Construction of a Temperature-Sensitive Shuttle Vector between Lactic Acid Bacteria and Escherichia coli and Its Application to a Tn10-Based Random Mutagenesis Tool in Lactic Acid Bacteria

Abstract

In the present study, we have obtained a temperature-sensitive replication mutant in the Escherichia (E.) coli–lactic acid bacterium (LAB) shuttle vector pLES003-b carrying erythromycin-resistance gene by error-prone PCR technique. Among 858 clones obtained in the construction of the random mutation libraries of pLES003-b in the ori and repA regions, three clones could grow normally at 28 °C but not at 42 °C. One of the clones was designated as pLES003-b TS1. The sequencing analysis of pLES003-b TS1 revealed that the plasmid has four substitution mutations (376G > A, 435A > T, 914C > A, and 1996T > A) and one insertional mutation (1806_1807insA). Among those mutations, substitution mutation 914C > A, which leads to a CGC-to-AGC codon change at position 44 of the RepA protein (arginine-to-serine substitution mutation: R44S in RepA), was predicted to be a cause of temperature sensitivity. Therefore, the C-to-A substitution was introduced into the repA gene in pLES003-b using a site-directed mutagenesis method, and the resultant plasmid was electroporated into a Lactobacillus (L.) plantarum cell. The resultant transformant cannot grow at 42 °C in the presence of erythromycin, which is used as a selective marker, indicating that the R44S point mutation in the RepA protein may be crucial for temperature sensitivity. Furthermore, we have developed a new plasmid as an efficient genetic engineering tool for random insertional mutagenesis in LABs using a combination of transposon Tn10 and the temperature-sensitive replication system in pLES003-b. The resultant plasmid vector, which was designated pLES-Tn10-TS1, would be useful for genetic analysis of the functional molecule in lactic acid bacterial strains.

INTRODUCTION

Techniques for gene disruption and random mutagenesis in bacteria are necessary to analyze the functions of a target gene and are carried out using homologous recombination and transposon-based insertional mutation, respectively.^1,2) Before gene disruption and mutagenesis occur, a linear or circular DNA fragment, which includes plasmid DNA, is introduced into target bacterial cells via transformation, transduction, and conjugation methods. The introduced fragment contains an antibiotic-resistance gene that acts as a selection marker after its integration into the chromosomal DNA. When the introduced fragment is not capable of self-replication, the unintegrated fragment is not carried over to the next generation, and thus mutated clones will be selected simply by using an antibiotic marker. However, under this system, the success probability of the mutation is quite low because the expected frequency depends on the efficiencies of both DNA introduction and DNA integration simultaneously. On the other hand, a self-replicable plasmid DNA is carried over once it is introduced into the host cell. In this case, although only the rate of the subsequent reaction of integration into the chromosomal DNA is a rate-limiting factor, an additional plasmid-curing step arises to remove the recombinant plasmids that have fulfilled their purpose. This step is relatively time-consuming and generally achieved through DNA gyrase inhibitor treatment or repetitive passaging without antibiotics, followed by checking the resistance against antibiotics used as the selective marker.^3–6) In addition, the temperature-sensitive plasmid, which is designed to be replicable at a low to standard temperature, but not at a high temperature, is applied to accomplish the plasmid curing.⁷⁾ When temperature-sensitive plasmids are used for the target bacterial host, this approach is expected to be useful for genetic engineering.

We have worked on the isolation and characterization of the functional molecule in plant-derived lactic acid bacteria (LABs). To study the mechanisms of those desirable effects genetically, we have constructed a shuttle vector, named pLES003, that is replicable in both Escherichia coli and several LAB hosts, such as lactobacilli, enterococci, and pediococci, and carries an erythromycin resistance gene (ery) as a selective marker in those hosts.^8–11) This shuttle vector contains a theta (θ)-type replication system, which is preferable for use in a plasmid development because theta-type plasmids are more stably harbored than those constructed based on another type of replication system, the rolling circle replicating mechanism.¹²⁾ In a previous study, the shuttle vector pLES003 and its derivative pLES003-b,¹³⁾ the replication origin region of which is reversed from that of pLES003, have been used to analyze the functional gene and metabolic engineering.^10,11,13)

For a new application of our shuttle vector pLES003-b, the aim of the present study is to develop a temperature-sensitive mutant of this vector through the error-prone PCR technique. Furthermore, we have constructed a plasmid vector for a genetic engineering tool used in random mutagenesis on LABs using the thermo-sensitive mutation and transposon Tn10.

MATERIALS AND METHODS

Bacterial Strains, Plasmids, and Culture Conditions

The bacterial strains and plasmids used in the present study are listed in Table 1. As LABs strains, Lactobacillus plantarum SN35N-Δp3, which is the plasmid-cured (non-exopolysaccharide-producing) mutant of L. plantarum SN35N prepared in the previous study,¹⁴⁾ and silage-derived L. plantarum NBRC 3070¹⁵⁾ were used in the present study. Those strains and their transformants were cultivated anaerobically in de Man, Rogosa, and Sharpe (MRS) broth (Merck KGaA, Darmstadt, Germany) at 28  or 42 °C. Escherichia coli strains were grown in LB broth (Sigma-Aldrich, St. Louis, MO, U.S.A.) at 37 °C. When necessary, the media were supplemented with ampicillin (100 µg/mL), kanamycin (50 µg/mL), tetracycline (12.5 µg/mL), chloramphenicol (34 µg/mL), erythromycin (300 µg/mL for E. coli and 7.5 µg/mL for LAB strains), 1.5% (w/v) agar, and 1 mM isopropyl β-D-thiogalactopyranoside (IPTG).

Table 1. LAB Strains and Plasmids Used in This Study

Strain or plasmid	Description	Reference or source
L. plantarum strains
SN35N-Δp3	Plasmid-cured mutant of L. plantarum SN35N	14
SN35N-Δp3 [pLES003-b TS-1]	SN35N-Δp3 harboring pLES003-b TS-1	This study
SN35N-Δp3 [pLES003-b (RepA R44S)]	SN35N-Δp3 transformed with pLES003-b (RepA R44S)	This study
NBRC 3070		Institute of Physical and Chemical Research, Japan
NBRC 3070 [pLES003-b]	NBRC 3070 transformed with pLES003-b	This study
NBRC 3070 [pLES003-b (RepA R44S)]	NBRC 3070 transformed with pLES003-b (RepA R44S)	This study
NBRC 3070 [pLES-Tn10-TS1]	NBRC 3070 transformed with pLES-Tn10-TS1	This study
Plasmids
pGEM-T Easy	E. coli TA-cloning vector	Promega
pLES003-b	E. coli–LAB shuttle vector	13
pLES003-b TS-1	Temperature-sensitive replication mutant of pLES003-b obtained by error-prone PCR	This study
pLES003-b (RepA R44S)	Temperature-sensitive replication mutant of pLES003-b generated by single-point mutation in repA	This study
Pre-pLES-Tn10	Tn10-based random mutation plasmid without replication system in LABs	This study
pLES-Tn10	Tn10-based random mutation plasmid	This study
pLES-Tn10-TS1	Tn10-based random mutation plasmid with temperature-sensitive replication mutation	This study

Chromosomal DNA of E. coli Origami B (DE3) was used as a template for PCR amplification of the transposase (Tase)-encoding gene. Escherichia coli DH5α and plasmids pLES003-b and pGEM-T Easy (Promega, Madison, WI, U.S.A.) were used for DNA cloning and plasmid construction. Escherichia coli HST04 (dam⁻ and dcm⁻) was used as a transient host to prepare the Dam and/or Dcm methylation-free plasmids for transformation to LAB cells. Escherichia coli HST08 was used as a host for the site-directed mutagenesis.

DNA Manipulations

Isolation of chromosomal DNA and plasmids from E. coli cells was done using the DNAzol Reagent (Invitrogen, Waltham, MA, U.S.A.) and Wizard Plus Minipreps DNA Purification System (Promega), respectively, according to the manufacturer’s instructions. Chromosomal DNA and plasmids from Lactobacillus strains were isolated according to the method described previously.⁸⁾ A DNA fragment separated by agarose gel electrophoresis was extracted using the QIAquick Gel Extraction Kit (Qiagen, Venlo, Netherlands) according to the manufacturer’s instructions.

Transformation of E. coli and LAB Cells

Transformation of E. coli with a plasmid was carried out using chemically competent cells as described in the literature.¹⁶⁾ An electroporation method was applied to a transformation of LAB cells and was performed basically according to a method described previously.¹⁷⁾ Briefly, LAB strains were grown in MRS broth supplemented with 2% (w/v) glycine at 28 °C until OD_600 nm reached around 0.6. The cells were harvested by centrifugation from the culture broth and washed twice with 10 mL of 1 mM MgCl₂ and once with same volume of 30% (w/v) polyethylene glycol (PEG) 1500. The cells were resuspended into 100 µL of 30% (w/v) PEG 1500, then 50 µL of the suspension was used for electroporation. The prepared cell suspension mixed with 1 µg of plasmid DNA was placed into a 0.1 cm gap electroporation cuvette from a Gene Pulser Xcell (Bio-Rad, Hercules, CA, U.S.A.) apparatus and held on ice for 5 min. The pulsing was conducted under the following conditions: field strength, 7.5 kV/cm; capacitance, 25 µF; and resistance, 400 Ω. Immediately after pulsing, the cell suspension was gently mixed with fresh MRS broth containing 0.5 M sucrose and 0.1 M MgCl₂ and then incubated at 28 °C for 3 h. The cells were plated out onto an MRS agar containing erythromycin and incubated anaerobically at 28 °C for 48 h.

Screening of a Temperature-Sensitive Plasmid Generated by Error-Prone PCR

Random mutation libraries of a replication-related region containing ori and repA from pLES003-b were constructed using the GeneMorph II EZClone Domain Mutagenesis Kit (Agilent Technologies, Santa Clara, CA, U.S.A.) according to a method described previously.¹⁸⁾ The error-prone PCR was carried out with primer set F1/R1 (Table 2), using pLES003-b as a template under the following conditions: initial denaturing at 95 °C for 2 min, followed by 30 cycles of 95 °C, 30 s; 55 °C, 30 s; 72 °C, 2.5 min; and final extension at 72 °C for 10 min. Amplified fragments were gel purified and used as megaprimers for the synthesis of pLES003-b mutants by the EZClone reaction. After removing the template plasmid (pLES003-b) via digestion with DpnI, the mutant libraries of pLES003-b were transformed to E. coli HST04 and amplified. Amplified libraries were isolated from the E. coli cells and introduced into L. plantarum SN35N-Δp3. Finally, 858 clones were obtained via 28 °C cultivation, and then they were transferred to an MRS agar and incubated at 42 °C for the screening of temperature-sensitive clones that harbor a temperature-sensitive plasmid.

Table 2. Primers Used in This Study

Name	Sequence (5′→3′)	Note
F1	CGTCTGTCGCTACATAATTATACGAACATATGTTCG	For error-prone PCR
R1	AGTCTGCCTATTCCTGCTTGAAAAGAGGG	For error-prone PCR
F2	GTAAGCTTTAGCTTTGACCAGCTGAAAGACC	For introducing R44S mutation
R2	AGTCTGGTCGCCCTTATCCCGCATA	For introducing R44S mutation
F3	CTTGCATGCCTGCAGATAGGAGGAGGAGGAATGTGCGAACTCGATATTTT	For plasmid construction
R3	GGTACCCGGGGATCCTCATAATTTCCCCAAAGCGT	For plasmid construction
F4	GATCATATGACAAGATGTGTATCCACCTTAACTTAATGATTTTTACCAAAATCATTAGGGGATTCATCAGCGGTGTGAAATACCGCACAG	For plasmid construction
R4	TATAGGGCCCGGAAAGCGGGCAGTGAGCGC	For plasmid construction
F5	CTGATGAATCCCCTAATGATTTTGGTAAAAATCATTAAGTTAAGGTGGATACACATCTTGTCATATGATCTAGAAGCAAACTTAAGAGTG	For plasmid construction
R5	TCTTGTCATATGATCATAGACGGTTTTTCGCCCTT	For plasmid construction
F6	AGATCTAGTCGGGAAACCTGTCGTGC	For plasmid construction
R6	ATTCATCAGGTCGACGACGTCAGGTGGCACTTTTC	For plasmid construction
F7	CGTCTATGCGGCCGCGATCATATGACAAGATGTGT	For plasmid construction
R7	TTCCCGACTAGATCTGGAAAGCGGGCAGTGAGCGC	For plasmid construction
F8	GTCGACCTGATGAATCCCCTAATGAT	For plasmid construction
R8	GCGGCCGCATAGACGGTTTTTCGCCCTT	For plasmid construction
F9	AAAAGTCGACCGTCTGTCGCTACATAATTATAC	For plasmid construction
R9	ATTCATCAGGTCGACCATATGGTGCACTCTCAGTA	For plasmid construction
F10	CATATGTAGAAGCAAACTTAAGAGTGTGTT	For Southern hybridization
R10	CATATGATAGACGGTTTTTCGCCCTTTGAC	For Southern hybridization

After sequence confirmation, a point mutation was introduced into the parental plasmid pLES003-b using KOD Plus Mutagenesis Kit (Toyobo, Osaka, Japan) with primer set F2/R2 according to the manufacturer’s instructions.

DNA Sequencing and Analysis

Nucleotide sequencing was conducted with ABI PRIZM 310 or the 3100 Genetic Analyzer (Applied Biosystems, Waltham, MA, U.S.A.) using the Big Dye Terminator v1.1 Cycle Sequencing Kit according to the manufacturer’s instructions. Genetic analysis was performed using ATGC and GENETYX software (Genetyx Corporation, Tokyo, Japan).

Construction of the Tn10-Based Random Mutation Plasmid pLES-Tn10-TS1

The construction scheme of the plasmid for random mutagenesis on LABs using transposon Tn10 is shown in Fig. 1. Because one of two IS10 elements, IS10-Right, has been reported to be structurally and functionally intact,^19,20) the Tase gene located on the IS10-Right of Tn10 was amplified with primer set F3/R3 using chromosomal DNA of E. coli Origami B (DE3) as a template. The amplified fragment was digested with BamHI and PstI and inserted into the same sites of pLES003-b. The Tase gene with a lactose promoter (P_lac) was amplified from the resultant plasmid with primer set F4/R4, which was designed to introduce an outside end (OE) of the 70 bp IS10 end sequence just after the Tase gene, and inserted into a pGEM-T Easy vector by TA cloning according to the manufacturer’s instructions. The ery gene was amplified to contain the inside end (IE) of the IS10 ends just before the ery gene with primer set F5/R5 and was also TA cloned into the pGEM-T Easy vector.

Fig. 1. Construction of the Temperature-Sensitive Tn10-Based Random Mutation Plasmid pLES-Tn10-TS1

To construct a new plasmid, pre-pLES-Tn10, the following three component fragments (Nos. 1–3) were individually amplified and assembled via an In-Fusion reaction using an In-Fusion HD Cloning Kit (TaKaRa Bio, Shiga, Japan). Fragment 1, containing the ColE1 origin and an ampicillin resistant gene (amp), was amplified from pLES003-b with primer set F6/R6. The Tase–OE- and IE–ery-containing fragments (fragments 2 and 3) were also amplified from each template described above with primer sets F7/R7 and F8/R8, respectively. After all the amplified samples were purified from agarose gel, those three fragments were assembled via an In-Fusion reaction to generate pre-pLES-Tn10.

To introduce a replication system into pre-pLES-Tn10, the region containing the replication origin and repA gene of pLES003-b were PCR amplified with primer set F9/R9, which was designed to add the restriction site SalI to each end. The amplified fragment was digested with SalI and purified from agarose gel after electrophoresis, then the fragment was inserted into the SalI site of pre-pLES-Tn10 to yield pLES-Tn10. Finally, a temperature-sensitive point mutation was introduced into the repA gene of the resultant plasmid using a KOD Plus Mutagenesis Kit (Toyobo) with primer set F2/R2 according to the manufacturer’s instructions, giving a novel plasmid, pLES-Tn10-TS1 (DDBJ Accession No.: LC761206).

Southern Hybridization

The chromosomal DNA isolated from each LAB clone was digested with XbaI and HindIII and was fractionated by 0.8% (w/v) agarose gel electrophoresis. The DNA fragments were transferred to a Hybond-N+ hybridization membrane (Merck KGaA) according to the standard protocol.¹⁶⁾ Southern hybridization analysis was conducted using a Gene Images AlkPhos Direct Labelling and Detection System Kit (GE Healthcare, Chicago, IL, U.S.A.) using an ery gene as a PCR-amplified probe with primer set F10/R10 from pLES003-b as a template. Probe labeling, hybridization, and detection were performed according to the manufacturer’s instructions.

RESULTS

Construction of the Temperature-Sensitive Replication Mutant of pLES003-b

After a random mutation library of pLES003-b in the ori and repA regions using the error-prone PCR method was constructed, 858 clones were obtained for L. plantarum SN35N-Δp3. Among those, three clones can grow at 28 °C but not at 42 °C in the presence of the selective marker, erythromycin. One of those plasmids, designated as pLES003-b TS1, was selected and used for further analyses.

Mutations Contributed to Temperature Sensitivity on pLES003-b

The newly obtained mutant plasmid pLES003-b TS1 was extracted from the clone, and the purified pLES003-b TS1 was reintroduced into the L. plantarum SN35N-Δp3 cell. The resultant transformants were also able to make a colony at 28 °C but not at 42 °C in the presence of erythromycin (Fig. 2), indicating that the temperature sensitivity is not due to host strain but to characteristics of the plasmid itself.

Fig. 2. Growth Ability of L. plantarum SN35N-Δp3 Carrying Temperature-Sensitive pLES003-b TS1 in the Presence of Erythromycin at 28 and 42 °C

The transformant was pre-cultured in MRS broth, and the aliquot of the cultured broth was plated onto an MRS agar with 7.5 µg/mL erythromycin. Each plate was incubated at 28 or 42 °C for 48 h.

To elucidate the mutations positively contributed to temperature sensitivity on pLES003-b TS1, the nucleotide sequence of its ori–repA region was determined and compared to that of parental plasmid pLES003-b (Fig. 3). The sequencing analysis revealed that there are four substitution mutations (376G > A, 435A > T, 914C > A, and 1996T > A) and one insertional mutation (1806_1807insA).

Fig. 3. Overview of Mutations in the ori–repA Region of the pLES003-b TS1 Obtained in This Study

Four substitution mutations and one insertional mutation are indicated in the figure, with position numbers. Among those, the substitution mutation 914C > A causes a CGC-to-AGC change at codon 44 in RepA, resulting in an arginine-to-serine substitution (R44S).

Determination of Critical Mutation for Temperature Sensitivity

Among the above-mentioned mutations, the substitution mutation 914C > A (R44S in the RepA protein) is only detected on the ori–repA sequence; thus the mutation may be predicted to be a cause of temperature sensitivity. Using a site-directed mutagenesis method, a C-to-A substitution was introduced into the repA gene (CGC-to-AGC change at codon 44), and then the resultant plasmid named pLES003-b (RepA R44S) was electroporated into the L. plantarum SN35N-Δp3 cell. The resultant transformant cannot grow at 42 °C in the presence of erythromycin (Fig. 4), indicating that the R44S point mutation caused in the RepA protein may be crucial for temperature sensitivity in pLES003-b.

Fig. 4. Growth Ability of L. plantarum SN35N-Δp3 Carrying the Constructed Temperature-Sensitive Plasmid pLES003-b (RepA R44S) in the Presence of Erythromycin at 28 and 42 °C

The transformant was pre-cultured in MRS broth, and the aliquot of the cultured broth was plated onto an MRS agar with 7.5 µg/mL erythromycin. Each plate was incubated at 28 or 42 °C for 48 h.

Application of Transposon Tn10 to Random Mutation in the LAB Strain

We have attempted to develop a new plasmid as a useful genetic tool with the application of a temperature-sensitive replicon and transposase-based random mutation. At first, pre-pLES-Tn10 was constructed as a plasmid for random mutation without a replication origin and replication protein-encoding gene for LAB. When the constructed non-replicable plasmid was electroporated into L. plantarum NBRC 3070, only a few colonies were obtained. The Tn10-mediated gene transfer efficiency was estimated at only approximately 0.063% by calculating from the numbers of generated colonies after electroporation with pre-pLES-Tn10 and that with pLES003-b. Incidentally, random insertion of the ery gene between the IE and OE of the IS10 ends was confirmed by Southern hybridization (Fig. 5). The analysis was conducted using chromosomal DNA extracted from five colonies selected from L. plantarum NBRC 3070 mutants, revealing the presence of an erythromycin gene, which was used as a probe, in the chromosome as a result of random transposition.

Fig. 5. Southern Blot Analysis of L. plantarum NBRC 3070 Genomes Transformed by pre-pLES-Tn10

Each genome was digested with XbaI and HindIII and then fractionated by 0.8% (w/v) agarose gel electrophoresis. Lanes 1–5, genomes extracted from five randomly selected colonies; P, probe DNA.

Introduction of a Temperature-Sensitive Replication System to Construct pLES-Tn10-TS1

pLES003-b (RepA R44S) was electroporated into the NBRC 3070 strain, and its growth profile was compared to that of the transformant with pLES003-b at 28  and 42 °C in the presence of erythromycin (Fig. 6). The result showed that the transformant with pLES003-b (RepA R44S) can grow at 28 °C but not at 42 °C, whereas that harboring the parental plasmid was able to grow regardless of the temperature, indicating that the RepA R44S temperature-sensitive mutation is also functional in L. plantarum NBRC 3070.

Fig. 6. The Viability of Transformants of L. plantarum NBRC 3070 with pLES003-b and pLES003-b (RepA R44S)

Each transformant was cultured in MRS broth supplemented with 1 mM IPTG and 0–30 µg/mL erythromycin.

To obtain a temperature-sensitive plasmid, named pLES-Tn10-TS1, the same point mutation was introduced into pre-pLES-Tn10. Because the Tase gene in the resultant plasmid is under the control of the P_lac, IPTG was added to the culture media during cultivation of the LAB transformant carrying pLES-Tn10-TS1 to induce expression of the Tase gene. After cultivating L. plantarum NBRC 3070 [pLES-Tn10-TS1] in MRS media containing erythromycin and IPTG at 28 °C for 48 h, an aliquot of the culture broth was plated onto a fresh MRS agar with or without erythromycin and further cultured at 28 and 42 °C for 48 h to estimate the number of erythromycin-resistant LAB cells (Table 3). When compared with the result obtained without erythromycin, the colony-forming unit (CFU) of the cultured broth decreased approximately tenfold in the presence of erythromycin at 42 °C. The result indicates that the transposition of the erythromycin resistance cassette occurred in only 10% of the transformants under the test condition and that the expression of P_lac-controlled genes is not only induced by IPTG but also repressed by carbon catabolic repression.²¹⁾ Therefore, the Lac-MRS medium, in which glucose was replaced with lactose, was prepared and applied to the same experiment, resulting that no difference in the CFU numbers with or without erythromycin selection at 42 °C was observed. The result indicated that the Tase induction and subsequent Tn10-based transposition successfully occurred using the Lac-MRS medium.

Table 3. Difference in CFU Values of the Cultured Broth between NBRC 3070 Strains Carrying pLES003-b and pLES-Tn10-TS1

Medium	Temperature (°C)	CFU/mL (×109/mL)
		pLES003-b		pLES-Tn10-TS1
		Erm +	Erm −	Erm +	Erm −
MRS	28	6.1	6.5	6.5	7.2
	42	1.7	6.0	0.47	6.8
Lac-MRS	28	2.1	2.6	6.6	6.6
	42	1.6	2.7	7.2	7.5

DISCUSSION

Before LABs were widely recognized as probiotics, which are well known as beneficial microorganisms for human health,^22–24) a great variety of LAB strains had been commercially provided not only as dairy products but also as bacterial drugs.^25–27) The purpose of taking probiotics is mainly to increase healthy intestinal bacteria by modifying the gut microbiota, resulting in health-promoting effects.^28,29) Although the mechanisms of those effects in many species have been gradually or partially clarified, such as the production of bacteriocins²⁴⁾ and short-chain fatty acids,³⁰⁾ there could be still many unknown parts. To make those mechanisms clear, classical genetic approaches, such as gene cloning and mutant preparation and characterization, are still required even in the present day, at which a huge amount of genomic, proteomic, metabolic, and clinical data have been registered in the public database. In addition to probiotic effects, LABs also produce exopolysaccharides, functional peptides, antioxidants, and other bioactive compounds^31–34); thus, not only their mechanisms of action but also their biosynthetic processes have been studied using the above techniques. LABs are recognized as common and essential bacteria for preparing fermented foods; however, unlike the cases of E. coli and yeast, there are not enough commercially available tools for a genetic approach. Due to the variety of potential applications of genetically modified LAB strains to food, health, and medicine, such strains have been expected to be placed on the market; however, due to the risks associated with possible gene transfer and adverse effects, no modified LAB strains have yet been commercialized.³⁵⁾ This may be one reason for the gap between market demand for lactic acid bacteria and the distribution of their genetic modification tools.

As one candidate technique for genetic modification, the random insertional mutation using a transposon has been studied and developed, starting with the success of in vitro transformation in E. coli.^36–38) The first report of a transposon found from dairy-related LAB is a 1.3 kb transposable element designated as ISL1.³⁹⁾ The application of a transposon for random insertion into the chromosomal DNA of LAB species Lactococcus lactis and Lactobacillus curvatus was achieved using a filter mating method using the conjugative transposon Tn919 found in Streptococcus sanguis.^40–42) As commercial application of transposon-based insertional mutation, a Tn5-based EZ::TN Transposase system has been developed.⁴³⁾ In this system, the transposome is prepared as a complex of a desired gene fragment amplified with a specific 19 bp transposase recognition sequence and a Tn5 transposase enzyme bound at each end of the fragment; then the constructed transposome is electroporated into a target cell, resulting Tn5-mediated insertional mutation.⁴⁴⁾ The system is applicable to both Gram-negative and Gram-positive bacteria, and thus is one of a few commercially available tools for LABs. Different from this system, the Tn10-based plasmid constructed in the present study contains Tase and an antibiotic-resistance cassette between two insertional sequences, providing the following advantage: once a target cell is transformed by the established plasmid, the insertional mutant libraries of the host strain are automatically provided by simple repeated cultivation of the initial transformant any number of times, and thus a higher efficiency of transformation is not required.

The application of a transposon-containing plasmid as a mutation tool had been achieved by using Tn917 derivatives such as pTV32 and pLTV1 plasmids.⁴⁵⁾ Recently, horn fly (Haematobia irritans)–derived Himar1 transposable elements were used to construct the random transposition vector pPH-M1, in which expression of the Himar1 transposase is under the control of a nisin-induced promoter system, for genetic analysis on Lactobacillus reuteri.⁴⁶⁾ Different from the reported plasmids ranging from approximately 10 to 20 kb, although pLES-Tn10-TS1 have been constructed using transposase, the constructed plasmid has a molecular size of 7.5 kb. Generally, smaller plasmids have advantages in their stability, copy numbers, and host growth.^47,48)

The present study has revealed the single-point mutation in the RepA protein giving temperature sensitivity to the protein itself. Olson and Lynd constructed and characterized temperature-sensitive plasmids, named pMU102 and pMU770, replicable in Clostridium thermocellum using a computationally designed amino acid substitution algorithm.^7,49,50) One approach is to substitute positively charged, polar, small, or large hydrophobic amino acids, such as lysine (Lys), serine (Ser), alanine (Ala), or tryptophan (Trp), at some predicted buried positions. The R44S mutation on the RepA protein found in the present study partially satisfies that requirement, and thus the parental residue arginine (Arg) may contribute to the stabilization of the structure and/or function of RepA.

The composite transposon Tn10 containing a tetracycline-resistant gene was first discovered as an antibiotic-resistant episome in E. coli.⁵¹⁾ A 9147 bp complete nucleotide sequence of Tn10 was determined in 2000 by Chalmers et al.,¹⁹⁾ showing that the Tn10 has 1329 bp inverted repeats, named IS10-Left and IS10-Right, which each contain a transposase gene. Further, each inverted repeat contains another pair of inverted repeats at both ends (IE and OE of the IS10 ends, 70 bp). The sequences of IS10-Left and IS10-Right are slightly different from each other, and IS10-Right has been reported to be fully functional, whereas the activity of the left side is reduced.^19,37) Therefore, the IS10-Right-derived IE, OE, and Tase gene were used in the present study. The hotspot of recombination for Tn10 is predicted to be one site per 1000 bp of the target DNA,^52–55) indicating that the Tn10-based random insertion may be fully expected in genetic approaches on LABs. In fact, Tn10-mediated transposition was reported to be successfully achieved in several kinds of Gram-negative and Gram-positive bacteria.^38,56) Therefore, pLES-Tn10-TS1 may also be expected to be a useful plasmid that will be applied for functional and genetic analyses in health-promoting LAB strains with a focus on our isolates confirmed to be useful in randomized controlled trials.^57–60)

Acknowledgments

We thank the Research Center for Molecular Medicine, the Faculty of Medicine, and the Analysis Center of Life Science, Hiroshima University, for the use of their facilities. We are also grateful to Hinako Ide and Yoshito Oka for their technical assistance in the Sugiyama laboratory.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Vos M. Why do bacteria engage in homologous recombination? Trends Microbiol., 17, 226–232 (2009).
• 2) Boeke JD. Putting mobile DNA to work: the toolbox. Mobile DNA II. (Craig NL, Craigie R, Gellert M, Lambowitz AM eds.) American Society for Microbiology, Washington DC, pp. 24–37 (2002).
• 3) Chen S, Larsson M, Robinson RC, Chen SL. Direct and convenient measurement of plasmid stability in lab and clinical isolates of E. coli. Sci. Rep., 7, 4788 (2017).
• 4) Martínez-García E, Aparicio T, de Lorenzo V, Nikel PI. Engineering Gram-negative microbial cell factories using transposon vectors. Methods Mol. Biol., 1498, 273–293 (2017).
• 5) Buckner MMC, Ciusa ML, Piddock LJV. Strategies to combat antimicrobial resistance: anti-plasmid and plasmid curing. FEMS Microbiol. Rev., 42, 781–804 (2018).
• 6) Volke DC, Friis L, Wirth NT, Turlin J, Nikel PI. Synthetic control of plasmid replication enables target- and self-curing of vectors and expedites genome engineering of Pseudomonas putida. Metab. Eng. Commun., 10, e00126 (2020).
• 7) Olson DG, Lynd LR. Computational design and characterization of a temperature-sensitive plasmid replicon for gram positive thermophiles. J. Biol. Eng., 6, 5 (2012).
• 8) Wada T, Noda M, Kashiwabara F, Jeon HJ, Shirakawa A, Yabu H, Matoba Y, Kumagai T, Sugiyama M. Characterization of four plasmids harboured in a Lactobacillus brevis strain encoding a novel bacteriocin, brevicin 925A, and construction of a shuttle vector for lactic acid bacteria and Escherichia coli. Microbiology, 155, 1726–1737 (2009).
• 9) Fukao M, Zendo T, Inoue T, Nakayama J, Suzuki S, Fukaya T, Yajima N, Sonomoto K. Plasmid-encoded glycosyltransferase operon is responsible for exopolysaccharide production, cell aggregation, and bile resistance in a probiotic strain, Lactobacillus brevis KB290. J. Biosci. Bioeng., 128, 391–397 (2019).
• 10) Jeon HJ, Noda M, Matoba Y, Kumagai T, Sugiyama M. Crystal structure and mutagenic analysis of a bacteriocin immunity protein, Mun-im. Biochem. Biophys. Res. Commun., 378, 574–578 (2009).
• 11) Sharma A, Noda M, Sugiyama M, Kaur B, Ahmad A. Metabolic engineering of Pediococcus acidilactici BD16 for heterologous expression of synthetic alaD gene cassette and L-alanine production in the recombinant strain using fed-batch fermentation. Foods, 10, 1964 (2021).
• 12) Liu CQ, Duan K, Dunn NW. Cloning and sequence analysis of a plasmid replicon from Lactococcus lactis subsp. cremoris FG2. J. Gen. Appl. Microbiol., 43, 75–80 (1997).
• 13) Noda M, Miyauchi R, Danshiitsoodol N, Matoba Y, Kumagai T, Sugiyama M. Expression of genes involved in bacteriocin production and self-resistance in Lactobacillus brevis 174A is mediated by two regulatory proteins. Appl. Environ. Microbiol., 84, e02707-17 (2018).
• 14) Noda M, Shiraga M, Kumagai T, Danshiitsoodol N, Sugiyama M. Characterization of the SN35N strain-specific exopolysaccharide encoded in the whole circular genome of a plant-derived Lactobacillus plantarum. Biol. Pharm. Bull., 41, 536–545 (2018).
• 15) Tanaka O, Kimura H, Takahashi E, Ogata S, Ohmomo S. Screening of lactic acid bacteria for silage inoculants by using a model system of silage fermentation. Biosci. Biotechnol. Biochem., 58, 1412–1415 (1994).
• 16) Sambrook J, Russell DW. Molecular Cloning: A Laboratory Manual. 3rd ed., Cold Spring Harbor Laboratory, New York (2001).
• 17) Aukrust T, Blom H. Transformation of Lactobacillus strains used in meat and vegetable fermentations. Food Res. Int., 25, 253–261 (1992).
• 18) Sakaguchi K, He J, Tani S, Kano Y, Suzuki T. A targeted gene knockout method using a newly constructed temperature-sensitive plasmid mediated homologous recombination in Bifidobacterium longum. Appl. Microbiol. Biotechnol., 95, 499–509 (2012).
• 19) Chalmers R, Sewitz S, Lipkow K, Crellin P. Complete nucleotide sequence of Tn10. J. Bacteriol., 182, 2970–2972 (2000).
• 20) Kleckner N, Chalmers RM, Kwon D, Sakai J, Bolland S. Tn10 and IS10 transposition and chromosome rearrangements: mechanism and regulation in vivo and in vitro. Transposable Elements. (Saedler H, Gierl A eds.) Springer, Berlin, Germany, pp. 49–82 (1996).
• 21) Gosalbes MJ, Monedero V, Pérez-Martínez G. Elements involved in catabolite repression and substrate induction of the lactose operon in Lactobacillus casei. J. Bacteriol., 181, 3928–3934 (1999).
• 22) Adolfsson O, Meydani SN, Russell RM. Yogurt and gut function. Am. J. Clin. Nutr., 80, 245–256 (2004).
• 23) Sanders ME. Probiotics: definition, source, selection, and uses. Clin. Infect. Dis., 46 (Suppl. 2), S58–S61, discussion, S144–S151 (2008).
• 24) Cotter PD, Ross PR, Hill C. Bacteriocins—a viable alternative to antibiotics? Nat. Rev. Microbiol., 11, 95–105 (2013).
• 25) Krawczyk B, Wityk P, Gałęcka M, Michalik M. The many faces of Enterococcus spp.—commensal, probiotic and opportunistic pathogen. Microorganisms, 9, 1900 (2021).
• 26) Suvorov A. Gut microbiota, probiotics, and human health. Biosci. Microbiota Food Health, 32, 81–91 (2013).
• 27) Vasiljevic T, Shah NP. Probiotics—from metchnikoff to bioactives. Int. Dairy J., 18, 714–728 (2008).
• 28) Ouwehand AC, Salminen S, Isolauri E. Probiotics: an overview of beneficial effects. Antonie van Leeuwenhoek, 82, 279–289 (2002).
• 29) Marteau P, Seksik P, Lepage P, Dore J. Cellular and physiological effects of probiotics and prebiotics. Mini Rev. Med. Chem., 4, 889–896 (2004).
• 30) Wang L, Cen S, Wang G, Lee YK, Zhao J, Zhang H, Chen W. Acetic acid and butyric acid released in large intestine play different roles in the alleviation of constipation. J. Funct. Foods, 69, 103953 (2020).
• 31) Hidalgo-Cantabrana C, López P, Gueimonde M, de Los Reyes-Gavilán CG, Suárez A, Margolles A, Ruas-Madiedo P. Immune modulation capability of exopolysaccharides synthesized by lactic acid bacteria and bifidobacterial. Probiotics Antimicrob. Proteins, 4, 227–237 (2012).
• 32) Trejo-González L, Gutiérrez-Carrillo AE, Rodríguez-Hernández AI, Del Rocío López-Cuellar M, Chavarría-Hernández N. Bacteriocins produced by LAB isolated from cheeses within the period 2009–2021: a review. Probiotics Antimicrob. Proteins, 14, 238–251 (2022).
• 33) Singh A, Duche RT, Wandhare AG, Sian JK, Singh BP, Sihag MK, Singh KS, Sangwan V, Talan S, Panwar H. Milk-derived antimicrobial peptides: overview, applications, and future perspectives. Probiotics Antimicrob. Proteins, 15, 44–62 (2023).
• 34) Vera-Santander VE, Hernández-Figueroa RH, Jiménez-Munguía MT, Mani-López E, López-Malo A. Health benefits of consuming foods with bacterial probiotics, postbiotics, and their metabolites: a review. Molecules, 28, 1230 (2023).
• 35) Renault P. Genetically modified lactic acid bacteria: applications to food or health and risk assessment. Biochimie, 84, 1073–1087 (2002).
• 36) Cohen SN, Chang AC, Boyer HW, Helling RB. Construction of biologically functional bacterial plasmids in vitro. Proc. Natl. Acad. Sci. U.S.A., 70, 3240–3244 (1973).
• 37) Kleckner N. Transposable elements in prokaryotes. Annu. Rev. Genet., 15, 341–404 (1981).
• 38) Choi KH, Kim KJ. Applications of transposon-based gene delivery system in bacteria. J. Microbiol. Biotechnol., 19, 217–228 (2009).
• 39) Shimizu-Kadota M, Kiwaki M, Hirokawa H, Tsuchida N. ISL1: a new transposable element in Lactobacillus casei. Mol. Gen. Genet., 200, 193–198 (1985).
• 40) Hill C, Daly C, Fitzgerald GF. Development of high-frequency delivery system for transposon Tn919 in lactic streptococci: random insertion in Streptococcus lactis subsp. diacetylactis 18-16. Appl. Environ. Microbiol., 53, 74–78 (1987).
• 41) Hill C, Daly C, Fitzgerald GF. Isolation of chromosomal mutations of Lactococcus lactis subsp. lactis biovar. diacetylactis 18-16 after introduction of Tn919. FEMS Microbiol. Lett., 81, 135–140 (1991).
• 42) Knauf HJ, Vogel RF, Hammes WP. Introduction of the transposon Tn919 into Lactobacillus curvatus Lc2-c. FEMS Microbiol. Lett., 65, 101–104 (1989).
• 43) Goryshin IY, Reznikoff WS. Tn5 in vitro transposition. J. Biol. Chem., 273, 7367–7374 (1998).
• 44) Ito M, Kim YG, Tsuji H, Kiwaki M, Nomoto K, Tanaka R, Okada N, Danbara H. A practical random mutagenesis system for probiotic Lactobacillus casei using Tn5 transposition complexes. J. Appl. Microbiol., 109, 657–666 (2010).
• 45) Israelsen H, Hansen EB. Insertion of transposon Tn917 derivatives into the Lactococcus lactis subsp. lactis chromosome. Appl. Environ. Microbiol., 59, 21–26 (1993).
• 46) Hemarajata P, Spinler JK, Balderas MA, Versalovic J. Identification of a proton-chloride antiporter (EriC) by Himar1 transposon mutagenesis in Lactobacillus reuteri and its role in histamine production. Antonie van Leeuwenhoek, 105, 579–592 (2014).
• 47) Croughan M. Plasmid DNA—overview. Pharm. Bioprocess., 9, 28–29 (2021).
• 48) Sinha RP. Stability of plasmids in lactococci during extended incubation in growth media. Can. J. Microbiol., 37, 488–490 (1991).
• 49) Varadarajan R, Nagarajaram HA, Ramakrishnan C. A procedure for the prediction of temperature-sensitive mutants of a globular protein based solely on the amino acid sequence. Proc. Natl. Acad. Sci. U.S.A., 93, 13908–13913 (1996).
• 50) Chakshusmathi G, Mondal K, Lakshmi GS, Singh G, Roy A, Ch RB, Madhusudhanan S, Varadarajan R. Design of temperature-sensitive mutants solely from amino acid sequence. Proc. Natl. Acad. Sci. U.S.A., 101, 7925–7930 (2004).
• 51) Nakaya R, Nakamura A, Murata Y. Resistance transfer agents in Shigella. Biochem. Biophys. Res. Commun., 3, 654–659 (1960).
• 52) Kleckner N, Ross DG. Translocation and other recombination events involving the tetracycline-resistance element Tn10. Cold Spring Harb. Symp. Quant. Biol., 43, 1233–1246 (1979).
• 53) Foster TJ. Insertion of the tetracycline resistance translocation unit Tn10 in the lac operon of Escherichia coli K12. Mol. Gen. Genet., 154, 305–309 (1977).
• 54) Noel KD, Ames GF. Evidence for a common mechanism for the insertion of the Tn10 transposon and for the generation of Tn10-stimulated deletions. Mol. Gen. Genet., 166, 217–223 (1978).
• 55) Halling SM, Kleckner N. A symmetrical six-base-pair target site sequence determines Tn10 insertion specificity. Cell, 28, 155–163 (1982).
• 56) Tascon RI, Rodriguez-Ferri EF, Gutierrez-Martin CB, Rodriguez-Barbosa I, Berche P, Vazquez-Boland JA. Transposon mutagenesis in Actinobacillus pleuropneumoniae with a Tn10 derivative. J. Bacteriol., 175, 5717–5722 (1993).
• 57) Higashikawa F, Noda M, Awaya T, Nomura K, Oku H, Sugiyama M. Improvement of constipation and liver function by plant-derived lactic acid bacteria: a double-blind, randomized trial. Nutrition, 26, 367–374 (2010).
• 58) Higashikawa F, Noda M, Awaya T, Danshiitsoodol N, Matoba Y, Kumagai T, Sugiyama M. Antiobesity effect of Pediococcus pentosaceus LP28 on overweight subjects: a randomized, double-blind, placebo-controlled clinical trial. Eur. J. Clin. Nutr., 70, 582–587 (2016).
• 59) Noda M, Kanno K, Danshiitsoodol N, Higashikawa F, Sugiyama M. Plant-derived Lactobacillus paracasei IJH-SONE68 improves chronic allergy status: a randomized, double-blind, placebo-controlled clinical trial. Nutrients, 13, 4022 (2021).
• 60) Danshiitsoodol N, Noda M, Kanno K, Uchida T, Sugiyama M. Plant-derived Lactobacillus paracasei IJH-SONE68 improves the gut microbiota associated with hepatic disorders: a randomized, double-blind, and placebo-controlled clinical trial. Nutrients, 14, 4492 (2022).