Detoxification and Activating Blood Circulation Decoction Promotes Reendothelialization of Damaged Blood Vessels via VEGF Signaling Pathway Activation by miRNA-126

Abstract

The occurrence of in-stent restenosis (ISR) poses a significant challenge for percutaneous coronary intervention (PCI). Thus, the promotion of vascular reendothelialization is essential to inhibit endothelial proliferation. In this study, we clarified the mechanism by which Detoxification and Activating Blood Circulation Decoction (DABCD) promotes vascular reendothelialization to avoid ISR by miRNA-126-mediated modulation of the vascular endothelial growth factor (VEGF) signaling pathway. A rat model of post-PCI restenosis was established by balloon injury. The injured aortic segment was collected 14 and 28 d after model establishment. Our findings indicate that on the 14th and 28th days following balloon injury, DABCD reduced intimal hyperplasia and inflammation and promoted vascular reendothelialization. Additionally, DABCD markedly increased nitric oxide (NO) expression and significantly decreased ET-1 production in rat serum. DABCD also increased the mRNA level of endothelial nitric oxide synthase (eNOS) and the protein expression of VEGF, p-Akt, and p-extracellular signal-regulated kinase (ERK)_1/2 in vascular tissue. Unexpectedly, the expression of miR-126a-5p mRNA was significantly lower in the aortic tissue of balloon-injured rats than in the aortic tissue of control rats, and higher miR-126a-5p levels were observed in the DABCD groups. The results of this study indicated that the vascular reendothelialization effect of DABCD on arterial intimal injury is associated with the inhibition of neointimal formation and the enhancement of vascular endothelial activity. More specifically, the effects of DABCD were mediated, at least in part, through miR-126-mediated VEGF signaling pathway activation.

INTRODUCTION

Percutaneous coronary intervention (PCI) is a primary clinical approach for managing coronary heart disease (CHD), enabling the rapid restoration of blood supply in CHD patients, reducing the incidence of cardiovascular adverse events, and enhancing patient QOL. However, a key bottleneck for PCI is in-stent restenosis (ISR).^1,2) The implantation of a stent can cause damage to the vascular intima and compromise the integrity of the vascular endothelium. While commonly used drug-eluting stents (DESs) inhibit the proliferation of vascular smooth muscle cells (VSMCs), they also hinder the regeneration of endothelial cells (ECs) and delay the process of vascular reendothelialization.^3,4) Once ECs are destroyed, there is a reduction in the synthesis of important vascular factors such as nitric oxide (NO), an increase in contraction-inducing factors such as ET-1, and the abnormal release of inflammatory mediators, including tumor necrosis factor-α (TNF-α), interleukin (IL)-1, and IL-6. These events further activate platelets, promote infiltration by inflammatory cells, and stimulate VSMCs to transition from a contractile to a synthetic state, leading to their proliferation and migration toward the inner membrane layer.⁵⁾ Additionally, damage to ECs can facilitate thrombus formation and vasoconstriction, ultimately resulting in endovascular restenosis. In conclusion, destruction and impaired function of ECs serve as initial triggers for restenosis; therefore, promoting effective repair and regeneration mechanisms after endovascular injury is crucial to inhibiting excessive intimal proliferation.

miRNA-126 is an endogenous noncoding small molecule RNA that exhibits specific expression within ECs and is closely associated with endothelial function. It plays a vital role in regulating various functions, such as cell proliferation, inflammation, and apoptosis, processes that are essential for maintaining proper vascular structure. In rabbit models, nanoparticles containing miRNA-126 bound to scaffolds significantly inhibited neointima formation, thereby preventing ISR.⁶⁾ In vitro studies involving human umbilical vein endothelial cells (HUVECs) have shown that miRNA-126 enhances the cell proliferation capacity and tube-forming ability via the SPRED-1/PIK3R2/Akt/ extracellular signal-regulated kinase (ERK)_1/2 pathway.⁷⁾ In atherosclerotic lesions, miRNA-126 regulates the migration responses of ECs to VEGF and fibroblast growth factor-2-induced migration. Additionally, apoptotic bodies released during endothelial apoptosis have been shown to contain miRNA-126, which attracts endothelial progenitor cells to the site and prevents arterial lesion development.^{8, 9)} Furthermore, miRNA-126 has an anti-inflammatory effect on ECs, as transfection with miRNA-126 oligonucleotides has been shown to inhibit the expression of vascular adhesion molecule 1 (VCAM-1) stimulated by TNF-α and prevent leukocyte adhesion to ECs.¹⁰⁾ Therefore, identifying a drug that can regulate the expression of miRNA-126 offers more options for improving endothelial function, promoting endometrial repair and reendothelialization, and preventing the occurrence and development of ISR.

Detoxification and activating blood circulation decoction (DABCD), derived from “SimiaoYong’an Decoction”, was first recorded in “Yanshu Xinbian” from the Qing Dynasty era China. According to traditional Chinese medicine (TCM) theory, DABCD has heat-clearing and detoxifying effects and promotes blood circulation and removes blood stasis. The author innovatively proposes that the TCM theory of “toxin stasis interjunction” aligns with inflammatory response mechanisms. Moreover, DABCD is a commonly used in-hospital prescription at the Affiliated Hospital of Jiangxi University of Chinese Medicine due to its safety and efficacy in preventing CHD and treating patients with CHD undergoing PCI procedures. Clinical studies have found that DABCD significantly reduces the incidence of cardiovascular events as well as aortic restenosis rates among patients with CHD who underwent PCI procedures while also improving clinical symptoms and QOL.¹¹⁾ Modern pharmacological studies have shown that the inhibitory effects of DABCD on intimal hyperplasia, VSMC proliferation-related inflammatory responses and cell cycle-related proteins in a rat aortic injury model are associated with the regulation of the toll-like receptor 4 (TLR4)/nuclear factor-kappaB (NF-κB) signaling pathway.¹²⁾ Additionally, promoting the reendothelialization of injured blood vessels plays a vital role in preventing the excessive proliferation of VSMCs and matrix deposition in the extracellular matrix (ECM).¹³⁾ The aim of this study was to assess the impact of DABCD on the reendothelialization of damaged blood vessels; the hypothesis was that the reendothelialization effect is closely linked to miRNA-126-mediated VEGF signaling pathway activation.

MATERIALS AND METHODS

Herb Preparation

DABCD consists of six herbs: Lonicera japonica Thunb., Scrophularia ningpoensis Hemsl., Angelica polymorpha Maxim., Glycyrrhizae Radix et Rhizoma, Salvia miltiorrhiza Bunge, and Panax notoginseng (http://www.theplantlist.org). All crude herbal components in DABCD were provided by the pharmacy department at the Affiliated Hospital of Jiangxi University of Chinese Medicine and authenticated as pure medicinal materials by senior pharmacists. The herbs were soaked in water for 30 min and decocted twice (1.5 h each time) using 10 and 8 times the volume of distilled water. The filtrate was combined after filtration and concentrated using a rotary evaporator before being autoclaved and stored at 4 °C for future use. The concentrations for the low, medium, and high doses of DABCD extract were 3.2, 6.4, and 9.6 g/mL, respectively. The extracted drugs were analyzed by mass spectrometry.

LC-Tandem Mass Spectrometry (LC-MS/MS) Analysis

The LC-MS/MS chromatography and MS conditions for DABCD were as follows: ACQUITY UPLC HSS T3 chromatographic column (2.1 × 100 mm, 1.8 µm, Waters, Milford, MA, U.S.A.); mobile phase, 0.1% formic acid-water (A) and 0.1% formic acid-acetonitrile (B); column temperature, 40 °C; flow rate, 0.3 mL/min; and sample size, 2 µL. The gradient elution conditions are shown in Table 1. The ion source was an electrospray ionization (ESI) source. Positive ion mode detection was used, as were the following conditions: ion transfer tube temperature, 320 °C; sheath gas flow rate, 35 arb; auxiliary gas flow rate, 10 arb; spray voltage, 3.5 kV (+); and heating temperature, 350 °C (+). The samples were scanned by primary mass spectrometry and secondary mass spectrometry. The primary mass spectrometry was full MS with a resolution of 70000 and a scanning range of 100–1500 m/z. Data-dependent two-stage scanning (dd-MS2) was adopted for the two-stage mass spectroscopy, with a resolution of 17500, cracking mode of high energy collision-induced dissociation (HCD), and normalized collision energies (NCEs) of 20, 40, and 60.

Table 1. Gradient Elution

Time (min)	0.1% Formic acid–water (%)	0.1% Formic acid–acetonitrile (%)
0	98	2
2	95	5
3	89	11
12	60	40
15	40	60
17	0	100
18	0	100
18.5	98	2
20	98	2

Chemicals and Reagents

Atorvastatin calcium tablets (specification 20 mg/tablet, Pfizer Pharmaceuticals Limited, H20051408) were made into a suspension with deionized distilled water. Anti-Akt (4691T) and anti-phosphorylated Akt (p-Akt) (13038T) antibodies were purchased from ABclonal (U.S.A.); anti-beta-actin antibody (Ab8226) was purchased from Abcam (U.S.A.); anti-ERK_1/2 (#4695) and anti-phosphorylated (p-ERK_1/2) antibodies (#4370) were purchased from CST (U.S.A.); the miRNA first-strand cDNA synthesis kit (stem loop method) (B532453) was purchased from Shanghai Shenggong Bioengineering Company; and anti-VEGF antibody (5220-0341) was provided by Proteintech (China). Standard compounds [Tanshinone I (MB6594), Ferulic Acid (MB6501), Liquiritin (MB6638), Ginsenoside Rb1(MB6881), Notoginsenoside R1(MB6856)] were purchased from Dalian Meilun Biotech Co., Ltd. (China).

Animal Model and Grouping

Male SD rats (300 ± 20 g) were purchased from Hunan Slack Jingda Laboratory Animal Co., Ltd. [License Number: SYXK (Xiang) (2015-0003)] were housed in the Animal Experiment Center of Yangming Campus, Jiangxi University of TCM. The housing conditions were as follows: relatively constant room temperature (20–24 °C) and humidity (58–62%). All experimental procedures and protocols were conducted after an ethical review by Jiangxi University of Chinese Medicine and in accordance with relevant national regulations and local guidelines.

A model of aortic endovascular injury in rats via balloon injury was established following a method previously used by our group.^12,14) Rats were anesthetized intraperitoneally with 2% pentobarbital sodium (50 mg/kg), and the middle of the neck was incised after full anesthesia. The left common carotid artery (approximately 2 cm) was located and separated, and the distal centrifugal artery was ligated. To prevent acute thrombosis, heparin sodium (100 U/kg) was injected into the tail vein 5 min before balloon injury. After occlusion of the proximal left common carotid artery with arterial forceps, a V-shaped incision was made between the ligation and forceps. A Runjin balloon catheter (2.0 × 15 mm) was inserted from the V-incision, guided by a guidewire. The balloon catheter was then carefully guided down through the aortic arch to the abdominal aorta to a depth of approximately 8 cm. A medical balloon dilatation pressure pump was used to inflate the balloon until resistance was felt when the catheter was pulled backward. Maintaining the same resistance, the catheter was pulled back into the aortic arch and then pushed forward to the position where the balloon inside the abdominal aorta was inflated. This process was repeated 4 times. The catheter was then rotated 180 degrees, and the process was repeated four times to ensure adequate wear of the vascular endothelium. After removal of the catheter from the artery, the common carotid artery was ligated proximally to stop bleeding.

Seventy-two rats were randomly divided into 6 groups (n = 12 rats in each group): (i) sham group (Sham), (ii) model group (Model), (iii) DABCD low-dose group (DABCD-L), (iv) DABCD medium-dose group (DABCD-M), (v) DABCD high-dose group (DABCD-H), and (vi) atorvastatin calcium group (Statin). Gastric gavage was performed on the first postoperative day. The Statin group was administered atorvastatin calcium tablets after aortic balloon injury. At 14 and 28 d after surgery, the aortic injury segment was harvested, and plasma samples were collected and centrifuged at 4 °C and 3500 r/min for 15 min, after which the supernatant was retained and stored at −80 °C.

Vascular Morphological Analysis

Injured thoracic aorta was collected on day 14 and day 28 postsurgery. The collected aortic tissue was fixed, washed, dehydrated, cleared, permeated with wax, and embedded, a process completed over 24 h. Subsequently, the embedded tissue was sliced into 5-µm sections. Three samples were randomly selected at each time point for hematoxylin–eosin (H&E) staining. Pathological changes in blood vessels were observed.

Endothelial Cell CD31 Immunofluorescence Staining

The injured vascular tissue of the thoracic aorta was embedded in paraffin and sectioned. Three sections were randomly selected for each time point, and each section was incubated with primary antibody (anti-CD31; 1 : 500) overnight at 4 °C. Then, the sections were incubated with the corresponding secondary antibody at 37 °C for 1 h, washed with PBS, and photographed under a confocal microscope.

Determination of Endothelial Active Factors in Serum

NO (catalog number: 20220720) and ET-1 (catalog number: 20220418) levels were measured using enzyme-linked immunosorbent assay (ELISA) kits (Nanjing Jiancheng Bioengineering Co., Ltd., China) according to the instructions.

Vascular Tissue eNOS and miRNA126a-5p Gene Expression Levels

To assess miRNA or mRNA levels, quantitative real-time PCR (qRT-PCR) was employed. Total RNA from rat vascular tissue was extracted using the TRIzol method followed by reverse transcription into cDNA as per the kit instructions. The experimental process was conducted in accordance with the standard operating procedures of the kit instructions. 2-(A-B) reflects the expression level relative to the target control group, where A = CT (target gene, sample)-CT (internal standard gene, sample), and B = CT (target gene, control sample)-CT (internal standard gene, control sample). qRT-PCR was conducted three times for each sample before statistical analysis. The primer pairs used were synthesized by Shenggong Biotechnology Co., Ltd. (Shanghai, China). The gene names and primer sequences are provided in Table 2.

Table 2. The Gene Names and Primers Sequences

Gene name	Primer name	Primer sequence (5′–3′)
β-Actin	Rat-β-actin F	GCCATGTACGTAGCCATCCA
	Rat-β-actin R	GAACCGCTCATTGCCGATAG
eNOS	eNOS_F	TACTCCAGGCTCCCGATG
	eNOS_R	AAGGGCAGCAAACCACTC
U6	rno-U6-F	ATTGGAACGATACAGAGAAGATT
	rno-U6-R	GGAACGCTTCACGAATTTG
miR-126a-5p	rno-miR-126a-5p-sl	GTCGTATCCAGTGCAGGGTCCGAGGT
		ATTCGCACTGGATACGACCGCGTA
	rno-miR-126a-5p-F	GCGCGCATTATTACTTTTGG
	rno-miR-126a-5p-R	AGTGCAGGGTCCGAGGTATT

Western Blot Analysis

Western blotting was used to assess VEGF, Akt, p-Akt, ERK_1/2, and p-ERK_1/2 protein expression in vascular tissues. Total protein was extracted from vascular tissue with RIPA lysis buffer. Proteins were separated by electrophoresis and then transferred onto polyvinylidene difluoride (PVDF) membranes. The membranes were incubated with primary antibodies overnight at 4 °C followed by corresponding secondary antibodies for 1 h. Gray values of protein bands were analyzed via ImageJ software.

Statistical Analysis

All data are expressed as the mean ± standard deviation and were analyzed with SPSS 18. Comparisons between groups were performed by one-way ANOVA, and Fisher’s least significant difference (LSD) test was used for a comparison between each group. p < 0.05 was considered statistically significant.

RESULTS

LC-MS/MS Analysis of DABCD

We verified the active ingredients using Chinese medicinal standard compounds. The peaks for tanshinone I, ferulic acid, liquiritin, ginsenoside Rb1, notoginsenoside R1 were compared with their respective standard compounds. The LC-MS/MS experiments of standard chemicals successfully identified these five compounds (Supplementary Fig. 1).

Effect of DABCD on the Morphology of Arterial Vessels

To investigate the reendothelialization effect of DABCD on ISR, we established a rat model of aortic injury and used atorvastatin as a positive control drug. We assessed the disease status of rats 14 and 28 d after initiating the oral administration of DABCD. The H&E staining results indicated that the aortic structure in the sham group remained largely intact, with no discernible signs of inflammatory infiltration on the 14th and 28th days after balloon injury. Conversely, the model group exhibited notable thickening of the vascular intima, disarrayed smooth muscle cells, and evident inflammatory infiltration. Compared to the model group, the DABCD groups and atorvastatin group exhibited reduced proliferation and inflammation in the aorta (Fig. 1).

Fig. 1. Thoracic Aortic Vascular Pathological Changes (n = 6)

(A) Comparison of the vascular morphology in rats on day 14 after balloon injury. Scale bar = 200 µm, magnification: 100×. (B) Comparison of the vascular morphology in rats on day 28 after balloon injury, Scale bar = 50 µm, magnification: × 200.

DABCD Promotes Vascular Reendothelialization

CD31 immunofluorescence staining revealed CD31-positive cells on the vascular lumen surface, indicating the presence of endothelialized vascular lumens. The findings of this study indicated a clear increase in lumen endothelialization in the sham group, with ECs being adequately covered. However, following balloon injury, the model group exhibited a substantial decrease in the degree of endothelialization, which was notably ameliorated after DABCD and atorvastatin treatment, particularly at 28 d after injury, as evidenced by improved vascular reendothelialization (Fig. 2).

Fig. 2 The Effect of DABCD on Vascular Reendothelialization in Rats on Day 14 and Day 28 after Balloon Injury Was Detected by CD31 Immunofluorescence Staining (n = 6)

Scale bar = 25 µm, Magnification: × 400 & Scale bar = 50 µm, Magnification: ×200.

To further substantiate the impact of DABCD on vascular endothelial function, the levels of NO and ET-1 in serum were quantified using ELISA. The findings indicated that at both 14 d and 28 d following balloon injury, there was a significant decrease in NO levels and a notable increase in ET-1 levels in the model group compared with the sham group. However, after the administration of DABCD and atorvastatin, the levels of NO and ET-1 were restored, suggesting that these treatments potentially enhance vascular endothelial function in balloon-injured rats by modulating the levels of NO and ET-1 (Figs. 3A–D).

Fig. 3. Effect of DABCD on the Levels of ET-1 and NO in Serum and eNOS mRNA Levels in Vascular Tissues

(A–D) Levels of NO and ET-1 were measured by ELISA. (E, F) eNOS mRNA levels were measured by qRT-PCR. * p < 0.05, ** p < 0.01, *** p < 0.001.

Furthermore, there was a substantial reduction in the expression of eNOS mRNA in vascular tissue in the model group, and the expression of eNOS mRNA was significantly higher in the DABCD groups and atorvastatin group than in the model group (Figs. 3E, F).

Effect of DABCD on Akt, p-Akt, ERK_1/2, and p-ERK_1/2 Proteins in Vascular Tissue

Additionally, we examined the levels of Akt, p-Akt, ERK_1/2 and p-ERK_1/2 protein in vascular tissue to explore the potential mechanism by which DABCD promotes damaged vascular reendothelialization. As shown in Figs. 4A–C, p-Akt protein levels were notably higher in the DABCD groups and atorvastatin group than in the model group. As shown in Figs. 4D–F, the administration of DABCD and atorvastatin resulted in an increase in p-ERK_1/2 levels after 14 d; however, these increases were not statistically significant. After 28 d of administration, compared to the model group, in the high-dose DABCD group and atorvastatin group, there was a significant upward trend in p-ERK_1/2 protein expression. This finding suggests that the duration of DABCD administration is closely associated with an increase in p-ERK_1/2 protein levels.

Fig. 4. The Effect of DABCD on the Levels of Phosphorylated Akt and ERK_1/2 Protein in Vascular Tissues Was Assessed by Western Blot

* p < 0.05, ** p < 0.01, *** p < 0.001.

DABCD Promotes Vascular Reendothelialization via miR-126a-5p-Mediated Activation of the VEGF Signaling Pathway

Western blotting was employed to assess the expression of VEGF in vascular tissues. The findings indicated that the expression of VEGF protein was significantly lower in the model group than in the sham group. Notably, compared with the model group, the DABCD groups exhibited varying degrees of increased VEGF protein levels, with statistically significant differences observed for the medium- and high-dose groups and the atorvastatin group at 28 d after injury (Figs. 5A–C).

Fig. 5. The Effect of DABCD on VEGF Protein and miRNA-126a-5p in Vascular Tissue Was Investigated

* p < 0.05, ** p < 0.01, *** p < 0.001.

The findings of this study indicated a significant decrease in the expression of VEGF protein in the model group compared to the sham group. Notably, compared with the model group, the DABCD groups exhibited varying degrees of increased VEGF protein levels, with statistically significant differences observed in the medium- and high-dose groups and the atorvastatin group at 28 d after injury. At both 14 and 28 d after injury, there was a notable decrease in the expression of miRNA-126a-5p in the model group, as determined by qRT-PCR. However, following treatment with DABCD and atorvastatin, there was a significant increase in miRNA-126a-5p expression in the DABCD groups and atorvastatin group, particularly at 28 d after injury (Figs. 5D–E). These findings suggest a close association between the promotion of vascular reendothelialization by DABCD and the involvement of miR-126a-5p and VEGF, with a similar effect observed to that of atorvastatin.

DISCUSSION

In this study, we demonstrated that DABCD effectively mitigates endothelial cell (EC) damage in the thoracic aorta induced by balloon injury, promotes vascular reendothelialization, and prevents ISR. Further investigations suggested that the effect of DABCD on vascular reendothelialization may be mediated through the VEGF signaling pathway, which is regulated by miRNA-126.

ISR remains a major limitation in the development of PCI.^15,16) The occurrence of ISR involves multiple pathophysiological mechanisms, including vascular EC injury, inflammatory processes, and VSMC proliferation and migration.³⁾ In our previous study, we investigated the mechanism of inflammation and the impact of smooth muscle proliferation and migration on ISR. Building upon that research foundation, in this study, we further explored the role of the vascular EC damage mechanism in ISR. Vascular ECs are single-layered flat cells that line the inner surface of blood vessels and release various endocrine substances to inhibit the activation, migration, and proliferation of smooth muscle cells while preventing their participation in neointima formation and ISR. This regulatory function is vital for maintaining vascular homeostasis.¹⁷⁾ Stent implantation inevitably disrupts EC integrity and function; therefore, promoting reendothelialization is crucial for preventing and treating ISR.

The experimental results demonstrated that rats in the model group had significantly thickened inner vessel walls, with lipid deposition, foam-like cell degeneration, inflammatory infiltration, and reduced luminal area; however, this effect was significantly attenuated by treatment with DABCD and atorvastatin, suggesting that DABCD had a notable protective effect on disrupted endothelial function. The results from CD31 immunofluorescence staining indicated that both DABCD and atorvastatin promoted the reendothelialization process and had a certain repair effect on balloon-injured vascular endothelium.

Nitric oxide (NO) is a crucial endothelium-derived relaxation factor that plays a significant role in regulating various endothelial functions, including vasodilation, cell proliferation, aging, and apoptosis. It also has diverse biological effects, such as inhibiting platelet aggregation, monocyte adhesion, and VSMC proliferation.¹⁸⁾ In this study, we observed a significant decrease in the expression level of NO in the serum of rats in the model group, indicating that aortic balloon injury caused significant damage to the vascular endothelium of rats. This finding verifies that endothelial function is one of the main mechanisms affecting vascular recovery after PCI. Furthermore, our results demonstrated that DABCD and atorvastatin can promote NO expression and restore vascular endothelial function. NO is synthesized from L-arginine by eNOS in ECs, and its regulation involves the phosphatidylinositol 3-kinase (PI3K)/protein kinase B (Akt)/eNOS cascade;¹⁹⁾ Akt is primarily activated through the upstream regulation of PI3K, and Akt phosphorylation indirectly reflects PI3K activity levels, which are crucial for cell proliferation and survival. Our findings show that DABCD and atorvastatin significantly increased the expression of p-Akt/Akt protein and eNOS mRNA in vascular tissues. Additionally, in this study, we examined ET-1, a potent endogenous vasoconstrictor primarily secreted by ECs, and its upstream pathway, mitogen-activated protein kinase (MAPK)/ERK_1/2. Previous research has demonstrated a correlation between elevated levels of ET-1 following PCI in patients with coronary CHD and the occurrence of ISR. Consequently, the measurement of ET-1 levels can serve as a valuable tool in assessing the risk of ISR.²⁰⁾ Sun et al. revealed that the inhibition of miR-29b can enhance the phosphorylation of ERK_1/2, reduce the serum ET-1 concentration, and impede vascular endothelial dysfunction and endothelial apoptosis.^21,22) The findings of our study indicate that the expression of ET-1 was significantly higher in the model group than in the sham group and that the p-ERK_1/2 protein level was significantly lower. However, the trends for these indicators were significantly reversed following intervention with DABCD and atorvastatin. These results suggest that in balloon-injured rats treated with DABCD, the MAPK/ERK_1/2 and PI3K/Akt signaling pathways play crucial roles in promoting reendothelialization and repairing vascular injury.

Furthermore, we investigated the role of VEGF, an upstream factor of MAPK/ERK_1/2 and PI3K/Akt. VEGF is a potent angiogenic factor. Our investigation delved deeper into the role of VEGF, a crucial upstream factor in the MAPK/ERK_1/2 and PI3K/Akt pathways. VEGF, renowned for its potent angiogenic properties, acts as a signaling protein that stimulates the growth of VECs and facilitates vascular regeneration. In the context of PCI, VEGF has been employed to expedite the repair of ECs and prevent the occurrence of intimal hyperplasia.^23–25) Extensive research has demonstrated that VEGF regulates the proliferation, migration, and angiogenesis of VECs by activating the MAPK/ERK_1/2 and PI3K/Akt signaling pathways.^26–29)

Quantitative analyses of gene expression revealed an increase in the expression of vegfr2 (kdr and kdrl) and vegfr1 in human umbilical vein ECs following the administration of Guanxinning Tablet (Salvia miltiorrhiza and Ligusticum stratum).³⁰⁾ Another study demonstrated that Buyang Huanwu Decoction, known for its blood-activating properties, enhanced the expression of VEGF, VEGFR2, and p-ERK in the infarct boundary area after acute myocardial infarction. This promotion of angiogenesis ultimately leads to vascular reendothelialization.³¹⁾ In this study, we found that the expression of VEGF was significantly reduced in the vascular tissues of rats following balloon injury; however, intervention with DABCD and atorvastatin resulted in a significant increase in VEGF protein expression. This finding suggests that DABCD may contribute to the alleviation of endothelial cell injury and the promotion of vascular reendothelialization, potentially through the regulation of the VEGF signaling pathway.

Additionally, miR-126, a physiological factor inherent to ECs, has been identified as a promoter of endothelial cell proliferation and migration, intimal repair and angiogenesis. Our results showed that the expression of miRNA-126 in the vascular tissue of rats with ISR was significantly lower than that in the sham group. This suggests that miR-126 plays a crucial role in facilitating the mechanism of reendothelialization in injured blood vessels.

Various TCM ingredients have been found to modulate the expression of miR-126. For instance, Danhong Injection (Salvia miltiorrhiza and Carthamus tinctorius) has been shown to promote angiogenesis and improve myocardial infarction through its regulation of the miR-126/ERK signaling pathway. Similarly, emodin enhances the expression of the miR-126 gene, which is associated with arterial injury, by mediating the Wnt4/Dvl-1/β-catenin signaling pathway in the carotid artery of balloon-injured rats, thereby preventing endometrial thickening.³²⁾ Additionally, paeonol has been shown to promote miR-126 expression at both the mRNA and protein levels while also inhibiting VCAM-1 expression. Furthermore, paeonol has been shown to inhibit the adhesion of monocytes to ox-LDL-damaged VECs by promoting miR-126 expression.¹⁰⁾ In a similar vein, in our study, the miR-126a-5p level was significantly higher in the DABCD group than in the model group, suggesting that DABCD facilitated endothelial cell proliferation and intimal repair through the regulation of miR-126. Previous research has indicated that miR-126 primarily promotes vascular repair and neovascularization by positively modulating VEGF expression. Additionally, a separate investigation found that Yiqi-Huoxue granule enhanced the expression of miR-126, consequently upregulating VEGF and the phosphorylation of PI3K/Akt; however, the inhibitory effect of a miR-126 inhibitor hindered the aforementioned impact.³³⁾ miR-126 positively regulates the expression of VEGF, p-Akt, and eNOS proteins, and inhibitors of these proteins block miR-126-induced chemokine receptor 4 (CXCR4) expression and reduce the migration of late-growth EPCs (LOCs).³⁴⁾ Based on the aforementioned experimental findings, it can be inferred that DABCD facilitates the reendothelialization of damaged blood vessels and that the positive regulation of the miR-126-mediated VEGF signaling pathway may serve as a mechanism by which DABCD prevents and treats ISR after PCI.

This study provides evidence for the reendothelialization effect of DABCD in promoting the proliferation and migration of vascular ECs in a rat model of aortic injury. The underlying mechanisms appear to involve the enhancement of the miR-126a-5p-mediated VEGF pathway through the activation of the PI3K/Akt and MAPK/ERK_1/2 signaling pathways. Furthermore, the mechanism of action of DABCD is comparable to that of atorvastatin, suggesting that further investigation and promotion of the application of DABCD for the treatment of patients with ISR after clinical PCI is warranted.

Acknowledgments

This work was supported by Grants from the National Natural Science Foundation of China (81960854, 82260911, 82004268), the Natural Science Foundation of Jiangxi Province (20192BAB205099, 20202BAB206070), the Science and Technology Plan Project of Jiangxi Provincial Health Commission (20204420, SKJP-220210188, 2022B516), Postdoctoral research project of Guangdong Provincial Hospital of Chinese medicine (10814), China Postdoctoral Science Foundation funded project (2023M730810), the 2020 Guangdong Provincial Science and Technology Innovation Strategy Special Fund (Guangdong-Hong Kong-Macau Joint Lab) (2020B1212030006).

Author Contributions

Guohui Zou, Xiaoyan Huang: Conceptualization, Funding acquisition, Project administration, Supervision. Zhiming Liu, Guangmei Xie, Zuwei Li, Hanbin Luo: Conceptualization, Writing—original draft, Writing—review & editing, Resources. Jianhong Zhou, Jie Cheng, Xiaolin Wang: Data curation, Software, Methodology.

Conflict of Interest

The authors declare no conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Lawton JS, Tamis-Holland JE, Bangalore S, et al. 2021 ACC/AHA/SCAI guideline for coronary artery revascularization: executive summary: a report of the American College of Cardiology/American Heart Association Joint Committee on clinical practice guidelines. J. Am. Coll. Cardiol., 79, 197–215 (2022).
• 2) Esposito G, Barbato E, Bartunek J. Burden of in-stent restenosis: shall we overcome? Circ. Cardiovasc. Interv., 14, e011292 (2021).
• 3) Yang X, Yang Y, Guo J, Meng Y, Li M, Yang P, Liu X, Aung LHH, Yu T, Li Y. Targeting the epigenome in in-stent restenosis: from mechanisms to therapy. Mol. Ther. Nucleic Acids, 23, 1136–1160 (2021).
• 4) Liu W, Huang J, He S, Du R, Shi W, Wang Y, Du D, Du Y, Liu Q, Wang Y, Wang G, Yin T. Senescent endothelial cells’ response to the degradation of bioresorbable scaffold induces intimal dysfunction accelerating in-stent restenosis. Acta Biomater., 166, 266–277 (2023).
• 5) Méndez-Barbero N, Gutierrez-Munoz C, Blanco-Colio LM. Cellular crosstalk between endothelial and smooth muscle cells in vascular wall remodeling. Int. J. Mol. Sci., 22, 7284 (2021).
• 6) Izuhara M, Kuwabara Y, Saito N, Yamamoto E, Hakuno D, Nakashima Y, Horie T, Baba O, Nishiga M, Nakao T, Nishino T, Nakazeki F, Ide Y, Kimura M, Kimura T, Ono K. Prevention of neointimal formation using miRNA-126-containing nanoparticle-conjugated stents in a rabbit model. PLOS ONE, 12, e0172798 (2017).
• 7) Qu Q, Wang L, Bing W, Bi Y, Zhang C, Jing X, Liu L. miRNA-126-3p carried by human umbilical cord mesenchymal stem cell enhances endothelial function through exosome-mediated mechanisms in vitro and attenuates vein graft neointimal formation in vivo. Stem Cell Res. Ther., 11, 464 (2020).
• 8) Lew JK, Pearson JT, Saw E, Tsuchimochi H, Wei M, Ghosh N, Du CK, Zhan DY, Jin M, Umetani K, Shirai M, Katare R, Schwenke DO. Exercise regulates microRNAs to preserve coronary and cardiac function in the diabetic heart. Circ. Res., 127, 1384–1400 (2020).
• 9) Ahmed YM, Orfali R, Abdelwahab NS, Hassan HM, Rateb ME, AboulMagd AM. Partial synthetic PPARY derivative ameliorates aorta injury in experimental diabetic rats mediated by activation of miR-126-5p Pi3k/AKT/PDK 1/mTOR expression. Pharmaceuticals (Basel), 15, 1175 (2022).
• 10) Yuan X, Chen J, Dai M. Paeonol promotes microRNA-126 expression to inhibit monocyte adhesion to ox-LDL-injured vascular endothelial cells and block the activation of the PI3K/Akt/NF-kappaB pathway. Int. J. Mol. Med., 38, 1871–1878 (2016).
• 11) Zou G, Huang X, Tang N, Liu Z. Effects of Jiedu Huoxue Recipe on the changes of NF-, IL-1, B, TNF- and restenosis in patients with coronary artery disease after percutaneous coronary intervention. J. Guangzhou Univ. Chin. Med., 34, 1–5 (2017).
• 12) Zou G, Zhu J, Liu Z, Wu L, Xu R, Chen H, Deng P, Deng C. Detoxification and activating blood circulation decoction reduces restenosis involving the TLR4/NF-kappaB pathway after balloon injury. Prostaglandins Other Lipid Mediat., 140, 1–8 (2019).
• 13) Xu K, Al-Ani MK, Wang C, Qiu X, Chi Q, Zhu P, Dong N. Emodin as a selective proliferative inhibitor of vascular smooth muscle cells versus endothelial cells suppress arterial intima formation. Life Sci., 207, 9–14 (2018).
• 14) Li L, Gao Y, Liu Z, Dong C, Wang W, Wu K, Gu S, Zhou Y. GDF11 alleviates neointimal hyperplasia in a rat model of artery injury by regulating endothelial NLRP3 inflammasome activation and rapid re-endothelialization. J. Transl. Med., 20, 28 (2022).
• 15) Lansky A, Grubman D, Scheller B. Paclitaxel-coated balloons: a safe alternative to drug-eluting stents for coronary in-stent restenosis. Eur. Heart J., 41, 3729–3731 (2020).
• 16) Moussa ID, Mohananey D, Saucedo J, Stone GW, Yeh RW, Kennedy KF, Waksman R, Teirstein P, Moses JW, Simonton C. Trends and outcomes of restenosis after coronary stent implantation in the United States. J. Am. Coll. Cardiol., 76, 1521–1531 (2020).
• 17) Wang X, Fang F, Ni Y, Yu H, Ma J, Deng L, Li C, Shen Y, Liu X. The combined contribution of vascular endothelial cell migration and adhesion to stent re-endothelialization. Front. Cell Dev. Biol., 9, 641382 (2021).
• 18) Cyr AR, Huckaby LV, Shiva SS, Zuckerbraun BS. Nitric Oxide and Endothelial Dysfunction. Crit. Care Clin., 36, 307–321 (2020).
• 19) Chen JF, Liu F, Qiao MM, Shu HZ, Li XC, Peng C, Xiong L. Vasorelaxant effect of curcubisabolanin A isolated from Curcuma longa through the PI3K/Akt/eNOS signaling pathway. J. Ethnopharmacol., 294, 115332 (2022).
• 20) Ma Y, Tian T, Wang T, Wang J, Guan H, Yuan J, Song L, Yang W, Qiao S. Predictive value of plasma big endothelin-1 in adverse events of patients with coronary artery restenosis and diabetes mellitus: beyond traditional and angiographic risk factors. Front. Cardiovasc. Med., 9, 854107 (2022).
• 21) Chi L, Hu X, Zhang W, Bai T, Zhang L, Zeng H, Guo R, Zhang Y, Tian H. Adipokine CTRP6 improves PPARgamma activation to alleviate angiotensin II-induced hypertension and vascular endothelial dysfunction in spontaneously hypertensive rats. Biochem. Biophys. Res. Commun., 482, 727–734 (2017).
• 22) Sun L, Zhang J, Li Y. Chronic central miR-29b antagonism alleviates angiotensin II-induced hypertension and vascular endothelial dysfunction. Life Sci., 235, 116862 (2019).
• 23) Hutter R, Carrick FE, Valdiviezo C, Wolinsky C, Rudge JS, Wiegand SJ, Fuster V, Badimon JJ, Sauter BV. Vascular endothelial growth factor regulates reendothelialization and neointima formation in a mouse model of arterial injury. Circulation, 110, 2430–2435 (2004).
• 24) Wang XB, Qu TT, Sun CF, Wang MY. Bisdemethoxycurcumin inhibits VEGF-induced HUVECs proliferation, migration and invasion through AMPK/mTOR pathway-dependent autophagy activation and cell cycle arrest. Biol. Pharm. Bull., 45, 1276–1282 (2022).
• 25) Yamashita T, Tsutsumi R, Nagano K. Extracellular vesicles derived from the serum of Seriola quinqueradiata induce human umbilical vein endothelial cell proliferation through angiogenic signaling. Biol. Pharm. Bull., 46, 1643–1646 (2023).
• 26) Song M, Finley SD. ERK and Akt exhibit distinct signaling responses following stimulation by pro-angiogenic factors. Cell Commun. Signal., 18, 114 (2020).
• 27) Chin HK, Horng CT, Liu YS, Lu CC, Su CY, Chen PS, Chiu HY, Tsai FJ, Shieh PC, Yang JS. Kaempferol inhibits angiogenic ability by targeting VEGF receptor-2 and downregulating the PI3K/AKT, MEK and ERK pathways in VEGF-stimulated human umbilical vein endothelial cells. Oncol. Rep., 39, 2351–2357 (2018).
• 28) Geng K, Wang J, Liu P, Tian X, Liu H, Wang X, Hu C, Yan H. Electrical stimulation facilitates the angiogenesis of human umbilical vein endothelial cells through MAPK/ERK signaling pathway by stimulating FGF2 secretion. Am. J. Physiol. Cell Physiol., 317, C277–C286 (2019).
• 29) Gomes AM, Pinto TS, da Costa Fernandes CJ, da Silva RA, Zambuzzi WF. Wortmannin targeting phosphatidylinositol 3-kinase suppresses angiogenic factors in shear-stressed endothelial cells. J. Cell. Physiol., 235, 5256–5269 (2020).
• 30) Chen J, Wang Y, Wang S, Zhao X, Zhao L, Wang Y. Salvianolic acid B and ferulic acid synergistically promote angiogenesis in HUVECs and zebrafish via regulating VEGF signaling. J. Ethnopharmacol., 283, 114667 (2022).
• 31) Zhu J-Z, Bao X-Y, Zheng Q, Tong Q, Zhu P-C, Zhuang Z, Wang Y. Buyang Huanwu decoction exerts cardioprotective effects through targeting angiogenesis via caveolin-1/VEGF signaling pathway in mice with acute myocardial infarction. Oxid. Med. Cell. Longev., 2019, 4275984 (2019).
• 32) Hua JY, He YZ, Xu Y, Jiang XH, Ye W, Pan ZM. Emodin prevents intima thickness via Wnt4/Dvl-1/beta-catenin signaling pathway mediated by miR-126 in balloon-injured carotid artery rats. Exp. Mol. Med., 47, e170 (2015).
• 33) Gao H, Peng C, Wu L, Gao S, Wang Z, Dai L, Wu H. Yiqi-Huoxue granule promotes angiogenesis of ischemic myocardium through miR-126/PI3K/Akt axis in endothelial cells. Phytomedicine, 92, 153713 (2021).
• 34) Pei CZ, Liu B, Li YT, Fang L, Zhang Y, Li YG, Meng S. MicroRNA-126 protects against vascular injury by promoting homing and maintaining stemness of late outgrowth endothelial progenitor cells. Stem Cell Res. Ther., 11, 28 (2020).