2023 年 46 巻 4 号 p. 524-532
This study investigated whether pretreatment with puerarin could alleviate myocardial ischemia/reperfusion (I/R) injury in a cardiomyocyte oxygen–glucose deprivation and reoxygenation (OGD/R) model and in a mouse I/R injury model. For in vitro experiments, H9C2 cells were divided into control, erastin, OGD/R, OGD/R + puerarin, and OGD/R + ferrostatin (Fer)-1 groups. Parameters related to ferroptosis included levels of malondialdehyde (MDA), 4-hydroxynonenal (4-HNE), ATP, reactive oxygen species (ROS), glutathione (GSH), prostaglandin endoperoxide synthase (Ptgs) 2 mRNA, glutathione peroxidase (GPX) 4 protein and iron. In H9C2 cells, puerarin or Fer-1 pretreatment reduced ferroptosis, as indicated by decreased ROS and increased GSH, ATP levels. In vivo, wild-type mice were randomly divided into sham, I/R + vehicle, I/R + puerarin, and IR + Fer-1 groups. The I/R model was established by 30 min of left anterior descending artery occlusion followed by 24 h of reperfusion. Pretreatment with puerarin or Fer-1 significantly reduced infarct size in I/R mice, and decreased the activities of Myeloperoxidase (MPO) and cardiac enzymes such as creatine kinase MB isoenzyme (CK-MB), aspartate aminotransferase (AST), and lactate dehydrogenase (LDH) compared to those in the vehicle-treated group. Puerarin also reduced the production of MDA and 4-HNE, reduced the mRNA expression of Ptgs2 mRNA, and increased GPX4 protein expression. These results showed that puerarin exerted protective effects against myocardial I/R injury by inhibiting ferroptosis and inflammation, and therefore may have therapeutic potential for treatment of acute myocardial infarction.
Coronary heart disease is the leading cause of death worldwide. Following acute myocardial infarction, thrombolytic therapy or primary percutaneous coronary intervention is the most effective strategy for reducing myocardial infarct size and improving clinical outcomes. However, the process of restoring blood flow to the ischemic myocardium can cause myocardial ischemia/reperfusion (I/R) injury1) resulting from cardiomyocyte apoptosis,2,3) necrosis,4) necroptosis,5) and autophagy.6) Currently, there is no effective treatment for myocardial reperfusion injury. Therefore, prevention of reperfusion injury is an important factor in preventing cardiac damage. Myocardial ischemia-reperfusion injury leads to myocardial cell death and cell hypertrophy, which promotes cardiac dysfunction and malignant arrhythmias, and can lead to death.
Ferroptosis is a recently identified form of regulated cell death that results from accumulation of iron-dependent lipid reactive oxygen species (ROS)7) caused by an imbalance between intracellular oxidative and antioxidant systems during reperfusion of the myocardium.8) Iron overload induces increased ROS production through the Fenton reaction, leading to increased membrane polyunsaturated fatty acid oxidation. Iron also participates in mitochondrial oxidative phosphorylation and production of ATP. Ferritin heavy chain 1 (FTH1) is the main component of ferritin, which plays an important role in iron metabolism by storing excess iron in the cytoplasm. Lipid peroxidation generates lipid alkoxy groups that decompose to active aldehydes such as 4-hydroxynonenal (4-HNE) and malondialdehyde (MDA). Glutathione peroxidase (GPX) 4 is an enzyme that reduces peroxides (e.g., L-OOH) to their corresponding alcohols (L-OH) through oxidation of reduced glutathione (GSH) to oxidized glutathione (GSSG).9) Glutathione is a cofactor and synthetic substrate of GPX4 that is affected by the cysteine/glutamate antiporter (XC−) system, and GSH depletion results in GPX4 inactivation and altered lipid homeostasis in cells. Accumulation of lipid ROS results in increased cell membrane permeability and cell death. Therefore, ferroptosis is characterized by iron-catalyzed formation of lipid radicals combined with GSH depletion or inactivation of GPX4.10,11) Prostaglandin endoperoxide synthase (PTGS)2, also known as cyclooxygenase 2, is a key enzyme in the synthesis of prostaglandins from arachidonic acid in the cell membrane, and is a marker of ferroptosis.12) Mitochondria are enriched in iron and are the main sources of cellular ATP and also the location of ferroptosis induction. Ferroptosis differs from other forms of nonapoptotic cell death in that it is characterized by mitochondrial shrinkage, increased mitochondrial membrane density, iron and lipid ROS accumulation, and a distinct gene expression profile.13) Ferroptosis can be inhibited by lipophilic antioxidants such as coenzyme Q10, vitamin E, liproxstatins,14) and ferrostatins such ferrostatin (Fer)-1.7)
Puerarin (8-C-β-D-glucopyranosyl-7,4-hydroxy-isoflavone), an isoflavone compound extracted from the root of Pueraria lobate, is used to treat a wide range of diseases in China, including cardiovascular and cerebrovascular diseases, diabetes and diabetic complications, osteonecrosis, Alzheimer’s disease, and endometriosis.15–19) Puerarin exerts protective effects against myocardial I/R injury by enhancing oxygen consumption, limiting infarct area, and improving diastolic function.20) These protective effects occur though inhibition of mitochondrial permeability transition pore formation and increased opening of calcium-activated potassium channels, resulting in activation of protein kinase C, and inhibition of autophagy and ROS production.18,21–23) Puerarin has been shown to protect against heart failure by inhibiting ferroptosis.24) Increased cardiomyocyte ferroptosis during reperfusion causes myocardial damage and impairs heart function.25,26) Therefore, strategies that target ferroptosis may alleviate myocardial I/R injury.
In this study we investigated whether puerarin could prevent myocardial I/R injury by inhibiting ferroptosis, and characterized the underlying mechanisms of these effects.
Cell Counting Kit (CCK)c-8 was purchased from Biosharp Biotechnology (Beijing, China). Malondialdehyde (S0131S), ATP (S0026), ECL (P0018S), DAB (P0202) assay kits and radioimmunoprecipitation assay buffer (RIPA, P0013B) were purchased from Beyotime Biotechnology (Shanghai, China). Glutathione assay kit (BC1170) was purchased from Solarbio® Life Sciences (Beijing, China). The iron assay kit (ab83366) was purchased from Abcam (Cambridge, MA, U.S.A.). BODIPY 581/591 C11 (D3861) and TRIzol reagent (15596018) were purchased from Invitrogen (Carlsbad, CA, U.S.A.). Eponate 12™ Kit (18012) was purchased from Ted Pella Inc. (Redding, CA, U.S.A.).
Dimethyl sulfoxide (DMSO; D2650), triphenyl tetrazolium chloride (TTC; T8877), Evan’s blue (E2129), and bovine serum albumin (BSA; A1933-25G) were purchased from Sigma-Aldrich (St. Louis, MO, U.S.A.). Dulbecco’s modified Eagle’s medium (DMEM; 11965092), phosphate-buffered saline (PBS; 10010031), and fetal bovine serum (FBS; 16140071) were purchased from Gibco (Grand Island, NY, U.S.A.). Puerarin (3681-99-0) was purchased from Chengdu Must Biotechnology (Chengdu, China). Fer-1 (S7243) was purchased from Selleck Chemicals (Houston, TX, U.S.A.). Erastin (571203-78-6) was purchased from MedChemExpress (Monmouth Junction, NJ, U.S.A.).
Primary antibodies against the following proteins were used in this study: Myeloperoxidase (MPO, ab188211), GPX4 (ab125066), and 4-HNE (ab46545) (Abcam); ferritin heavy chain (FTH)1 (4393S) (Cell Signaling Technology, Danvers, MA, U.S.A.); glyceraldehyde 3-phosphate dehydrogenase (GAPDH) (A19056) (ABclonal, Wuhan, China). Horseradish peroxides (HRP)-conjugated goat anti-rabbit (SA00001-2) secondary antibody was purchased from Proteintech (Wuhan, China).
AnimalsEight-week-old male C57BL/6 mice were obtained from GemPharmatech (Nanjing, China). The mice were fed a standard diet and housed in a standard environment. Animal experiments were conducted according to the “Guiding Principles in the Care and Use of Animals” (China) and were approved by Institutional Animal Care and Use Committee of Shanghai General Hospital of Shanghai Jiao Tong University School of Medicine (IACUC No. 2021AW029). Wild-type mice were randomly assigned to four groups: sham, I/R + vehicle, I/R + Fer-1, and I/R + puerarin.
Cell Culture and in Vitro TreatmentsH9C2 cells were cultured in DMEM containing 10% FBS and antibiotics (100 U/mL penicillin and 100 µg/mL streptomycin) in an incubator with 5% CO2 and 95% air. The cells were randomly divided into the following groups: control, erastin, oxygen–glucose deprivation and reoxygenation (OGD/R), OGD/R + puerarin, and OGD/R + Fer-1. Cells in the control group were cultured under normal conditions. Cells of erastin group were treated with erastin at the indicated concentration. The OGD/R group was cultured in glucose-free DMEM with low oxygen (1% O2, 94% N2, 5% CO2) for 3 h, then with normal DMEM under normoxic conditions (95% air, 5% CO2) for 3 h. Cells were pretreated with puerarin or Fer-1 for 2 h before OGD/R in the OGD/R + puerarin and OGD/R + Fer-1 groups, respectively.
Cell Viability AssayThe viability of H9C2 cells was assessed using the CCK-8 assay. Cells were treated with erastin, erastin + puerarin, or erastin + Fer-1 at different concentrations for 24 or 48 h before adding 10 µL of CCK-8 solution to each well. Then, optical density (OD) was measured at 450 nm using a microplate reader.
I/R Mouse Model and Evaluation of Infarct SizeThe mouse I/R model was induced as previously described.26) The mice in I/R + Fer-1 group were administered Fer-1 (1 mg/kg) by intraperitoneal injection 24 and 2 h before I/R induction. In I/R + Pue or I/R + Vehicle group, puerarin (100 mg/kg) or vehicle (sterile saline) were administered by intraperitoneal injection 24 and 2 h before I/R induction. Ferrostatin 1 and puerarin were dissolved in DMSO, then diluted in sterile saline.
At 24 h after I/R surgery, Evans blue and TTC staining were performed as previously description.26) The non-ischemic left ventricle myocardium was stained dark blue, while the ischemic left ventricle myocardium was stained brick red with pale areas, which were defined as the area at risk27) and infarct area (IF), respectively. The size of each area was calculated using Image J v6.0 software (National Institutes of Health, Bethesda, MD, U.S.A.).
Measurement of Serum Iron and Iron Saturation Levels and Tissue Ferrous LevelsSerum iron and iron saturation levels were measured using a biochemical analyzer (DxC 800, Beckman Coulter, Brea, CA, U.S.A.). Tissue ferrous levels were measured using a commercial assay kit according to the manufacturer’s instructions. The absorbance of samples at 593 nm was recorded.
Determination of GSH, ROS, ATP, and MDA LevelsMalondialdehyde levels in heart tissue were measured using an MDA assay kit. In addition, ATP and GSH levels in H9C2 cells were measured using commercial assay kits according to the manufacturers’ instructions. BODIPY 581/591 C11 was used to measure live-cell lipid ROS at a concentration of 50 µM. After 1 h, the cells were visualized with 488 nm excitation wavelength and bandpass filter (EX: 460–500 nm, DC: 505 nm, EM: 512–542 nm) of a fluorescence microscope (Leica DMi8, Leica Microsystems, Wetzlar, German).
Measurement of Serum Lactate Dehydrogenase (LDH), Aspartate Aminotransferase (AST), and Creatine Kinase MB Isoenzyme (CK-MB) LevelsThe levels of the myocardial injury markers LDH, AST, and CK-MB in the sera of mice were measured using a biochemical analyzer (DxC 800).
HistologyHeart tissues were embedded in paraffin, and serial 5-µm sections were prepared. The sections were stained with hematoxylin–eosin (H&E) for routine histologic examination under a light microscope (Leica LAS V4).
ImmunohistochemistrySerial sections were deparaffinized, rehydrated, treated for antigen retrieval, immersed in 3% hydrogen peroxide, and blocked with 5% BSA (w/v). Then, the sections were incubated with anti-MPO and anti-4-HNE antibodies overnight at 4 °C. The following day, the sections were incubated with HRP anti-rabbit secondary antibody for 1 h at room temperature. Then, the sections were visualized by DAB HRP color development kit using a microscope (Leica LAS V4).
Quantitative RT-PCRTotal RNA was extracted using TRIzol reagent and reverse transcribed to cDNA using a PrimeScript RT Master Mix Kit (TaKaRa Bio, Otsu, Japan). Quantitative PCR was performed using SYBR Green Fast qPCR mix (TaKaRa Bio) on an ABI 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.). The fold difference in gene expression was calculated using the 2−ΔΔCt method, and expression was normalized to the expression level of GAPDH. The primer sequences are listed in Table 1.
| Gene | Species | Forward primer (5′→3′) | Reverse primer (5′→3′) |
|---|---|---|---|
| GAPDH | Rat | CCGCATCTTCTTGTGCAGTG | GAGAAGGCAGCCCTGGTAAC |
| GAPDH | Mouse | ATCATCCCTGCATCCACT | ATCCACGACGGACACATT |
| Ptgs2 | Rat | AGGTCATCGGTGGAGAGGTGTATC | CGGCACCAGACCAAAGACTTCC |
| Ptgs2 | Mouse | GGTGCCTGGTCTGATGATGTATGC | GGATGCTCCTGCTTGAGTATGTCG |
| Anp | Mouse | AAGAACCTGCTAGACCACCTGGAG | TGCTTCCTCAGTCTGCTCACTCAG |
| Bnp | Mouse | GGAAGTCCTAGCCAGTCTCCAGAG | GCCTTGGTCCTTCAAGAGCTGTC |
Tissues or cells were lysed in RIPA. Equal amounts of protein were separated by 12.5% acrylamide gel electrophoresis and transferred to nitrocellulose membranes (P-N66485, Pall Corporation, Port Washington, NY, U.S.A.). After blocking, the membranes were incubated with primary antibodies against GAPDH, GPX4, and FTH1 overnight at 4 °C. On the next day the membranes were incubated with HRP-conjugated secondary antibody. Detection was performed by ECL kit with an Amersham Imager 600 (Cytiva, Marlborough, MA, U.S.A.). Gray-scale values were measured using ImageJ software (National Institutes of Health).
Transmission Electron Microscopy (TEM)Myocardium tissue (1 × 2 × 2 mm) was rapidly dissected from the left ventricle and immediately fixed in 2.5% glutaraldehyde solution for 6 h at 4 °C. Then the tissues were fixed with 1% osmic acid at 4 °C for 3 h. Tissue blocks were washed with PBS, dehydrated with gradient concentrations of acetone, treated with different ratios of acetone/embedding solution, and embedded with pure embedding solution under gradient temperature conditions. The embedding solution came from Eponate 12™ Kit (Eponate 12 epoxy resin, DDSA, NMA, BDMA). Samples were cut into 60 nm thick ultrathin sections using an ultrathin microtome and stained with uranyl acetate and lead citrate. Then, the samples were visualized using a Hitachi 7650 TEM.
Statistical AnalysisAll experiments were performed at least in triplicate. Data were analyzed and plotted using Prism software (GraphPad, La Jolla, CA, U.S.A.), and values are presented as the mean ± standard error of the mean (S.E.M.). Comparisons between groups were performed using one-way ANOVA. Differences with a p value <0.05 were considered significant.
H9C2 rat cardiomyocytes were treated with different concentrations of erastin to induce ferroptosis, and cell viability was evaluated using the CCK-8 assay. Erastin induced H9C2 cell death (Fig. 1A). IC50 of erastin was calculated as 13.3 µM by nonlin fitting analysis through Graphpad prism software. Based on the results of previous study,7) 10 µM was selected as the concentration of erastin in subsequent experiments. In Fig. 1B, cells were treated with 10 µM erastin and various concentrations of Fer-1 for 24h. It showed that Fer-1 mitigated the reduction of H9C2 cell viability induced by erastin and EC50 (=1.2 µM) of Fer-1 was calculated by nonlin fitting analysis through Graphpad prism software. Based on the results of previous study,28) 1 µM Fer-1 was selected for subsequent experiments. In Fig. 1C, cells were treated with 10 µM of erastin and various concentrations of puerarin for 24 or 48 h. Similarly, puerarin mitigated the reduction of H9C2 cell viability induced by erastin across a range of concentrations. And the chemical structure of puerarin was seen in Fig. 1D.
(A) H9C2 cell viability after treatment with Era (2, 4, 6, 8, 10, 100 µM) for 24h. (B) H9C2 cell viability after treatment with 10 µM erastin and various concentrations of Fer-1 (0.25, 0.5, 1, 2, 4, 8 µM) for 24h. (C) H9C2 cell viability after treatment with 10 µM erastin and various concentrations of Pue (10, 20, 40, 80, 160 µM) for 24h or 48 h. (D) The chemical structure of puerarin. (E, F) H9C2 cells were treated with different concentrations of puerarin alone, 10 µM Era, 10 µM Era with 1 µM Fer-1, 10 µM Era with 20, 80, or 160 µM Pue for 24h. The expressions of GPX4 were analyzed by Western blotting and normalized to GAPDH. Relative mRNA levels of Ptgs2 were analyzed by qRT-PCR and normalized to GAPDH. The control was set to 1 (n = 3). GPX4, glutathione peroxidase 4; era, erastin; fer-1, ferrostatin-1; pue, puerarin. * p < 0.05 and *** p < 0.001 vs. Control, # p < 0.05 vs. erastin, ## p < 0.01 vs. erastin.
To evaluate the concentration at which puerarin induced protective effects, the protein expression of GPX4 and relative mRNA levels of Ptgs2 were detected (Figs. 1E, F). Treatment with 10 µM erastin for 24 h decreased GPX4 expression and increased Ptgs2 mRNA levels relative to that in control H9C2 cells. These effects were mitigated by treatment with Fer-1 (1 µM) or puerarin (20 or 80 µM) (Figs. 1E, F) while treatment with puerarin alone affected neither the GPX4 protein expression or the Ptgs2 mRNA levels. We chose 80 µM puerarin for subsequent experiments because it showed the best protective effect.
Puerarin Alleviated Ferroptosis Induced by OGD/R in CardiomyocytesErastin is typically used to induce ferroptosis, and Fer-1 is a specific inhibitor of ferroptosis.7) Treatment of H9c2 cells with erastin or OGD/R treated H9C2 cells resulted in two-fold greater Ptgs2 mRNA levels (Fig. 2A), but lower levels of ATP and GSH (Figs. 2B, C), compared with those in untreated cells. Pretreatment with Fer-1 or puerarin reversed the expression changes induced by OGD/R (Figs. 2A–C). Treatment with erastin or OGD/R also induced increased lipid ROS production, as determined using BODIPY 581/591 C11 staining (Fig. 2D). Treatment with Fer-1 or puerarin decreased the green fluorescence in OGD/R treated cells (Fig. 2D). Western blot analysis showed that GPX4 expression was reduced in the OGD/R and erastin groups, while treatment with Fer-1 or puerarin increased GPX4 expression in OGD/R cells (Fig. 2E). These results demonstrated that OGD/R induced a phenotype similar to ferroptosis, and puerarin had an anti-ferroptotic effect similar to that of Fer-1 in an OGD/R model.
Cells were divided into five groups: Control, Erastin (10 µM), OGD/R, OGD/R + Pue (80 µM), and OGD/R + Fer-1(1 µM). Cells were treated with erastin for 24 h. Pue or Fer-1 were administered 2 h before OGD/R. (A) Relative messenger RNA expression of Ptgs2. (B, C) ATP and GSH levels in each group were measured using ATP and GSH assay kits, respectively. (D) Cells in different groups were stained using BODIPY 581/591 C11 and images were taken using a fluorescence microscope. (E) Representative Western blot images and quantification of the levels of GPX4. N = 3 per group. * p < 0.05, ** p < 0.01 and *** p < 0.001 vs. Control, # p < 0.05, ## p < 0.01, and ### p < 0.001 vs. OGD/R.
To assess the therapeutic potential of puerarin in mice with I/R injury, mice were pretreated with puerarin or Fer-1, then subjected to I/R. Mice subjected to I/R had significantly higher myocardial levels of ferrous iron than sham-operated mice (Fig. 3A). In contrast, serum iron concentration (Fig. 3B) and transferrin saturation (Fig. 3C) did not differ between I/R and sham-operated mice. Pretreatment with Fer-1 or puerarin inhibited the I/R-induced increase in myocardial ferrous iron content (Figs. 3A–C). In addition, I/R also increased the levels of MDA and Ptgs2 mRNA, and decreased GPX4 and FTH1 expression (Figs. 3D–F). Pretreatment with Fer-1 or puerarin prevented these I/R-induced changes (Figs. 3D–F). Immunohistochemical analysis showed that the levels of 4-HNE, a lipid peroxidation product, were increased in the I/R group, and did not increase in response to I/R in mice pretreated with puerarin or Fer-1 (Fig. 3G). As reduction or disappearance of mitochondrial cristae is a feature of ferroptosis,7) We examined the morphology of mitochondria of heart tissue samples using TEM. The mitochondria in the myocardial tissue of I/R mice showed changes consistent with ferroptosis, including smaller size and fewer cristae (Fig. 3H). Treatment with puerarin or Fer-1 mitigated I/R-induced mitochondrial damage (Fig. 3H). These results indicated that puerarin inhibited I/R-induced ferroptosis in mouse hearts.
(A) Levels of cardiac ferrous iron. (B, C) Levels of serum iron and iron transferrin saturation. (D) Levels of MDA. (E) Relative mRNA expression of Ptgs2. (F) Representative Western blot images and quantitative analysis of GPX4 and FTH1 protein levels. (G) Representative images of immunohistochemical staining and quantitative analysis of 4-hydroxynonenal (4-HNE). (H) Typical transmission electron microscopy images of mitochondria, (bar = 500 nm). n = 3 per group. *vs. Control, * p < 0.05, ** p < 0.01, *** p < 0.001, #vs. I/R + Vehicle, # p < 0.05, ## p < 0.01, ### p < 0.001. Pue, puerarin; Fer-1, ferrostatin-1; I/R, ischaemia/reperfusion; MDA, Malondialdehyde; Ptgs2, prostaglandin-endoperoxide synthase 2; GPX4, glutathione peroxidase 4; FTH1, ferritin heavy chain 1; 4-HNE, 4-hydroxynonenal.
Hematoxylin and eosin staining of heart tissue showed that the myocardial tissue was dense and well-organized with intact fibers in the sham-operated group (Fig. 4A). In contrast, the cells were disordered and some myocardial fibers were fractured in the I/R group. Pretreatment with Fer-1 or puerarin restored the organization of myocardial tissue. Given that the inflammatory response plays a critical role in I/R injury,29) we examined the expression of MPO in mouse hearts. Myeloperoxidase is an enzyme primarily detected in neutrophils. Therefore, MPO is an indicator of neutrophil infiltration and acute inflammation.30,31) Positive immunohistochemical staining for MPO after I/R surgery was weakened by pretreatment with Fer-1 or puerarin (Fig. 4A). Evans blue and TTC staining (Fig. 4B) showed that the area of myocardial infarction was smaller in mice pretreated with puerarin or Fer-1 than that in the I/R group, although the treatment groups had AARs of comparable sizes (Fig. 4C). The changes in serum myocardial enzymes were consistent with the histologic observations (Fig. 4D). Messenger RNA levels of ANP and BNP were higher in the vehicle + IR group than those in the sham group, and these increases were inhibited by administration of puerarin or Fer-1 (Fig. 4E). These data suggested that inhibition of ferroptosis in mice protected the heart against I/R injury.
(A) Representative images of H&E and MPO staining of the heart. (B) Representative images of TTC and Evans blue staining of the hearts. (C) The IF/AAR and AAR/LV percentages. (D) Serum levels of AST, CK-MB, and LDH (n = 6). (E) Relative mRNA levels of ANP and BNP. *vs. Sham, * p < 0.05, ** p < 0.01, *** p < 0.001; #vs. I/R + Vehicle, # p < 0.05, ## p < 0.01, ### p < 0.001. Pue, puerarin; Fer-1, ferrostatin-1; I/R, ischemia/reperfusion; H&E, Hematoxylin and Eosin; TTC, Triphenyl Tetrazolium Chloride; IF, infarct size; AAR, area at risk; LV, left ventricle; AST, aspartate aminotransferase; CK-MB, creatine kinase MB isoenzymes; LDH, lactate dehydrogenase; ANP, atrial natriuretic peptide; BNP, brain natriuretic peptide.
In the present study, we observed that iron-dependent lipid peroxides were significantly increased during myocardial I/R injury, and this increase was inhibited by puerarin treatment, which also reduced myocardial infarct size. These results showed that puerarin exerted protective effects against myocardial I/R injury by inhibiting ferroptosis, and therefore may have therapeutic potential for treatment of acute myocardial infarction.
Ferroptosis is a recently identified iron-dependent cell death that is morphologically, biochemically, and genetically distinct from apoptosis and necrosis, and can be prevented by iron chelation treatment.26) Previous studies have detected iron deposition in peri-infarct and non-infarct zones in mice with myocardial infarction. In addition, I/R injury was shown to be associated with disrupted iron metabolism. Clinical data have shown that iron was an important independent risk factor for left ventricular remodelling after reperfusion.32–34) These findings indicated that iron overload may play an important role in I/R injury. Subsequent studies showed that levels of FTH1, an iron regulator, were decreased in cardiac tissues that underwent I/R,35) and inhibition of glutaminolysis attenuated myocardial I/R injury by blocking ferroptosis.36) The current study found that I/R injury triggered accumulation of iron in cardiomyocytes, which in turn damaged lipid membranes by inducing production of lipid peroxides. Moreover, treatment with Fer-1, a specific inhibitor of ferroptosis, significantly reduced myocardial infarct size and improved cardiac function, which indicated that ferroptosis occurred in the myocardium during I/R. Therefore, targeting ferroptosis may be a potential strategy to prevent I/R injury.
Although there is no effective therapy for I/R injury clinically, several pre-clinical studies have shown that puerarin prevented I/R injury through reduced infarct size, improved coronary blood flow, improved myocardial oxygen consumption, and reduced inflammation.37–40) Our study showed that puerarin protected against I/R, as evidenced by reduced levels of AST, LDH, and CK-MB, and reduced ANP and BNP mRNA expression and preventing histological damage in I/R models. These observations confirmed that pretreatment with puerarin mitigated myocardial injury and preserved cardiac function in an I/R model. However, the mechanisms of the protective effects of puerarin require further study. Recently, puerarin was shown to inhibit ferroptosis in lung injury41) and heart failure.24) Therefore, we evaluated the effects of puerarin on iron homeostasis and lipid peroxidation, the two key features of ferroptosis, in myocardial I/R injury models. We showed that puerarin alleviated iron overload, reduced the production of ROS, MDA, and 4-HNE, promoted synthesis of GSH after I/R injury in vivo and in vitro. These results showed that puerarin exerted anti-ferroptotic effects, which may be the mechanism by which puerarin protected against I/R injury.
Whereas, the mechanism of anti-ferroptotic effects of puerarin is still unknown. Some studies discovered that GPX4 and FTH1 are key upstream regulators of ferroptosis. Quantitative proteomic analysis showed that downregulation of GPX4 in MI contributed to ferroptosis in cardiomyocytes.42) A previous study showed that mitochondria-specific overexpression of GPX4 in mitochondria alleviated cardiac dysfunction following I/R.43) Ferritin, an important mediator of iron homeostasis, is important in ferroptosis. Fang et al.44) found that loss of cardiac ferritin H facilitated cardiomyopathy via Slc7a11-mediated ferroptosis, and deletion of ferritin H in neurons counteracted the protective effect of melatonin against ferroptosis.45) In addition, puerarin alleviated ferroptosis and increased ferritin production.24) Our study showed that puerarin treatment preserved the protein expression of FTH1 and GPX4 and thus reduced production of peroxide and ferrous levels in the myocardium and in H9c2 cells. These changes may partly be involved in the mechanism of anti-ferroptotic effects of puerarin in an I/R model.
As inflammation participates in the pathogenesis of myocardial I/R injury and inhibition of inflammation can inhibit up to 50% of myocardial infarction area.1) We further measured the expression of MPO in different groups and found that puerarin and Fer-1 resulted in reduced MPO activity of I/R group. It can be indicated that puerarin could prevent myocardial from I/R injury by controlling inflammatory response. It also revealed that inhibition of ferroptosis suppressed inflammation and puerarin could inhibit inflammation partly through preventing ferroptosis. A recent report also found that Fer-1 effectively alleviates neutrophils infiltration after myocardial I/R through TLR4/Trif signaling pathway, thereby alleviating myocardial damage.46) Nevertheless, the relationship between ferroptosis, inflammation and I/R injury needs to be further investigated.
In conclusion, in vitro and in vivo results showed that ferroptosis occurred during myocardial I/R injury. Fer-1 and Puerarin pretreatment improved ferroptosis and inflammation indices in myocardial I/R models. These results indicated that puerarin induced anti-inflammation and anti-ferroptotic effects that protected against myocardial I/R injury. And inflammation could be suppressed by inhibiting ferroptosis. Our study highlighted the therapeutic potential of puerarin for treatment of acute myocardial infarction. The clinical efficacy and molecular mechanisms of puerarin as a therapeutic agent for I/R injury require further investigation.
This work was supported by the National Natural Science Foundation of China (NSFC, No. 81803759 to Bei Liu, No. 81970273 to Shaowen Liu and No. 82000312 to Juan Xu).
The authors declare no conflict of interest.
