Role of the Cytosolic Domain of the a3 Subunit of V-ATPase in the Interaction with Rab7 and Secretory Lysosome Trafficking in Osteoclasts

Abstract

We previously reported that the a3 subunit of proton-pumping vacuolar-type ATPase (V-ATPase) interacts with Rab7 and its guanine nucleotide exchange factor, Mon1a-Ccz1, and recruits them to secretory lysosomes in osteoclasts, which is essential for anterograde trafficking of secretory lysosomes. The a3 subunit interacts with Mon1a-Ccz1 through its cytosolic N-terminal domain. Here, we examined the roles of this domain in the interaction with Rab7 and trafficking of secretory lysosomes. Immunoprecipitation experiments showed that a3 interacted with Rab7 through its cytosolic domain, similar to the interaction with Mon1a-Ccz1. We connected this domain with a lysosome localization signal and expressed it in a3-knockout (a3KO) osteoclasts. Although the signal connected to the cytosolic domain was mainly detected in lysosomes, impaired lysosome trafficking in a3KO osteoclasts was not rescued. These results indicate that the cytosolic domain of a3 can interact with trafficking regulators, but is insufficient to induce secretory lysosome trafficking. The C-terminal domain of a3 and other subunits of V-ATPase are likely required to form a fully functional complex for secretory lysosome trafficking.

INTRODUCTION

Bone density is maintained by the balance between bone genesis by osteoblasts and bone resorption by osteoclasts. Excessive bone resorption induced by aging and a strong inflammatory response causes osteoporosis.^1,2) Osteoclasts tightly attach to the bone surface and release lysosomal enzymes, such as cathepsin K, toward the bone surface to digest bone substrate. Lysosomes in osteoclasts are called secretory lysosomes, which move toward and fuse with the plasma membrane to release their enzymes.^2–4) Proton-pumping vacuolar-type ATPase (V-ATPase) plays an essential role in bone resorption by osteoclasts. Through secretory lysosomes, lysosomal V-ATPase relocates to the plasma membrane, where it generates the acidic conditions required for activity of released lysosomal enzymes and dissolution of calcium phosphate in bone.^5,6)

V-ATPase is composed of a cytosolic V₁ sector and a membrane-embedded V_o sector (Fig. 1A). The a and c subunits in the V_o sector form a proton pathway. The a subunit is composed of more than 800 amino acids, and its C-terminal half has transmembrane domains that form the proton pathway, while its N-terminal half is a cytosolic domain that protrudes from the membrane and interacts with subunits in the V₁ sector.^7,8) Among the four a subunit isoforms, a3 is accumulated mainly in lysosomes.^7,8) Osteoclasts in a3-knockout (a3KO) mice lack bone resorption activity and these mice develop osteopetrosis.^9,10) However, the detailed role of a3 in osteoclasts had not been revealed.

Fig. 1. Interaction of V-ATPase a3 Subunit Derivatives, Rab7, and Mon1a-Ccz1

(A) Schematic illustration of the subunits of mammalian proton-pumping V-ATPase. aN and aC represent the cytosolic domain and the membrane-embedded domain of the a subunit, respectively. (B) Structures of a3 derivatives. Numbers indicate amino acids from the N-terminus. (C) Interaction of a3 derivatives with Rab7 and Mon1a-Ccz1. Control indicates experiments using cells transfected with an empty vector instead of the FLAG-a3 expression plasmid.

Rab small guanosine 5′-triphosphatases (GTPases) are key players in organelle and vesicle trafficking.¹¹⁾ Their activities are controlled by nucleotide exchange. The GTP- and guanosine 5′-diphosphate (GDP)-bound forms are active and inactive, respectively. A guanine nucleotide exchange factor (GEF) activates Rab proteins by exchanging their GDP for GTP.¹²⁾ Activated Rab proteins can localize to organelle membranes, where they form a large trafficking machinery including effector and motor proteins.^11,12) Through the machinery, organelles are docked on and move along microtubules and/or actin filaments. Among more than 60 mammalian Rab proteins identified so far,¹³⁾ Rab7 is late endosome- and lysosome-specific.¹⁴⁾

Using a3KO mice and osteoclasts, we previously reported that the lysosomal a3 subunit recruits Rab7 and its GEF, Mon1a-Ccz1, to secretory lysosomes in osteoclasts, which is essential for secretory lysosome trafficking toward the plasma membrane and thus bone resorption.^15,16) This finding demonstrates that a3 has a dual function in osteoclasts: formation of an acidic environment in the space between cells and bone, and recruitment of trafficking regulators to secretory lysosomes.^15,16) Additionally, our immunoprecipitation analysis using HEK293T cells revealed that a3 and Mon1a-Ccz1 interact with each other through the cytosolic N-terminal domain of a3 and the longin domains of Mon1a and Ccz1.¹⁶⁾

In this study, we investigated the roles of the cytosolic N-terminal domain of a3 in the interaction with Rab7 and secretory lysosome trafficking. Our data showed that this domain interacted with Rab7, but failed to induce secretory lysosome trafficking in osteoclasts. The C-terminal domain of a3 and other subunits of V-ATPase likely play a role in formation of a fully functional complex of trafficking factors on secretory lysosomes.

MATERIALS AND METHODS

Animals and Cell Culture

C57BL/6-a3^+/− heterozygous mice (BRC No. RBRC04421)¹⁷⁾ were purchased from the RIKEN BioResource Center and mated to obtain homozygous a3^+/+ wild-type (WT) and a3^−/− (a3KO) mice. All animal experiments complied with the Animal Experimental Guidelines of Iwate Medical University and the Act on Welfare and Management of Animals of Japan, and were approved by the Ethics Committee for Animal Research at Iwate Medical University (Approval No. 03-019). Isolation of macrophages and induction of osteoclast differentiation were performed as described previously.^15,16) HEK293T and Plat-E cells were purchased from the RIKEN BioResource Center (Ibaraki, Japan; RCB2202) and Cell Biolabs (San Diego, CA, U.S.A.), respectively, and cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum and antibiotics. Unless otherwise indicated, all reagents used for cell culture were from Thermo Scientific (Waltham, MA, U.S.A.).

Retrovirus Infection

Plat-E cells were plated at a density of 1 × 10⁶ cells in 6 cm dishes for retrovirus production. Spleen macrophages were infected with retroviruses using Platinum Retrovirus Expression Systems (Cell Biolabs).^15,16) Infected cells were selected by culture in the presence of 2 µg/mL puromycin, re-plated in 24-well dishes at a density of 1.0 × 10⁴ cells per well, and cultured for a further 2 d in the absence of puromycin. Then, these cells were cultured with 200 ng/mL receptor activator of nuclear factor kappa B ligand (RANKL, Oriental Yeast, Tokyo, Japan) to induce osteoclast differentiation.

Construction of Plasmids

Construction of a3N-TM(STX7), a3N-TM(Tom5), and a3N-TM(Fis1) expression vectors is described below. The DNA fragment encoding a3N was PCR-amplified using primers (T7 and a3N_R) with BamHI and EcoRI sites. The linker encoding a transmembrane domain of syntaxin 7 with EcoRI and NotI sites was made by annealing two synthesized oligonucleotides, Eco-Syt(TM)-Not_F and Eco-Syt(TM)-Not_R. In the same way, linkers encoding transmembrane domains of Tom5 and Fis1 were also made. The digested DNA fragment and linkers were subcloned into pcDNA3.1/FLAG and pMX(puro)/V5 vectors using BamHI and NotI. The sequences of the oligonucleotides are shown in Table 1.

Table 1. Sequences of Oligonucleotides Used in This Study

Name	Sequence
a3N_R	5′-ACTGGAATTCTTCCCTGTAGCGGCCCAC-3′
Eco-Syt(TM)-Not_F	5′-AATTCTGCATTATCATTTTTATCCTCGTGGTCGGAATCGTGATCATCTGTCTCATCGTATGGGGACTGAAAGGCTGAGC-3′
Eco-Syt(TM)-Not_R	5′-GGCCGCTCAGCCTTTCAGTCCCCATACGATGAGACAGATGATCACGATTCCGACCACGAGGATAAAAATGATAATGCAG-3′
Eco-Tom5(TM)-Not_F	5′-AATTCGTGATCTCCTCCATACGGAACTTTCTCATCTACGTGGCCCTCCTGCGAGTCACTCCATTTATCTTAAAGAAATTGGACAGCATATGAGC-3′
Eco-Tom5(TM)-Not_R	5′-GGCCGCTCATATGCTGTCCAATTTCTTTAAGATAAATGGAGTGACTCGCAGGAGGGCCACGTAGATGAGAAAGTTCCGTATGGAGGAGATCACG-3′
Eco-Fis1(TM)-Not_F	5′-AATTCATGAAGAAAGATGGACTCGTGGGCATGGCCATCGTGGGAGGCATGGCCCTGGGTGTGGCGGGACTGGCCGGACTCATCGGACTTGCTGTGTCCAAGTCCAAATCCTGAGC-3′
Eco-Fis1(TM)-Not_R	5′-GGCCGCTCAGGATTTGGACTTGGACACAGCAAGTCCGATGAGTCCGGCCAGTCCCGCCACACCCAGGGCCATGCCTCCCACGATGGCCATGCCCACGAGTCCATCTTTCTTCATG-3′

Immunoprecipitation and Western Blotting

Immunoprecipitation using HEK293T cells was performed as described previously.^15,16) Cell lysates were subjected to immunoprecipitation with an anti-FLAG antibody, and the resulting precipitates were analyzed by SDS-polyacrylamide gel electrophoresis and Western blotting using an ECL Prime detection kit (GE Healthcare, Chicago, IL, U.S.A.). Chemiluminescence was detected using Fusion Solo S (Vilber Lourmat). These experiments were repeated three times.

Fluorescence Microscopy

Immunostaining was carried out as described previously.^15,16) Fluorescence images were acquired using a FV-1000 confocal microscope with a 100× objective, NA 1.40 (Olympus, Tokyo, Japan). These experiments were repeated three times.

Antibodies

Antibodies against the A and d1 subunits of V-ATPase were purchased from Abcam (Cambridge, U.K.). Antibodies against FLAG, V5, and CD68 were from Sigma-Aldrich (St. Louis, MO, U.S.A.), Thermo Scientific, and Hycult Biotech (Uden, the Netherlands), respectively. Clean-Blot, a horseradish peroxidase (HRP)-conjugated antibody for Western blot detection following immunoprecipitation, was from Thermo Scientific. HRP-conjugated anti-mouse immunoglobulin G (IgG) was obtained from GE Healthcare. Alexa Fluor-conjugated secondary antibodies for immunostaining were from Thermo Scientific.

RESULTS

Role of the Cytosolic Domain of a3 in the Interaction with Rab7

We previously reported that the a3 subunit of V-ATPase interacts with Mon1a-Ccz1 through its cytosolic N-terminal domain.¹⁶⁾ We also reported that a3 specifically interacts with Rab7(T22N), a GDP-bound Rab7 mutant, but not with Rab7(Q67L), a GTP-bound Rab7 mutant.^15,16) In addition, a3 recruits these proteins from the cytosol to secretory lysosomes in osteoclasts.^15,16) These previous results suggest that GDP-bound Rab7 recruited from the cytosol is activated by Mon1a-Ccz1 on secretory lysosomes.

In this study, to determine which domain of a3 interacts with Rab7(T22N), immunoprecipitation experiments were performed. We prepared HEK293T cells exogenously expressing FLAG-tagged a3 derivatives (Fig. 1B) and V5-tagged Rab7(T22N) together with V5-Mon1a and V5-Ccz1. Mon1a-Ccz1, a GEF for Rab7, increases the amount of Rab7 precipitated with a3¹⁶⁾; therefore, these proteins were co-expressed in cells. Using these cell lysates, immunoprecipitation was carried out with an anti-FLAG antibody. Consistent with previous results, V5-GDP-bound Rab7(T22N), V5-Mon1a, and V5-Ccz1 were co-precipitated with FLAG-a3WT (Fig. 1C, a3WT), indicating that these proteins form a complex. GDP-bound Rab7 and Mon1a-Ccz1 were also co-precipitated with the N-terminal domain of a3 (a3N), but not with the C-terminal domain (a3C) (Fig. 1C), indicating that a3 interacts with Rab7 through its N-terminal domain, similar to the interaction with Mon1a-Ccz1.

We constructed expression vectors harboring cDNA encoding a3N-TM(STX7), which is FLAG-a3N conjugated with a transmembrane domain of syntaxin 7, a lysosomal membrane protein, to deliver the protein to lysosomes¹⁸⁾ (Fig. 1B), and performed immunoprecipitation. a3N-TM(STX7) efficiently interacted with Rab7 and Mon1a-Ccz1 compared with a3WT (Fig. 1C). Similar to a3WT, a3N-TM(STX7) interacted with the d1 subunit in the V_o sector, but interacted much less efficiently with the A subunit in the V₁ sector (Fig. 1C), suggesting that the V_o sector harboring a3N-TM(STX7) failed to associate with the V₁ sector. V₁-free a3N-TM(STX7) seems to have higher accessibility to Rab7 and Mon1a-Ccz1 than a3WT.

FLAG-a3N was also conjugated with a transmembrane domain of Tom5 or Fis1, which are mitochondrial outer membrane proteins.^19,20) Both a3N-TM(Tom5) and a3N-TM(Fis1) interacted with Mon1a-Ccz1, but less efficiently than FLAG-a3N-TM(STX7) (Fig. 1C). The lysosomal localization of a3N-TM(STX7) seems to stabilize the interactions with Rab7 and Mon1a-Ccz1.

Role of the Cytosolic Domain of a3 in Anterograde Trafficking of Secretory Lysosomes in Osteoclasts

We previously showed that secretory lysosomes move toward the plasma membrane by anterograde trafficking and localize to the cell periphery in WT osteoclasts (Fig. 2B, WT, arrowhead), whereas this trafficking is impaired and secretory lysosomes defuse throughout the cytoplasm in a3KO cells (Fig. 2B, a3KO, Control).¹⁵⁾ a3N interacted with Rab7 and Mon1a-Ccz1; therefore, we investigated whether it restores lysosome trafficking in a3KO osteoclasts.

Fig. 2. Effects of a3 Derivatives on Secretory Lysosome Trafficking in WT and a3KO Osteoclasts

(A) Expression of a3 derivatives in osteoclasts. (B) Localizations of a3 derivatives and the lysosome marker CD68 in osteoclasts. More than 10 cells were observed and representative images are shown. Schematically illustrated osteoclasts (light blue) and merged images are also shown. The boxed regions were magnified.

For expression experiments in osteoclasts, a3N and a3N-TM(STX7) were V5-tagged. The expression level of V5-a3N was much lower than those of V5-a3WT and V5-a3N-TM(STX7) in osteoclasts (Fig. 2A). a3N seems to require the transmembrane domains for its stability in osteoclasts. To determine the localizations of the V5-a3 derivatives and secretory lysosomes, we performed immunostaining using antibodies specific to V5 and a lysosome marker, CD68. V5-a3WT colocalized with CD68 and restored its peripheral localization when expressed in a3KO cells (Fig. 2B, a3KO, V5-a3WT, arrowhead). On the other hand, V5-a3N-TM(STX7) colocalized with CD68, at least partly (Fig. 2B, a3N-TM(STX7), Merge), but did not restore its peripheral localization, suggesting that the cytosolic domain of a3 on lysosomes is insufficient to induce secretory lysosome trafficking. As expected, signals of V5-a3N were hardly observed (Fig. 2B, a3N).

DISCUSSION

In this study, we investigated the roles of the cytosolic domain of the a3 subunit of V-ATPase in the interaction with Rab7 and secretory lysosome trafficking in osteoclasts. Our immunoprecipitation analysis revealed that the cytosolic a3N can interact with Rab7 and Mon1a-Ccz1, and the a3C is not required for these interactions. This indicates that Rab7 and Mon1a-Ccz1 interact with a similar region of a3. Mon1a-Ccz1 interacts with GDP-bound Rab7; therefore, Rab7 likely interacts with a3 through Mon1a-Ccz1.¹⁶⁾

Interestingly, a3N-TM(STX7), the cytosolic domain of a3 conjugated with a transmembrane domain of syntaxin 7, interacted more efficiently with Rab7 than a3N, suggesting that its membrane localization stabilizes the interaction. Additionally, a3N-TM(STX7) interacted more efficiently with Rab7 and Mon1a-Ccz1 than a3N-TM(Tom5) and a3N-TM(Fis1), a3N conjugated with a transmembrane domain of mitochondrial outer membrane proteins. These results suggest that a lysosome component is responsible for the efficient interactions. Human Mon1a preferentially binds to phosphatidylinositol-3-phosphate, which is a phosphatidylinositol phosphate lipid (PIP) in the lysosomal membrane.^21,22) Additionally, it was recently reported that human a isoforms specifically interact with distinct PIPs.²³⁾ Therefore, lysosomal components, including PIPs, possibly strengthen the interaction.

a3N-TM(STX7) localized to lysosomes in osteoclasts and efficiently interacted with Rab7; therefore, we expected it to recruit Rab7 and restore secretory lysosome trafficking in a3KO osteoclasts. However, this was not observed. This result indicates that the cytosolic domain of a3 on lysosomes is insufficient to induce secretory lysosome trafficking. a3N-TM(STX7) interacted with the d1 subunit in the V_o sector, but not with the A subunit in the V₁ sector, indicating that it does not form the whole V-ATPase structure. Additionally, this trafficking requires not only Rab7 and Mon1a-Ccz1, but also effector and motor proteins. Thus, the entire structure of V-ATPase including the a3 cytosolic domain seems to be essential to form the fully functional trafficking machinery on secretory lysosomes.

Alternatively, proton transport activity by V-ATPase might be necessary.²⁴⁾ We previously reported that GTP-bound (active) Rab7 needs a3 to stably localize to lysosomes, although it does not interact with a3. We also previously showed that anterograde secretory lysosome trafficking in osteoclasts is abolished upon treatment with the V-ATPase inhibitor bafilomycin A1. These results imply that the lysosome luminal acidic conditions generated by V-ATPase are important for stable localization of activated Rab7 to lysosomes. However, it is noteworthy that bafilomycin A1 does not specifically inhibit lysosomal V-ATPase harboring a3. Here, we revealed that lysosomal a3N-TM(STX7), which lacks a proton pathway, did not restore the trafficking. This result strengthens the hypothesis that acidic conditions in lysosomes are important for the lysosomal localization of Rab7. A further study is required to fully elucidate the molecular mechanism underlying trafficking of secretory lysosomes in osteoclasts.

Acknowledgments

This work was supported partly by JSPS (Japan Society for the Promotion of Science) KAKENHI Grant Numbers: JP18K06661 and JP21H02627 (to M.N.-M.), and JP19K06646 and 23K05754 (to N.M.). We thank Dr. Mizuki Sekiya for critical discussions. We also thank Ms. Shio Yano and Ms. Kikuko Kawano for their expert technical assistance.

Author Contributions

M.N.-M. conceived the study, analyzed the interaction between a3 and trafficking factors, and wrote the manuscript with input from all authors. N.M. conceived the study and analyzed a3KO osteoclasts. Y.W. and G.-H.S.-W. generated a3KO mice.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Nakamura I, Takahashi N, Jimi E, Udagawa N, Suda T. Regulation of osteoclast function. Mod. Rheumatol., 22, 167–177 (2012).
• 2) Xu F, Teitelbaum SL. Osteoclasts: new insights. Bone Res., 1, 11–26 (2013).
• 3) Luzio JP, Hackmann Y, Dieckmann NM, Griffiths GM. The biogenesis of lysosomes and lysosome-related organelles. Cold Spring Harb. Perspect. Biol., 6, a016840 (2014).
• 4) Ribet ABP, Ng PY, Pavlos NJ. Membrane transport proteins in osteoclasts: the ins and outs. Front. Cell Dev. Biol., 9, 644986 (2021).
• 5) Blair HC, Teitelbaum SL, Ghiselli R, Gluck S. Osteoclastic bone resorption by a polarized vacuolar proton pump. Science, 245, 855–857 (1989).
• 6) Maxson ME, Grinstein S. The vacuolar-type H⁺ -ATPase at a glance—more than a proton pump. J. Cell Sci., 127, 4987–4993 (2014).
• 7) Futai M, Sun-Wada GH, Wada Y, Matsumoto N, Nakanishi-Matsui M. Vacuolar-type ATPase: a proton pump to lysosomal trafficking. Proc. Jpn. Acad., Ser. B, Phys. Biol. Sci., 95, 261–277 (2019).
• 8) Nakanishi-Matsui M, Matsumoto N. V-ATPase a3 subunit in secretory lysosome trafficking in osteoclasts. Biol. Pharm. Bull., 45, 1426–1431 (2022).
• 9) Li YP, Chen W, Liang Y, Li E, Stashenko P. Atp6i-deficient mice exhibit severe osteopetrosis due to loss of osteoclast-mediated extracellular acidification. Nat. Genet., 23, 447–451 (1999).
• 10) Scimeca JC, Franchi A, Trojani C, Parrinello H, Grosgeorge J, Robert C, Jaillon O, Poirier C, Gaudray P, Carle GF. The gene encoding the mouse homologue of the human osteoclast-specific 116-kDa V-ATPase subunit bears a deletion in osteosclerotic (oc/oc) mutants. Bone, 26, 207–213 (2000).
• 11) Stenmark H. Rab GTPases as coordinators of vesicle traffic. Nat. Rev. Mol. Cell Biol., 10, 513–525 (2009).
• 12) Ishida M, Oguchi ME, Fukuda M. Multiple types of guanine nucleotide exchange factors (GEFs) for rab small GTPases. Cell Struct. Funct., 41, 61–79 (2016).
• 13) Bock JB, Matern HT, Peden AA, Scheller RH. A genomic perspective on membrane compartment organization. Nature, 409, 839–841 (2001).
• 14) Zhang M, Chen L, Wang S, Wang T. Rab7: Roles in membrane trafficking and disease. Biosci. Rep., 29, 193–209 (2009).
• 15) Matsumoto N, Sekiya M, Tohyama K, Ishiyama-Matsuura E, Sun-Wada GH, Wada Y, Futai M, Nakanishi-Matsui M. Essential role of the a3 isoform of V-ATPase in secretory lysosome trafficking via Rab7 recruitment. Sci. Rep., 8, 6701 (2018).
• 16) Matsumoto N, Sekiya M, Sun-Wada GH, Wada Y, Nakanishi-Matsui M. The lysosomal V-ATPase a3 subunit is involved in localization of Mon1-Ccz1, the GEF for Rab7, to secretory lysosomes in osteoclasts. Sci. Rep., 12, 8455 (2022).
• 17) Sun-Wada GH, Tabata H, Kawamura N, Aoyama M, Wada Y. Direct recruitment of H⁺ -ATPase from lysosomes for phagosomal acidification. J. Cell Sci., 122, 2504–2513 (2009).
• 18) Wong SH, Xu Y, Zhang T, Hong W. Syntaxin 7, a novel syntaxin member associated with the early endosomal compartment. J. Biol. Chem., 273, 375–380 (1998).
• 19) Horie C, Suzuki H, Sakaguchi M, Mihara K. Characterization of signal that directs C-Tail-anchored proteins to mammalian mitochondrial outer membrane. Mol. Biol. Cell, 13, 1615–1625 (2002).
• 20) Marty NJ, Teresinski HJ, Hwang YT, Clendening EA, Gidda SK, Sliwinska E, Zhang D, Miernyk JA, Brito GC, Andrews DW, Dyer JM, Mullen RT. New insights into the targeting of a subset of tail-anchored proteins to the outer mitochondrial membrane. Front. Plant Sci., 5, 426 (2014).
• 21) Cabrera M, Nordmann M, Perz A, Schmedt D, Gerondopoulos A, Barr F, Piehler J, Engelbrecht-Vandré S, Ungermann C. The Mon1-Ccz1 GEF activates the Rab7 GTPase Ypt7 via a longin-fold-Rab interface and association with PI3P-positive membranes. J. Cell Sci., 127, 1043–1051 (2014).
• 22) Banerjee S, Kane PM. Regulation of V-ATPase activity and organelle pH by phosphatidylinositol phosphate lipids. Front. Cell Dev. Biol., 8, 510 (2020).
• 23) Mitra C, Winkley S, Kane PM. Human V-ATPase a-subunit isoforms bind specifically to distinct phosphoinositide phospholipids. J. Biol. Chem., 299, 105473 (2023).
• 24) Matsumoto N, Nakanishi-Matsui M. Proton pumping V-ATPase inhibitor bafilomycin A1 affects Rab7 lysosomal localization and abolishes anterograde trafficking of osteoclast secretory lysosomes. Biochem. Biophys. Res. Commun., 510, 421–426 (2019).