a preclinical for predicting oral bioavailability and in vitro performance of pharmaceutical oral dosage forms: a PEARRL review. J. Pharm. Pharmacol., 71, 581–602 (2019).
• 6) Swindle MM, Smith AC. Comparative anatomy and physiology of the pig. Scand. J. Lab. Anim. Sci., 25 (Suppl. 1), 11–22 (1998).
• 7) Bode G, Clausing P, Gervais F, Loegsted J, Luft J, Nogues V, Sims J. The utility of the minipig as an animal model in regulatory toxicology. J. Pharmacol. Toxicol. Methods, 62, 196–220 (2010).
• 8) Elmorsi Y, Al Feteisi H, Al-Majdoub ZM, Barber J, Rostami-Hodjegan A, Achour B. Proteomic characterization of drug metabolizing enzymes and drug transporters in pig liver. Xenobiotica, 50, 1208–1219 (2020).
• 9) Burkina V, Rasmussen MK, Pilipenko N, Zamaratskaia G. Comparison of xenobitotic-metabolising human, porcine, rodent, and piscine cytochorome P450. Toxicology, 375, 10–27 (2017).
• 10) Puccinelli E, Gervasi PG, Longo V. Xenobitotic metabolizing cytochrome P450 in pig, a promising animal model. Curr. Drug Metab., 12, 507–525 (2011).
• 11) Schelstraete W, de Clerck L, Govaert E, Millecam J, Devreese M, Deforce D, van Bocxlaer J, Croubels S. Characterixation of porcice hepatic and intestinal drug metabolizing CYP450: comparison with human orthologues from a quantitative, activity and selectivity perspective. Sci. Rep., 9, 9233 (2019).
• 12) Skaanild MT. Porcine cytochrome P450 and metabolism. Curr. Pharm. Des., 12, 1421–1427 (2006).
• 13) Kojima M, Morozumi T. Cloning of six full-length cDNAs encoding pig cytochrome P450 enzymes and gene expression of these enzymes in the liver and kidney. J. Health Sci., 50, 518–529 (2004).
• 14) Kojima M. Sex and breed differences in the constitutive gene expression of hepatic drug metabolizing1 enzymes in Meishan and Landrace pigs: testosterone-mediated differences. Japan Agricultural Research Quarterly, 54, 7–12 (2020).
• 15) Kojima M, Degawa M. Androgen-dependent differences in the amounts of CYP mRNAs in the pig kidney. Biol. Pharm. Bull., 44, 1120–1128 (2021).
• 16) Kojima M, Degawa M. Sex differences in the constitutive gene expression of sulfotransferases and UDP-glucuronosyltransferases in the pig liver: androgen-mediated regulation. Drug Metab. Pharmacokinet., 29, 192–197 (2014).
• 17) Kojima M, Degawa M. Serum androgen level is determined by autosomal dominant inheritance and regulates sex-related CYP genes in pigs. Biochem. Biophys. Res. Commun., 430, 833–838 (2013).
• 18) Kojima M, Degawa M. Sex differences in constitutive mRNA levels of CYP2B22, CYP2C33, CYP2C49, CYP3A22, CYP3A29 and CYP3A46 in the pig liver: comparison between Meishan and Landrace pigs. Drug Metab. Pharmacokinet., 31, 185–192 (2016).
• 19) Kojima M, Sekimoto M, Degawa M. A novel gender-related difference in the constitutive expression of hepatic cytochrome P4501A subfamily enzymes in Meishan pigs. Biochem. Pharmacol., 75, 1076–1082 (2008).
• 20) Kojima M, Sekimoto M, Degawa M. Androgen-mediated down-regulation of CYP1A subfamily genes in the pig liver. J. Endocrinol., 207, 203–211 (2010).
• 21) Guo T, Huang J, Zhang H, Dong L, Guo D, Guo L, He F, Bhutto ZA, Wang L. Abcb1 in pigs: Molecular cloning, tissue distribution, functional analysis, and its effect on pharmacokinetics of enrofloxacin. Sci. Rep., 6, 32244 (2016).
• 22) Kool M, de Haas M, Scheffer GL, Scheper RJ, van Eijk MJ, Juijn JA, Baas F, Borst P. Analysis of expression of cMOAT (MRP2), MRP3, MRP4, and MRP5, homologues of the multidrug resistance-associated protein gene (MRP1), in human cancer cell lines. Cancer Res., 57, 3537–3547 (1997).
• 23) Sun W, Wu RR, van Poelje PD, Erion MD. Isolation of a family of organic anion transporters from human liver and kidney. Biochem. Biophys. Res. Commun., 283, 417–422 (2001).
• 24) König J, Cui Y, Nies AT, Keppler D. Localization and genomic organization of a new hepatocellular organic anion transporting polypettide. J. Biol. Chem., 275, 23161–23168 (2000).
• 25) Buist SCN, Klaassen CD. Rat and mouse differences in gender-predominant expression of organic anion transporter (OAT1-3; SLC22A6-8) mRNA levels. Drug Metab. Dispos., 32, 620–225 (2004).
• 26) Kobayashi Y, Ohshiro N, Shibusawa A, Sasaki T, Tokuyama S, Sekine T, Endou H, Yamamoto T. Isolation, characterization, and differential gene expression of multispecific organic anion transporter 2 in mice. Mol. Pharmacol., 62, 7–14 (2002).
• 27) Buist SCN, Cherrington NJ, Choudhuri S, Hartley DP, Klaassen CD. Gender-specific and development influences on the expression of rat organic anion transporters. J. Pharmacol. Exp. Ther., 301, 145–151 (2002).
• 28) Kobayashi Y, Hirokawa N, Ohshiro N, Sekine T, Sasaki T, Tokuyama S, Endou H, Yamamoto T. Differential gene expression of organic anion transporters in male and female rats. Biochem. Biophys. Res. Commun., 290, 482–487 (2002).
• 29) Fojo AT, Ueda K, Slamon DJ, Poplack DG, Gottesman MM, Pastan I. Expression of multidrug-resistance gene in human tumors and tissues. Proc. Natl. Acad. Sci. U.S.A., 84, 265–269 (1987).
• 30) Cui YJ, Cheng X, Weaver YM, Klaassen CD. Tissue distribution, gender-divergent expression, ontogeny, and chemical induction of multidrug resistance transporter genes (Mdr1a, Mdr1b, Mdr2) in mice. Drug Metab. Dispos., 37, 203–210 (2009).
• 31) Fetsch PA, Abati A, Litman T, Morisaki K, Honjo Y, Mittal K, Bates SE. Localizaiont of the ABCG2 mitoxantrone resistance-associated protein in normal tissues. Cancer Lett., 235, 84–92 (2006).
• 32) Tanaka Y, Slitt AL, Leazer TM, Maher JM, Klaassen CD. Tissue distribution and hormonal regulation of the breast cancer resistance protein (Bcrp/Abcg2) in rats and mice. Biochem. Biophys. Res. Commun., 326, 181–187 (2004).
• 33) Gorboulev V, Ulzheimer JC, Akhoundova A, Ulzheimer-Teuber I, Karbach U, Quester S, Baumann C, Lang F, Busch AE, Koepsell H. Cloning and characterization of two human polyspecific organ cation transporters. DNA Cell Biol., 16, 871–881 (1997).
• 34) Alnouti Y, Petrick JS, Klaassen CD. Tissue distribution and ontogeny of organic cation transporters in mice. Drug Metab. Dispos., 34, 477–482 (2006).
• 35) Gründemann D, Gorboulec V, Gambaryan S, Veyhl M, Koepsell H. Drug excretion mediated by a new prototype of polyspecific transporter. Nature, 372, 549–552 (1994).
• 36) Slitt AL, Cherrington NJ, Hartley DP, Leazer TM, Klaassen CD. Tissue distribution and renal developmental changes in rat organic cation transporter mRNA levels. Drug Metab. Dispos., 30, 212–219 (2002).
• 37) Okuda M, Saito H, Urakami Y, Takano M, Inui K. cDNA cloning and functional expression of a novel rat kidney organic caiton transporter, OCT2. Biochem. Biophys. Res. Commun., 224, 500–507 (1996).
• 38) Merino G, van Herwaarden AE, Wagenaar E, Jonker JW, Schinkel AH. Sex-dependent expression and activity of the ATP-binding cassette transporter breast cancer resistance protein (BCRP/ABCG2) in liver. Mol. Pharmacol., 67, 1765–1771 (2005).
• 39) Piquette-Miller M, Pak A, Kim H, Anari R, Shahzamani A. Decreased expression and activity of P-glycoprotein in rat liver during acute inflammation. Pharm. Res., 15, 706–711 (1998).
• 40) Schuetz EG, Furuya KN, Schuetz JD. Interindividual variation in expression of P-glycoprotein in normal human liver and secondary hepatic neoplasms. J. Pharmacol. Exp. Ther., 275, 1011–1018 (1995).
• 41) Kanado Y, Tsurudome Y, Omata Y, Yasukochi S, Kusunose N, Akamine T, Matsunaga N, Koyanagi S, Ohdo S. Estradiol regulation of P-glycoproteni expression in mouse kidney and human tubular epithelial cells, implication for renal clearance of drugs. Biochem. Biophys. Res. Commun., 519, 613–619 (2019).
• 42) Maher JM, Slitt AL, Cherrington NJ, Cheng X, Klaassen CD. Tissue distribution and hepatic and renal ontogeny of the multidrug resistance-associated protein (MRP) family in mice. Drug Metab. Dispos., 33, 947–955 (2005).
• 43) Simon FR, Iwahashi M, Hu LJ, Qadri I, Arias IM, Ortiz D, Dahl R, Sutherland E. Hormonal regulation of hepatic multidrug resistance-associated protein 2 (Abcc2) primarily involves the pattern of growth hormone secretion. Am. J. Physiol. Gastrointest. Liver Physiol., 290, G595–G608 (2006).
• 44) Urakami Y, Nakamura N, Takahashi K, Okuda M, Saito H, Hashimoto Y, Inui K. Gender differences in expression of organic cation transporter OCT2 in rat kidney. FEBS Lett., 461, 339–342 (1999).
• 45) Ma Y, Qin H, Jin Y, Huang J, Han M, Wang X, Zhang G, Zhou Y, Rao Z, Wu X. Gender-related differences in the expression of organic cation transporter 2 and its role in urinary excretion of metformin in rats. Eur. J. Drug Metab. Pharmacokinet., 41, 559–565 (2016).
• 46) Breljak D, Brzica H, Sweet DH, Anzai N, Sabolic I. Sex-dependent expression of Oat3 (Slc22a1) and Oat1 (Slc22a6) proteins in murine kidneys. Am. J. Physiol. Renal Physiol., 304, F1114–F1126 (2013).
• 47) Ljubojević M, Herak-Kramberger CM, Hagos Y, Bahn A, Endou H, Burckhardt G, Sabolić I. Rat renal cortical OAT1 and OAT3 exhibit gender differences determined by both androgen stimulation and estrogen inhibition. Am. J. Physiol. Renal Physiol., 287, F124–F138 (2004).
• 48) Buist SC, Cherrington NJ, Klaassen CD. Endocrine regulation of rat organic anion transporters. Drug Metab. Dispos., 31, 559–564 (2003).
• 49) Ljubojevieć M, Balen D, Breljak D, Kušan M, Anzai N, Bahn A, Burckhardt G, Sabolić I. Renal expression of organic anion transporter OAT2 in rats and mice is regulated by sex hormones. Am. J. Renal Physiol., 292, F361–F372 (2007).
• 50) Meetam P, Srimaroeng C, Soodvilai S, Chatsudthipong C. Regulatory role of testosterone in organic cation transport: in vitro and in vivo studies. Biol. Pharm. Bull., 32, 982–987 (2009).
• 51) Urakami Y, Okuda M, Saito H, Inui K. Hormonal regulation of organic cation transporter OCT2 expression in rat kidney. FEBS Lett., 473, 173–176 (2000).
• 52) Asaka J, Terada T, Okuda M, Katsura T, Inui K. Androgen receptor is responsible for rat organic cation transporter 2 gene regulation but not for rOCT1 and rOCT3. Pharm. Res., 23, 697–704 (2006).
• 53) Arbona JR, Marple DN, Russell RW, Rahe CH, Mulvaney DR, Sartin JL. Secretory patterns and metabolic clearance rate of porcine growth hormone in swine selected for growth. J. Anim. Sci., 66, 3068–3072 (1988).