Relationship between Serum Concentrations and Muscular Expressions of Selenoproteins on Selenium-Supplemented Insulin Resistance Mouse Model

Abstract

Previously, insulin resistance and hepatic oxidative stress with increased expressions of glutathione peroxidase (GPx) 1 and selenoprotein P (SelP) were induced in NSY mice, a diabetic mouse model, by administrating a high fat diet (HFD) and seleno-L-methionine (SeMet) for 12 weeks. In this study we developed an analysis method for serum selenoproteins using LC-tandem mass spectrometry (LC-MS/MS) and investigated the effects of supplementary selenium on serum concentrations of selenoproteins as well as protein expression in skeletal muscle as a major insulin target tissue under the same experimental condition. The glucose area under the curves for oral glucose tolerance and insulin tolerance tests indicated that the HFD induced insulin resistance, whereas the treatment of SeMet + HFD showed insignificant promotion compared with the HFD-induced insulin resistance. Although the expressions of GPx1 in gastrocnemius and soleus were not significantly induced by supplementary SeMet nor HFD administration, the expressions of SelP in both skeletal muscles were significantly induced by the treatment of SeMet + HFD. There were also significant increases in serum concentrations of SelP by supplementary SeMet + HFD administration, whereas GPx3 was augmented by supplementary SeMet only. These results indicated that the HFD intake under the sufficient selenium status augmented the blood secretion of SelP, which may participate in the reduction of insulin sensitivity in skeletal muscles as well as liver or adipose tissues, and it is a better indicator of deterioration than GPx3 as it is a major selenoprotein in serum.

INTRODUCTION

Selenium (Se) is a trace element with both nutritional and toxicological properties, for which the range of adequate dietary intakes is relatively close to either habitual excess or insufficient ingestion.^1,2) Se is biologically converted and integrated as the Se-cysteine (SeC) residue into the active center of selenoenzymes to synthesize thioredoxin reductase,³⁾ glutathione peroxidase (GPx) family⁴⁾ and selenoprotein P (SelP).⁵⁾ Under nutritional conditions, these antioxidant enzymes suppress oxidative stress and regulate inflammatory responses.^6,7) These selenoenzymes are also involved in the prevention of complex disorders including diabetes mellitus and cardiovascular disease by suppressing the harmful accumulation of intracellular reactive oxygen (ROS).^8,9)

Type 2 diabetes is a metabolic disorder resulting from the decline of insulin secretion from pancreatic β-cells, and a lack of insulin action in the target organs, liver, adipose tissue and skeletal muscles.¹⁰⁾ Genetic and lifestyle factors of patients are responsible for the pathologies¹¹⁾ linked physiologically to insulin resistance,¹²⁾ and biochemically to oxidative stress.¹³⁾ Antioxidant enzymes intrinsically counterbalance the intracellular ROS production and normalize redox status in pancreatic β-cells^14,15) or function during insulin signal transduction within the target tissue cells.¹⁶⁾ However, higher serum selenium levels than nutritionally adequate are positively associated with type 2 diabetes in populations, indicating that high dietary selenium intake may increase the risk of the metabolic disorder.¹⁷⁾ It is also reported that high Se intake increases the risk of gestational diabetes in Japan.¹⁸⁾ It is thus important to estimate the individual intake by monitoring blood major selenoprotein levels. We previously investigated a relationship between supplementary Se and glucose intolerance with NSY mice, a diabetic mouse model, by administrating a high fat diet (HFD) and seleno-L-methionine (SeMet) and found that the hepatic lipid accumulation promotes oxidative stress and hepatic SelP expression with the induction of insulin resistance.¹⁹⁾ It was however still unclear whether muscles as a major glucose-consuming tissues were insensitive to insulin and contributed to the whole resistance. Meta-analysis suggested that the blood levels of SelP, most of which were identified by enzyme-linked immunosorbent assay (ELISA) as Se transporter, positively correlates with the markers of glucose and lipid metabolic diseases, including type 2 diabetes.²⁰⁾ However, the monoclonal antibodies of SelP commercially available for ELISA kits and/or Western blotting are not always specific for this determination,²¹⁾ likely due to polymorphism in human SelP²²⁾ and the imperfect translational mechanism of the UGA codon as 10 SeC residues.²³⁾ Therefore, a development of blood SelP monitoring independent on the polymorphism should be useful for prevention of the metabolic disorders.

In this study, we investigated selenoprotein expressions in skeletal muscle of NSY mice as a major insulin target tissue under the same experimental condition as the previous study.¹⁹⁾ We developed an analysis method for serum selenoproteins with LC-tandem mass spectrometry (LC-MS/MS) and investigated the effects of administrating HFD and an effective selenium nutrient showing the high bioavailavility,²⁴⁾ SeMet on the serum concentrations of SelP and GPx3 as the major selenoproteins in the blood.

MATERIALS AND METHODS

Animals

Permission for the animal experiments performed in this study was obtained from the Animal Experiment Room Administration Committee of Setsunan University, and the experiments were conducted according to the Animal Experiment Guidelines of the Faculty of Pharmaceutical Sciences, Setsunan University. Specific pathogen-free male NSY mice (4 weeks old, about 14 g) were purchased from Hoshino Laboratory Animals, Inc. (Ibaraki, Japan). The animals were maintained in a specific pathogen-free room at 23 ± 1 °C and 47–67% humidity, under a 12 h light/dark cycle (lights on at 7:00 a.m.), and had ad libitum access to γ-ray-irradiated normal diet (ND) (CRF-1, Oriental Yeast Co., Ltd., Tokyo, Japan) and sterilized tap water. The mice were acclimated for 1 week prior to use.

HFD and SeMet Administration and Biochemical Tests

NSY mice (8 mice/group) were switched from a normal diet to a HFD (60% kcal from fat) (HFD-60, Oriental Yeast Co., Ltd.) and tap water containing 2 mgSe/L SeMet (Sigma-Aldrich Japan K.K., Tokyo, Japan) at 5 weeks old. These mice were kept for 12 weeks while measuring body weight every two days and non-fasting blood glucose level every week. The oral glucose tolerance test (OGTT), insulin tolerance test (ITT), quantitative RT-PCR (RT-qPCR) and Western blot analysis of selenoproteins and peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) in skeletal muscles were conducted, as described previously.¹⁹⁾ RT-qPCR was performed with primers for SelH (forward: GGAAGAAAGCGTAAGGCGGG, reverse: GGTTTGGACGGGTTCACTTGC), SelW (forward: CCCAAGTACCTCCAGCTCA, reverse: GCCATCACCTCTCTTCTTGG) and PGC-1α (forward: TGCCATTGTTAAGACCGA, reverse: GGTCATTTGGTGACTCTGG).²⁵⁾

Sample Preparation for Serum Selenoproteins

Whole blood was allowed to clot for 30 min at room temperature and then centrifuged at 3000 × g for 20 min at 4 °C. The fractionated serum samples were transferred into clean micro tubes and immediately frozen at −80 °C until use. An aliquot (12.5 µL) of the serum sample was then applied to an immunoaffinity spin column (Multiple Affinity Removal Spin Cartridge Mouse-3; Agilent Technologies Japan, Ltd., Tokyo, Japan), and high-abundance proteins such as albumin, immunoglobulin G and transferrin were eliminated, according to the manufacturer’s instructions. The eluates were concentrated under reduced pressure, reconstituted in 200 µL of 4 M urea solution, and then reduced with 2 µL of 500 mM dithiothreitol at 60 °C for 45 min, followed by alkylation with 20 µL of 150 mM iodoacetamide at room temperature for 60 min. The alkylation samples were diluted with 0.1 M Tris–HCl (pH 8.0) to a total volume of 800 µL and subsequently digested at 37 °C for 16 h with 5 µg of trypsin. Protein digestion was stopped by 4 µL of trifluoroacetic acid (TFA) and cleaned up using MonoSpin C18 (GL Sciences, Inc., Tokyo, Japan). The column was conditioned with centrifuging of 400 µL 95% acetonitrile (ACN) at 3000 × g for 2 min, followed by 400 µL 2% ACN containing 0.1% TFA at 3000 × g for 2 min. The whole amount of digested sample was added to the conditioned column, centrifuged at 3000 × g for 2 min, and then rinsed with 400 µL 2% ACN containing 0.1% TFA at 3000 × g for 2 min. Analytes were eluted by centrifuging of 200 µL 50% ACN containing 0.1% TFA at 3000 × g for 2 min.

Liquid Chromatography-Quadrupole Time-of-Flight Mass Spectrometry (LC-QTOF-MS)

The elution samples and synthetic peptides (≥98% purity, GenScript USA, Inc., Piscataway, NJ, U.S.A.) were analyzed on X500R coupled to an ExionLC UHPLC system (AB Sciex Pte. Ltd., Framingham, MA, U.S.A.), controlled by Sciex OS (ver.2.1, AB Sciex Pte. Ltd.). The samples were injected 10 µL and separated using 1.7 µm Raptor-ARC18, 2.1 × 150 mm (Restek Corp., Bellefonte, PA, U.S.A.). The column temperature was maintained at 40 °C. Mobile phase A was ultra-pure water (18.2 MΩ × cm) with 0.1% (v/v) formic acid. Mobile phase B was 100% ACN with 0.1% (v/v) formic acid. The flow rate was 0.25 mL/min. In information dependent acquisition (IDA) mode, gradient conditions were 0–5 min 5% B, 5–110 min from 5% B to 40% B, 110–120 min 40% B to 95% B, and then washed with 95% B for 15 min and 5% B for 20 min, for a total of 155 min. In TOF-MS/MS scan mode, Gradient conditions were 0–1 min 5% B, 1–21 min from 5% B to 40% B, 21–23 min 40% B to 95% B, and then washed with 95% B for 10 min and 5% B for 10 min, for a total of 43 min. The column effluent was connected to the X500R coupled with electrospray ionization (ESI). The instrument parameter settings for IDA are shown below: ion source gas 1 and 2 was 50 psi, curtain gas was 20, collisionally activated dissociation gas was 7, ion source temperature was 450 °C, ESI spray voltage was 5500 V, TOF MS collision energy (CE) was 10 V and TOF MS/MS CE was 35 ± 10 V, TOF MS and TOF MS/MS declustering potential was 80 V, TOF MS mass charge ratio (m/z) was between 300 and 1200, TOF MS/MS m/z was between 50 and 1500. TOF MS accumulation time was 0.1 s and TOF MS/MS was 0.05 s. The instrument parameter settings for TOF-MS/MS scan mode were modified parameters of TOF MS/MS CE (GPx3; 25 ± 10 V, SelP; 35 ± 10 V), precursor ion m/z (GPx3; 652.34, SelP; 867.13), TOF MS/MS m/z (between 200 and 1400) and accumulation time (TOF MS; 0.25 s, TOF MS/MS; 0.15 s) from IDA mode. The IDA-acquired data format was converted WIFF2 to mzML using ProteoWizard.²⁶⁾ A non-target proteomic analysis was performed for the converted data by ProteinPilot software (ver. 5.0.2.0, AB Sciex Pte. Ltd.), according to manufacturer’s recommended method.

LC-MS/MS

The elution samples and the synthetic peptides were analyzed on QTRAP4500 coupled to an ExionLC UHPLC system (AB Sciex Pte. Ltd.). The system was controlled by Analyst (ver. 1.6.3, AB Sciex Pte. Ltd.), and obtained data were analyzed by Sciex OS (ver.2.1, AB Sciex Pte. Ltd.). The samples were injected 2 µL and separated using 1.9 µm YMC-Triart C18 ExRS, 2.1 × 50 mm (YMC CO., LTD., Kyoto, Japan). The column temperature was maintained at 50 °C. Mobile phase A was ultra-pure water (18.2 MΩ × cm) with 0.1% (v/v) formic acid. Mobile phase B was 100% ACN with 0.1% (v/v) formic acid. The flow rate was 0.4 mL/min. Gradient conditions were 0–1 min 5% B, 1–9 min from 5% B to 40% B, 9–10 min 40% B to 100% B, and then washed with 100% B for 10 min and 5% B for 6 min, for a total of 26 min. The column eluate was connected to the QTRAP4500 coupled with ESI. The spray voltage was set at 5500 V and the ion source temperature at 450 °C. The target peptide information and MS parameters of multiple reaction monitoring (MRM) are listed in Table 1. The acquired chromatograms were analyzed using Sciex OS (ver.2.1, AB Sciex Pte. Ltd.).

Table 1. MRM Parameters for Fragment Peptides from SelP and GPx3

Target peptide	Precursor ion (m/z)	Product ion (m/z)		Declustering potential (V)		Collision energy (V)		Collision cell exit potential (V)
		Quantifier	Qualifier	Quantifier	Qualifier	Quantifier	Quantifier	Quantifier	Qualifier
SelP: LVYHLGLPYSFLTFPYVEEAIK	867.5	948.4	826.6	101		35	27	24	8
GPx3: YVRPGGGFVPNFQLFEK	652.3	511.9	467.3	66		25	23	8	12

Statistical Analysis

Values in the figures are expressed as the mean ± standard deviation (S.D.). Statistical analysis was carried out by a two-way ANOVA as well as a one-way ANOVA followed by a Tukey test and Pearson’s correlation coefficient test with Origin 9 (LightStone Corp., Tokyo, Japan). The P level was set at 0.05 or 0.01.

RESULTS

Hyperglycemia and Muscular Protein Expressions

To investigate the effect of treatment with HFD and SeMet on hyperglycemia and insulin resistance, NSY mice were given a HFD and 2 mgSe/L SeMet water for 12 weeks. OGTT after 10 weeks and ITT after 11 weeks resulted in a significant increase of blood glucose area under the curve (AUC) in the mice on a HFD (Fig. 1). However, there was no significant effect of supplementary SeMet on both blood glucose AUC of OGTT and ITT.

Fig. 1. Blood Glucose Area under the Curve in OGTT (A) and ITT (B) for NSY Mice on Supplementary SeMet and an HFD

OGTT and ITT were performed 10 and 11 weeks after switching to a HFD and SeMet water. Blood glucose levels are shown as AUC. Values are mean ± S.D. (n = 8, ** p < 0.01).

The results of PGC-1α and selenoprotein mRNA expressions in skeletal muscles are shown in Table 2. There was no significant increase in muscular protein mRNA expression by treatment of HFD or SeMet, except for GPx1, SelP and SelW, which were significantly augmented by HFD treatment. As shown in Fig. 2, the muscular SelP protein expression was significantly increased by supplementary SeMet or HFD ingestion in gastrocnemius and by supplementary SeMet in soleus. However, the significant increase in muscular GPx1 protein expression was observed only for the HFD and SeMet treatment (Fig. 3).

Table 2. PGC-1α and Selenoprotein mRNA Expressions in Skeletal Muscle

Muscle/Substance		Relative mRNA expression (/rps18)
	Group	ND		HFD
	SeMet	−	+	−	+
Gastrocnemius
PGC-1α		1.00 ± 0.37	1.24 ± 0.32	1.23 ± 0.41	1.03 ± 0.18
GPx1		1.00 ± 0.29	1.32 ± 0.20	1.52 ± 0.30*	1.44 ± 0.37
SelP		1.00 ± 0.31	1.28 ± 0.42	1.44 ± 0.22	1.08 ± 0.37
SelW		1.00 ± 0.50	1.31 ± 0.39	1.50 ± 0.57	1.17 ± 0.23
SelH		1.00 ± 0.41	1.33 ± 0.65	1.32 ± 0.39	1.23 ± 0.36
Soleus
PGC-1α		1.00 ± 0.64	1.05 ± 0.24	0.62 ± 0.26	0.68 ± 0.09
GPx1		1.00 ± 0.22	0.85 ± 0.35	1.62 ± 0.38**	1.28 ± 0.23†
SelP		1.00 ± 0.63	0.99 ± 0.48	2.11 ± 0.77*	2.57 ± 0.69††
SelW		1.00 ± 0.50	1.32 ± 0.20	2.13 ± 0.54**	2.05 ± 0.84
SelH		1.00 ± 0.21	1.00 ± 0.46	1.20 ± 0.47	1.17 ± 0.43

The data are shown as mean ± S.D. (n = 8). Two-way ANOVA: interaction between HFD and SeMet; p < 0.05 in the gastrocnemius SelP mRNA expression. Tukey test: * p < 0.05; ** p < 0.01 vs. ND −SeMet group. ^† p < 0.05; ^†† p < 0.01 vs. ND +SeMet group. ^## p < 0.01 vs. HFD −SeMet group.

Fig. 2. Effect of the HFD and SeMet Supplementation on SelP Protein Expression in the Gastrocnemius (A) and Soleus Muscles (B)

Protein expression values are normalized to β-actin. Values are mean ± S.D. (n = 8, * p < 0.05, ** p < 0.01).

Fig. 3. Effect of the HFD and SeMet Supplementation on GPx1 Protein Expression in the Gastrocnemius (A) and Soleus Muscles (B)

Protein expression values are normalized to β-actin. Values are mean ± S.D. (n = 8, * p < 0.05, ** p < 0.01).

Serum Selenoprotein Levels

To measure blood major selenoprotein levels that may be associated with the induction of insulin resistance, we developed an analysis method using LC-MS/MS. The distinct peptide fragments of SelP; LVYHLGLPYSFLTFPYVEEAIK and GPx3; YVRPGGGFVPNFQLFEK were the highest confidence and intensity among the detected peptide fragments in GPx3 and SelP, respectively, based on ProteinPilot software (Fig. 4). Using the sample digested and purified from NSY mouse serum, TOF-MS/MS spectra of the peptides were in close agreement with the synthetic standard peptides (Fig. 5) and then quantified by LC-MS/MS. As shown in Fig. 6 (A), the blood level of SelP was not dependent on the supplementary SeMet and significantly increased only by the treatment of HFD and SeMet. However, the blood level of GPx3 was dependent on the supplementary SeMet (Fig. 6 (B)). These results indicated that blood GPx3 is a preferable indicator of Se status than SelP. As shown in Figs. 6 (C) and (D), analysis of the correlation between the AUC of OGTT and selenoproteins showed that the respective correlation coefficients were r = 0.61769 for SelP and r = 0.19149 for GPx3. Meanwhile, the inverse correlations between the AUC of OGTT and both of SelP (r=−0.89554) and GPx3 (r=−0.87577) were observed in the HFD + SeMet treated group. These results suggest that blood SelP may be an indicator that reflects the early phase of the blood glucose rise, though the inverse correlation from only the restricted group should be interpreted carefully because of the small sample size.

Fig. 4. Q-TOF-MS/MS Fragmentation Spectra Annotation of SelP (A) and GPx3 (B) Digested Peptide Using ProteinPilot

The blue spectra are from trypsin digested samples, while the b and y ion designations indicate four of the fragments with higher intensities that match the theoretical values calculated for the fragments using ProteinPilot software.

Fig. 5. Comparison of Q-TOF-MS/MS Fragment Peaks between Synthetic and Sample-Digested Peptides on SelP (A) and GPx3 (B)

Spectra in the left panel were obtained from the MS/MS fragmentation of synthetic peptides and the right panel are from sample-digested peptides.

Fig. 6. Effect of the HFD and SeMet Supplementation on Serum Levels of SelP (A) and GPx3 (B)

Two-way ANOVA: interaction between HFD and SeMet; p < 0.01 for both SelP and GPx3 expression. Values are mean ± S.D. (n = 6–8, ** p < 0.01). Serum SelP (C) and GPx3 (D) were assessed for correlation with OGTT and r is shown in each figure. The plots in these figures are as follows: ND + tap water (■), ND + SeMet (●), HFD + tap water (▲) and HFD + SeMet (▼). The solid line represents the linear correlation for all plots (n = 30), while the single point line represents the linear correlation for the HFD + SeMet group (n = 8).

DISCUSSION

In our previous study, supplementary SeMet significantly augmented OGTT blood glucose levels in NSY mice on a HFD treatment.¹⁹⁾ This study investigated the effect of SeMet on hyperglycemia under the same experimental conditions. However, the blood glucose AUC resulted indicated that although SeMet tended to deteriorate insulin resistance by HFD treatment in ITT, there was no significant difference between HFD control and HFD + SeMet groups (Fig. 1B). The SeMet level in drinking water given to the mice was adjusted to the upper limit of the physiological range,²⁷⁾ by calculation based on normal diet Se content and dietary intake. Thus, the possibility for deterioration due to excess Se consumption should reflect normal conditions and may not be greatly exaggerated intake.

We also investigated the effects of HFD and SeMet on the expression of PGC-1α in skeletal muscles, which is an inducible transcriptional coactivator regulating mitochondrial biogenesis and cellular energy metabolism.²⁸⁾ However, there was no significant effect on PGC-1α mRNA expression and protein expression (Table 2) in gastrocnemius and soleus muscles by HFD treatment nor supplementary SeMet. Of the selenoproteins tested, there was no significant difference between the control and HFD and/or SeMet treatment groups in the protein expressions of selenoprotein W (data not shown) and mRNA expressions of selenoprotein W and selenoprotein H (Table 2), which are reported to be related with a redox motif found abundantly in skeletal muscle²⁹⁾ and the regulation of the mitochondrial biogenesis,³⁰⁾ respectively, except for the significant increase in the soleus of selenoprotein W mRNA expression with HFD ingestion. The increases in mRNA and protein expressions of GPx1 by SeMet were not remarkable, particularly in the soleus muscle, compared with that in the liver.¹⁹⁾ This inconsistency may be due to differences in the cellular level necessary for oxidative stress protection. However, SelP protein expressions in skeletal muscles were significantly augmented by HFD and SeMet treatment (Fig. 2), and this phenomenon was similar to that in the liver.¹⁹⁾ There was no significant difference in features between the gastrocnemius and soleus, which generally act as fast and slow contracting muscles, respectively.³¹⁾ These results may be due to both muscles having similar mitochondrial functions and respiration rates.³²⁾

SelP, a serum glycoprotein and Se source in other insulin target tissues, is primarily synthesized in liver and secreted into blood.²³⁾ This selenoprotein contains genetically multiple- and imperfect-encoded SeC residues and so may be produced in multiple isoforms, as truncated species, and post-translationally modified variants. This interferes with accurate quantification of blood SelP in ELISA kits and even in Western blotting, both of which are dependent on the availability of specific antibodies and primary standards, unless recombinant SelP becomes available.²¹⁾ In this study, we used the peptide fragments (22 amino acid residues; m/z 867.5) of the N-terminal region for the quantification of blood SelP with LC-MS/MS. As there is no SeC residue in this fragment region, this quantification is not affected by the multiple- and imperfect-SeC encoding, regardless of cleavage by plasma kallikrein. The analytical results suggest that an increase in SelP level of serum by HFD + SeMet (Fig. 6) relatively contributes to the augment of SelP expression in skeletal muscles by the same treatment, particularly in the gastrocnemius. The GPx3 level was dependent on supplementary SeMet regardless of HFD ingestion. However, it was difficult to evaluate the efficiency of tissue extraction or the efficiency of trypsin digestion of selenoproteins because the SeC-containing standard materials were not available in this study, which led to the limitation in the calculation of recovery rates. In addition, the complexity of peak annotation that caused by the presence of Se isotopic patterns made LC-MS/MS analysis difficult for the SeC-containing trypsin-digested peptides in selenoproteins. Therefore, an absolute quantification method for SeC-containing peptides suitable for all tissues should be developed in future study.

In conclusion, the HFD intake under the sufficient selenium status augmented the blood secretion of SelP, which may participate in the deterioration of insulin sensitivity of skeletal muscles as well as liver or adipose tissues and potentially correlate with early blood glucose rise. These findings suggest that SelP may be a better indicator for insulin resistance deterioration than GPx3, as it is a major selenoprotein in serum.

Acknowledgments

The authors thank Mr. Shunya Sado and Ms. Rio Kakuta at Setsunan University for technical assistance. The ProteinPilot analysis was performed with support from Dr. Naoto Tani (Department of Legal Medicine, Graduate School of Medicine, Osaka Metropolitan University) and Mr. Ushio Takeda (AB SCIEX). This research was supported in part by Grants-in-Aid for Scientific Research (KAKENHI 19K07073) from Japan Society for the Promotion of science.

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Prabhu KS, Lei XG. Selenium. Adv. Nutr., 7, 415–417 (2016).
• 2) Shi W, Su L, Wang J, Wang F, Liu X, Dou J. Correlation between dietary selenium intake and stroke in the National Health and Nutrition Examination Survey 2003–2018. Ann. Med., 54, 1395–1402 (2022).
• 3) Mustacich D, Powis G. Thioredoxin reductase. Biochem. J., 346 (Pt. 1), 1–8 (2000).
• 4) Margis R, Dunand C, Teixeira FK, Margis-Pinheiro M. Glutathione peroxidase family—an evolutionary overview. FEBS J., 275, 3959–3970 (2008).
• 5) Saito Y, Hayashi T, Tanaka A, Watanabe Y, Suzuki M, Saito E, Takahashi K. Selenoprotein P in human plasma as an extracellular phospholipid hydroperoxide glutathione peroxidase: isolation and enzymatic characterization of human selenoprotein P. J. Biol. Chem., 274, 2866–2871 (1999).
• 6) Ueno H, Kajihara H, Nakamura H, Yodoi J, Nakamuro K. Contribution of thioredoxin reductase to T-cell mitogenesis and NF-kappaB DNA-binding promoted by selenite. Antioxid. Redox Signal., 9, 115–121 (2007).
• 7) Ueno H, Kajihara H, Nakamura H, Okuno T, Sakazaki F, Arakawa T, Ogino H, Nakamuro K, Yodoi J. Effect of selenite on T-cell mitogenesis: contribution of ROS production and apoptosis signal-regulating kinase 1. Biol. Pharm. Bull., 37, 1352–1358 (2014).
• 8) Lubos E, Loscalzo J, Handy DE. Glutathione peroxidase-1 in health and disease: from molecular mechanisms to therapeutic opportunities. Antioxid. Redox Signal., 15, 1957–1997 (2011).
• 9) Hasan AA, Kalinina E, Tatarskiy V, Shtil A. The thioredoxin system of mammalian cells and its modulators. Biomedicines, 10, 1757 (2022).
• 10) World Health Organization. Definition, diagnosis and classification of diabetes mellitus and its complications: report of a WHO consultation. Part 1: Diagnosis and classification of diabetes mellitus. Report Number: WHO/NCD/NCS/99.2 (1999).
• 11) Zimmet P, Alberti KG, Shaw J. Global and societal implications of the diabetes epidemic. Nature, 414, 782–787 (2001).
• 12) Reaven GM. Banting lecture 1988: role of insulin resistance in human disease. Diabetes, 37, 1595–1607 (1988).
• 13) Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O, Makishima M, Matsuda M, Shimomura I. Increased oxidative stress in obesity and its impact on metabolic syndrome. J. Clin. Invest., 114, 1752–1761 (2004).
• 14) Hoarau E, Chandra V, Rustin P, Scharfmann R, Duvillie B. Pro-oxidant/antioxidant balance controls pancreatic β-cell differentiation through the ERK1/2 pathway. Cell Death Dis., 5, e1487 (2014).
• 15) Stancill JS, Broniowska KA, Oleson BJ, Naatz A, Corbett JA. Pancreatic β-cells detoxify H₂O₂ through the peroxiredoxin/thioredoxin antioxidant system. J. Biol. Chem., 294, 4843–4853 (2019).
• 16) Nakamura S, Takamura T, Matsuzawa-Nagata N, Takayama H, Misu H, Noda H, Nabemoto S, Kurita S, Ota T, Ando H, Miyamoto K, Kaneko S. Palmitate induces insulin resistance in H4IIEC3 hepatocytes through reactive oxygen species produced by mitochondria. J. Biol. Chem., 284, 14809–14818 (2009).
• 17) Wang XL, Yang TB, Wei J, Lei GH, Zeng C. Association between serum selenium level and type 2 diabetes mellitus: a non-linear dose-response meta-analysis of observational studies. Nutr. J., 15, 48 (2016).
• 18) Kyozuka H, Murata T, Fukuda T, Yamaguchi A, Kanno A, Yasuda S, Sato A, Ogata Y, Hosoya M, Yasumura S, Hashimoto K, Nishigori H, Fujimori K. Effect of preconception selenium intake on the risk for gestational diabetes: the Japan environment and children’s study. Antioxidants, 10, 568 (2021).
• 19) Murano K, Ogino H, Okuno T, Arakawa T, Ueno H. Role of supplementary selenium on the induction of insulin resistance and oxidative stress in NSY mice fed a high fat diet. Biol. Pharm. Bull., 41, 92–98 (2018).
• 20) Yu R, Wang Z, Ma M, Xu P, Liu L, Tinkov AA, Lei XG, Zhou JC. Associations between circulating SELENOP level and disorders of glucose and lipid metabolism: a meta-analysis. Antioxidants, 11, 1263 (2022).
• 21) Saito Y, Misu H, Takayama H, Takashima SI, Usui S, Takamura M, Kaneko S, Takamura T, Noguchi N. Comparison of human selenoprotein P determinants in serum between our original methods and commercially available kits. Biol. Pharm. Bull., 41, 828–832 (2018).
• 22) Janowska M, Potocka N, Paszek S, Skrzypa M, Żulewicz K, Kluz M, Januszek S, Baszuk P, Gronwald J, Lubiński J, Zawlik I, Kluz T. An assessment of GPX1 (rs1050450), DIO2 (rs225014) and SEPP1 (rs7579) gene polymorphisms in women with endometrial cancer. Genes (Basel), 13, 188 (2022).
• 23) Schomburg L, Selenoprotein P. Selenium transport protein, enzyme and biomarker of selenium status. Free Radic. Biol. Med., 191, 150–163 (2022).
• 24) Ueno H, Shimizu R, Okuno T, Ogino H, Arakawa T, Sakazaki F, Nakamuro K. Effects of administering sodium selenite, methylseleninic acid, and seleno-L-methionine on glucose tolerance in a streptozotocin/nicotinamide-induced diabetic mouse model. Biol. Pharm. Bull., 37, 1569–1574 (2014).
• 25) Wen X, Wu J, Chang JS, Zhang P, Wang J, Zhang Y, Gettys TW, Zhang Y. Effect of exercise intensity on isoform-specific expressions of NT-PGC-1 α mRNA in mouse skeletal muscle. BioMed Res. Int., 2014, 402175 (2014).
• 26) Chambers MC, MacLean B, Burke R, et al. Cross-platform toolkit for mass spectrometry and proteomics. Nat. Biotechnol., 30, 918–920 (2012).
• 27) Shimizu R, Ueno H, Okuno T, Sakazaki F, Nakamuro K. Effect of sodium selenite supplementation on glucose intolerance and pancreatic oxidative stress in type 2 diabetic mice under different selenium status. Journal of Health Science, 55, 271–280 (2009).
• 28) Kang C, Li Ji L. Role of PGC-1α signaling in skeletal muscle health and disease. Ann. N. Y. Acad. Sci., 1271, 110–117 (2012).
• 29) Shin MG, Cha HN, Park S, Kim YW, Kim JY, Park SY. Selenoprotein W deficiency does not affect oxidative stress and insulin sensitivity in the skeletal muscle of high-fat diet-fed obese mice. Am. J. Physiol. Cell Physiol., 317, C1172–C1182 (2019).
• 30) Ma YM, Guo YZ, Ibeanu G, Wang LY, Dong JD, Wang J, Jing L, Zhang JZ, Li PA. Overexpression of selenoprotein H prevents mitochondrial dynamic imbalance induced by glutamate exposure. Int. J. Biol. Sci., 13, 1458–1469 (2017).
• 31) Guillemin I, Becker M, Ociepka K, Friauf E, Nothwang HG. A subcellular prefractionation protocol for minute amounts of mammalian cell cultures and tissue. Proteomics, 5, 35–45 (2005).
• 32) Valentine JM, Li ME, Shoelson SE, Zhang N, Reddick RL, Musi N. NFκB regulates muscle development and mitochondrial function. J. Gerontol. A Biol. Sci. Med. Sci., 75, 647–653 (2020).