Sphingolipid-Enriched Porcine Placental Extract Promotes the Expression of Structural Genes and Desquamation Enzyme Genes in Cultured Human Keratinocytes

Abstract

Porcine placental extract (PPE) is commonly used in various health foods and cosmetics. PPE use in cosmetics predominantly consist of the water-soluble fraction derived from the entire placenta. In this report, we examined the effect of the hydrophobic constituents of the PPE, specifically the sphingolipid-enriched fraction designated as the sphingolipid-enriched porcine placental extract (SLPPE), on the expression of genes associated with skin function in cultured normal human epidermal keratinocytes. Using quantitative RT-PCR (qRT-PCR) analysis, we found that SLPPE concentrations ranging from 25 to 100 µg/mL upregulated the gene expression of key components associated with the cornified envelope structure (filaggrin (FLG), involucrin (IVL) and loricrin (LOR)), cornification enzymes (transglutaminase 1 (TGM1) and TGM5) and the desquamation enzymes (kallikrein 5 (KLK5) and KLK7). Additionally, KLK5p and FLG protein (FLGp) were detected in the culture supernatants of keratinocytes treated with SLPPE at these concentrations. These findings suggest that SLPPE is possible to promote the cornification and desquamation in epidermal keratinocytes, and it may offer potential benefits in cosmetics.

INTRODUCTION

The placental extract (PE) has been used in traditional medicines and is reported to possess various medicinal effects. In Japan, human PE has been used for treating chronic hepatitis and climacteric symptoms, whereas porcine placental extract (PPE) has been used as a dietary supplement for nutrients and tonics.^1,2) Recently, PPE has gained widespread use in various health foods and cosmetics.^3–7) Most PEs used in the cosmetic industry are water-soluble, and their beneficial effects have been studied extensively.^8–11) In previous research, we demonstrated that PPE promotes the proliferation of skin fibroblasts and cultured bone marrow cells and suppresses the production of inflammatory cytokines by the RAW 264.1 murine macrophage cell line co-stimulated with lipopolysaccharide.^12–14) Although the water-insoluble portion of both porcine and bovine placental extracts is also listed in the Japanese Standards of Quasi-drug Ingredients,¹⁵⁾ the beneficial effects of these extracts, including the porcine placenta steroid extract (PPSE),¹⁶⁾ have not been thoroughly investigated using epidermal cells. These extracts are produced by extracting bovine or porcine placenta with diethyl ether and dissolving the extracted dried product under reduced pressure in olive or sesame oil. The resulting substance is termed the oil-soluble placental extract (OSPE).¹⁵⁾ The PPSE is also prepared by extraction with chloroform/methanol and removal of excessive free fat. The PPSE contains 17β-estradiol, estrone, progesterone and other hormones.¹⁶⁾

In this study, we isolated the sphingolipid-enriched fraction from porcine placental extract (SLPPE), and assessed the potential cosmetic benefits of SLPPE by investigating its effects on the expression of genes related to skin function. Our findings revealed that SLPPE upregulates the gene expression of cornified envelope (CE) structural components in normal human epidermal keratinocyte (NHEK) cells, i.e., filaggrin (FLG), involucrin (IVL), loricrin (LOR), and cornification enzymes transglutaminase 1 (TGM1) and TGM5. Additionally, gene expression of the desquamation enzymes kallikrein 5 (KLK5) and KLK7 in NHEK cells was upregulated. These results suggest that SLPPE enhances the barrier function of NHEKs, indicating its potential utility in cosmetics.

MATERIALS AND METHODS

Preparation of Hydrophobic Porcine Placental Extract

A hydrophobic porcine placental extract (HPPE) was prepared as follows. Fresh placentas obtained from female pigs that had just given birth were washed with ice-cold water to remove excess blood and other tissues. The cleaned placentas were homogenized and dissolved in distilled water, and a protease was added to this sample.¹⁴⁾ Digestive supernatants were removed, and the remaining water-insoluble portion was collected using a filter press (Yabuta Kikai Co., Ltd., Osaka, Japan). The obtained cakes were sterilized by autoclaving at 121 °C for 30 min and lyophilized under residual pressure (Hyuga Manufactory Co., Ltd., Saitama, Japan) to obtain a light gray powder (HPPE: approximately 3.8 g/kg wet weight of placenta).

Preparation of SLPPE

SLPPE was prepared from HPPE using the BUME method¹⁷⁾ and solvent fractionation method.¹⁸⁾ In brief, 10 g of HPPE was dissolved in a mixture of butanol/methanol (3 : 1, 320 mL) and stirred for 1 h. A mixture of heptane/ethyl acetate (3 : 1, 320 mL) was added to the solution and stirred for 1 h. Next, 320 mL of 1% acetic acid solution was added to the solution. After stirring for 1 h, the solution was centrifuged for 20 min at 14000 × g, and the top layer was obtained and evaporated to yield 5.0 g of total lipid. The total lipid (5.0 g) extracted from HPPE was then macerated in acetone (10 times the volume for 10 min, repeated twice) to remove simple lipids. The acetone-insoluble portion was then mixed with ether (10 times the volume for 10 min, repeated twice), and glycerophospholipids were removed by filtration. The remaining sphingolipid-enriched fraction was air-dried to obtain a light gray powder (SLPPE, approximately 46.5 mg/g HPPE) and used in the experiments as SLPPE.

LC-MS Profile of SLPPE

The composition of sphingolipids in SLPPE was analyzed using HPLC, UltiMate 3000 RSLC (Thermo Fisher Scientific, Waltham, MA, U.S.A.) equipped with a C18 column (SunShell, 2.1ø × 150 mm, ChromaNik Technologies Inc., Osaka, Japan) employing a four-step gradient at a flow rate of 0.2 mL/min over 50 min at 40 °C. The mobile phases were as follows; mobile phase A: CH₃CN containing 10 mM HCOONH₄/H₂O (60 : 40, 0.1% HCOOH); and mobile phase B: 2-propanol containing 10 mM HCOONH₄/CH₃CN (90 : 10, 0.1% HCOOH). The molecular ion peaks at the indicated times were detected using a high-resolution mass spectrometer Q Exactive (Thermo Fisher Scientific), and the relative intensity of the ion peaks was expressed as the m/z value. The identification of lipid molecular species was determined using LipidSearch analysis software (Mitsui Knowledge Industry Co., Ltd., Tokyo, Japan). This analysis was conducted by the Kazusa DNA Research Institute (Chiba, Japan).

Preparation of Liposomal SLPPE (Lipo-SLP)

Lipo-SLP was used in this study because dissolving lipophilic sphingolipids in the culture medium was challenging. Lipo-SLP, composed of dioleoylphosphatidylcholine (DOPC)/dioleoylphosphatidylglycerol (DOPG) at a ratio of 1 : 1 was prepared using an automated liposome manufacturing system (Hashimoto Electronic Industry Co., Ltd., Matsusaka, Japan) to achieve a final concentration of 10.5 mg/mL SLPPE in Lipo-SLP. Lipo-SLP (10.5 mg/mL) was diluted with culture medium ranging from 105- to 420-fold, resulting in final concentrations of SLPPE equivalent to 25–100 µg/mL. Liposomes alone were also tested in this experiment and were diluted with the culture medium using the same method to prepare Lipo-SLP (25–100 µg/mL).

Cell Culture

NHEK cells were obtained from Kurabo Industries (Osaka, Japan). The cells were cultured in HuMedia-KG2 medium (Kurabo Industries), supplemented with recombinant human epidermal growth factor (0.1 ng/mL), recombinant human insulin (10 µg/mL), hydrocortisone (0.67 µg/mL), gentamicin (50 µg/mL), amphotericin B (50 ng/mL) (Kurabo Industries) and 0.4% (v/v) bovine pituitary extract in a humidified atmosphere at 37 °C with 5% CO₂ and 95% atmospheric air.

Cell Viability Assay

NHEK cells at a density of 3.5 × 10⁵ cells/mL were cultured in a 12-well plate (1 mL) with the supplemented HuMedia-KG2 medium for 24 h. The cells were subsequently treated with various concentrations of Lipo-SLP and the liposome control (Lipo-cont) dissolved in HuMedia-KG2 medium supplemented with half the quantity of growth factors (see Cell Culture), excluding gentamicin and amphotericin B. Cell viability was assessed by adding 0.5 mL medium with 15 µL Cell Counting Kit-8 solution (CCK-8; Dojindo Laboratories, Kumamoto, Japan) 48 h after cultivation. The formazan formed in the culture medium was measured using a microplate reader at 450 nm (Bio-Rad Laboratories, Inc., Hercules, CA, U.S.A.).

mRNA Expression Determined by Real-Time Quantitative RT-PCR (qRT-PCR)

Total RNA was extracted from cells treated with various concentrations of Lipo-SLP or Lipo-cont for 48 h using the NucleoSpin RNA kit (TaKaRa Bio Inc., Shiga, Japan). Reverse transcription of isolated mRNA was carried out using PrimeScript RT Master Mix (TaKaRa Bio Inc.). RT-PCR was performed using a Thermal Cycler Dice Real-Time System II and SYBR Premix Ex Taq II (TaKaRa Bio Inc.). Reaction mixtures consisted of 0.2 µL each of 50 µM forward and reverse primers, 2.5 µL of template cDNA, 9.6 µL of ultra-pure water, and 12.5 µL of SYBR Premix Ex Taq II. The mRNA primer sequences used in this study are listed in Table 1. Second-strand cDNA synthesis and PCR amplification were carried out with the following program: 1 cycle at 95 °C for 30 s, 40 cycles at 95 °C for 5 s and 40 cycles at 60 °C for 30 s. The kinetics of PCR amplification were determined using data from quadruplicate samples. The expression levels were calculated using the 2^–ΔΔCt method.

Table 1. Primer Sequences Used in This Study

Gene name	Access No.	Sequence		Size (bp)
GAPDH	NM_002046.7	Forward	GCACCGTCAAGGCTGAGAAC	138
		Reverse	TGGTGAAGACGCCAGTGGA
LORICRIN	NM_00427.3	Forward	CCTACCTGGCCGTCCAAATA	114
		Reverse	GCAAACCTCGGGTAGCATCA
IVL	NM_005547.3	Forward	GCTGGAGCAGCCTGTGTTTG	159
		Reverse	CTGGACACTGCGGGTGGTTA
FLG	NM_002016.1	Forward	GTGGCAGTCCTCACAGTTCTAGTTC	100
		Reverse	CCATAGCTGCCATGTCTCCAA
HRNR	NM_001009931.3	Forward	AAGATGCAGCAGCGGTAGTGTC	139
		Reverse	AATGCTCTTGCTCACTGGCTTG
RPTN	NM_001122965.1	Forward	ACCAGGCAGAGTCATGGTGAG	133
		Reverse	CATCTTTATGGGTTCGCCTGTC
EVPL	NM_001320747.2	Forward	CTTGCCTCAGAGCAGCCTCA	117
		Reverse	GATGGATCAGGCACCAAGGTTA
PPL	NM_002705.5	Forward	AGTCCCGCCCACATATGAGA	148
		Reverse	TGTTGCTGGGAGTGTACAGGAA
SPRR1A	NM_001199828.2	Forward	AACGGTCACTCCAGCACCAG	137
		Reverse	GGTCAATAGGCAAATGGGATTCA
SPRR2A	NM_005988.3	Forward	ACCTCAGCAGTGCCAGCAGA	141
		Reverse	TGGAACGAGGTGAGCCAAATATC
SPRR2B	NM_001017418.3	Forward	TCCAGGTGGAGACTGAGCAAAG	143
		Reverse	GAAGCTCATGCCCAGGTGAA
LCE2A	NM_178428.4	Forward	ACATCACAGAGCAACCCTTATGGA	136
		Reverse	CTCTTGGGCCATGACAACAGAC
LCE2B	NM_014357.5	Forward	CGACTGCTGTGAGAGTGAACC	112
		Reverse	GGAGGTTCTTAAACATTCTGTCCAA
TGM1	NM_000359.3	Forward	GCTCGAAGGCTCTGGGTTACA	132
		Reverse	TCCAAGCTGGCAATGAGCTG
TGM3	NM_003245.4	Forward	CACGCTTGTACATGAAGTGTGGAA	138
		Reverse	GCTGTGATCCGGATCATGTTG
TGM5	NM_004245.4	Forward	CGAGCGGGATGACATCACA	114
		Reverse	TGGGAGCCATGGAAGCTTCTA
KLK5	NM_001077492.2	Forward	TGCTAAGGCCCAACCAGCTC	149
		Reverse	GAACATCTGCTGCCCAGATTCA
KLK7	NM_005046.4	Forward	GCGTGGATGTCAAGCTCATCTC	152
		Reverse	CAGGGTACCTCTGCACACCAAC

Measurement of Filaggrin Protein (FLGp) and Kallikrein 5 Protein (KLK5p)

NHEKs treated with various concentrations of the tested samples were cultured for 48 h, and subsequently, the culture supernatants were collected and assessed for FLGp and KLK5p levels using enzyme-linked immunosorbent assay (ELISA) kits. The ELISA kit from Cloud-Clone Corp. (Katy, TX, U.S.A.) was used for FLGp, and the kit from R&D Systems, Inc. (Minneapolis, MN, U.S.A.) was used for KLK5p, following the manufacturers’ instructions.

Statistical Analysis

All data are presented as the mean ± standard deviation (S.D.). Statistical analyses were conducted using Kaleida Graph software (Synergy Software, Ver. 4.5, Reading, PA, U.S.A.). Statistical significance was determined by Tukey’s HSD test for comparisons between all different experimental conditions. A p-value was considered significant below 0.05.

RESULTS

LC-MS Profiles of SLPPE

We initially analyzed the components of SLPPE isolated from the porcine placenta using LC-MS (Fig. 1). The individual peaks at each time point were assigned to sphingomyelins (SM), phosphatidylcholines (PC), ceramides and neutral-glycosphingolipids. The fragment match score (m-score) was set to 5, and the identification level (fragmentation grade) quality filters A and B (A: lipid class and fatty acids unambiguously identified; B: lipid class and some fatty acids identified) were considered. The results revealed that sphingomyelins comprised 19 components, and the PC group, ceramides and neutral-glycosphingolipids group comprised 58, 92, and 55 components, respectively (Table 2).

Fig. 1. Total Ion Chromatogram Profile from LC-MS of SLPPE

The SLPPE sample was loaded onto the C18 column using a four-step gradient at a flow rate of 0.2 mL/min over 50 min at 40 °C. The eluate was measured by positive mode, ionized using electrospray ionization. The identification of lipoid molecular species was determined using LipidSeach. LPC: lysophosphatidylcholine, ST: sulfatide, PC: phosphatidylcholine, Hex3Cer: trihexosylceramides, SM: sphingomyelin, Hex2Cer: dihexosylceramides, Hex1Cer: hexosylceramide, Cer: ceramides.

Table 2. The Results of the Lipidomics Analysis of SLPPE

Group	Lipid Class	Identified number	Composition of fatty acid side chain
P-Choline	Lysophosphatidylcholine (LPC)	31	LPC (18 : 0), LPC (20 : 1), LPC (16 : 1), etc.
	Phosphatidylcholine (PC)	27	PC (16 : 0_18 : 1), PC (16 : 0_16 : 0), PC (20 : 0_14 : 3), etc.
P-Ethanol amine	Lysophosphatidylethanolamine (LPE)	15	LPE (18 : 0), LPE (20 : 1), LPE(22 : 0), etc.
	Lysodimethylphosphatidylethanolamine (LdMePE)	2	LdMePE (16 : 0), LdMePE (18 : 0)
	Phosphatidylethanolamine (PE)	27	PE (18 : 0_18 : 1), PE (16 : 0_18 : 1), PE (18 : 1_18 : 1), etc.
	Dimethylphosphatidylethanolamine (dMePE)	2	dMePE (16 : 0_18 : 1), dMePE (18 : 0_16 : 0)
P-Serine	Lysophosphatidylserine (LPS)	2	LPS (18 : 1), LPS (16 : 0)
	Phosphatidylserine (PS)	9	PS (18 : 0_18 : 1), PS (16 : 0_18 : 1), PS (18 : 1_18 : 1), etc.
P-Glycerol	Lysophosphatidylglycerol (LPG)	3	LPG (20 : 2), LPG (16 : 1), LPG (18 : 2), etc.
	Phosphatidylglycerol (PG)	6	PG (18 : 0_18 : 1), PG (16 : 0_18 : 1), PG (18 : 1_18 : 1), etc.
P-Inositol	Lysophosphatidylinositol (LPI)	2	LPI (16 : 0), LPI (18 : 1)
	Phosphatidylinositol (PI)	12	PI (18 : 0_18 : 1), PI (18 : 1_18 : 1), PI (22 : 0_14 : 1), etc.
P-Ethanol	Phosphatidylethanol (PEt)	0
P-Acid	Lysophosphatidic acid (LPA)	1	LPA (16 : 0)
	Phosphatidic acid (PA)	1	PA (8 : 1e_10 : 0)
	Cyclic phosphatidic acid (cPA)	1	cPA (18 : 0)
P-Methanol	Lysophosphatidylmethanol (LPMe)	3	LPMe (18 : 0), LPMe (16 : 0), LPMe (22 : 0)
	Phosphatidylmethanol (PMe)	1	PMe (8 : 0e_10 : 0)
Sphingolipids	Sphingomyelin (SM)	19	SM (d18 : 1_24 : 1), SM (d16 : 1_20 : 0), SM (d16 : 1_16 : 0), etc.
	Sphingomyelin (phytosphingosine) (phSM)	0
Neutral glycerolipid	Diglyceride (DG)	3	DG (25 : 0_16 : 1), DG (16 : 0_18 : 1), DG (18 : 0_18 : 1)
	Triglyceride (TG)	1	TG (18 : 4_11 : 1_22 : 6)
Sphingoid base	Sphingosine (SPH)	0
Neutral glycosphingolipids	Simple Glc series (Hex1Cer)	9	Hex1Cer (d18 : 1_24 : 0), Hex1Cer (t18 : 0_24 : 0), Hex1Cer (d18 : 1_22 : 0), etc.
	Simple Glc series (Hex2Cer)	31	Hex2Cer (d18 : 1_24 : 0), Hex2Cer (d18 : 1_24 : 1), Hex2Cer (d18 : 1_16 : 0), etc.
	Simple Glc series (Hex3Cer)	14	Hex3Cer (d18 : 1_22 : 0), Hex3Cer (d18 : 1_24 : 0), Hex3Cer (d18 : 1_16 : 0), etc.
	Simple Glc series (CerG2GNAc1)	0
	Sulfatide (ST)	1	ST (d18 : 1_16 : 0)
Ceramides	Ceramides (Cer)	92	Cer (d18 : 1_24 : 0), Cer (d18 : 1_16 : 0), Cer (m19 : 0_23 : 2), etc.
	Ceramides phosphate (CerP)	0
Glycosphingolipids	Gangliosides (GM3)	0
Steroid	Zymosterol (ZyE)	1	ZyE (0 : 0)
Fatty esters	Wax exters (WE)	0
	Acyl Carnitine (AcCa)	7	AcCa (20 : 0), AcCa (22 : 0), AcCa (24 : 0),etc.
Glycoglycerolipid	Monogalactosyldiacylglycerol (MGDG)	0

The identified lipid molecules were classified in the lipid classes and groups. Composition of fatty lipid side chain were listed in lipid molecular species, three kinds of high peak areas.

Effect of Lipo-SLP on the Cell Viability of NHEK Cells

The effect on proliferation of Lipo-SLP in cultured NHEK cells were evaluated by the CCK-8 assay. Treatment with Lipo-SLP for 48 h did not affect the proliferation of cultured NHEK cells at any concentration compared with the blank culture (BLK) (Fig. 2). Lipo-Cont at 25 µg/mL enhanced proliferation slightly by 6.6% (p = 0.0122). Although there exist some statistically significant differences between groups, these effects are all very small (6.0 to 8.9%).

Fig. 2. Effect of Lipo-SLP on the Cell Viability of NHEK Cells

NHEK cells were cultured with or without various concentrations of Lipo-SLP (25–100 µg/mL) or Lipo-Cont (25–100 µg/mL). Cell viability was measured after 48 h of cultivation. (A) Data of cell viability are expressed in a bar graph as means with S.D. of quadruplicate cultures. The experiment was repeated at least three times, and one representative data is shown. (B) Significant probabilities between all combinations of the conditions were determined by Tukey’s HSD test. p-Values <0.05 are shown in bold letters. Con25, Con50, Con100, Lipo25, Lipo50, and Lipo100 denote Lipo-Cont (25 µg/mL), Lipo-Cont (25 µg/mL), Lipo-Cont (50 µg/mL), Lipo-SLP (25 µg/mL), Lipo-SLP (50 µg/mL), and Lipo-SLP (100 µg/mL), respectively.

Effects of Lipo-SLP on the Level of mRNA Expression for Structural Proteins, Cornification Enzymes and Desquamation Enzymes in NHEK Cells

Changes in the transcriptional levels of various genes in NHEK cells when treated with Lipo-SLP are summarized in Table 3. These genes include 12 structural proteins (LOR, IVL, FLG, hornerin, repetin, envoplakin, periplakin, small proline-rich protein 1A, small proline-rich protein 2A and 2B, and late cornified envelope 2A and 2B), three cornification enzymes (TGM1, -3, and -5) and two desquamation enzymes (KLK5 and -7) (Table 3). The all results on the statistical analyses of individual gene expressions with Tukey’s HSD method are shown in Supplementary Table S1.

Table 3. Effect of Lipo-SLP on the Expression of mRNA of Structural Proteins, Cornification Enzymes, and Desquamation Enzymes in Epidermal Keratinocyte Cells

Target proteins		Blank	25 µg/mL						50 µg/mL						100 µg/mL
			Lipo-Cont	p-Value vs. blank	Lipo-SLP	p-Value vs. blank	Ratio		Lipo-Cont	p-Value vs. blank	Lipo-SLP	p-Value vs. blank	Ratio		Lipo-Cont	p-Value vs. blank	Lipo-SLP	p-Value vs. blank	Ratio
							Lipo-SLP/Lipo-Cont	p-Value Lipo-Cont vs. Lipo-SLP					Lipo-SLP/Lipo-Cont	p-Value Lipo-Cont vs. Lipo-SLP					Lipo-SLP/Lipo-Cont	p-Value Lipo-Cont vs. Lipo-SLP
Structual proteins
LOR	Loricrin	1.00 ± 0.15	1.29 ± 0.11	0.8052	2.07 ± 0.43	0.0007	1.6	0.0152	1.17 ± 0.11	0.9818	4.21 ± 0.55	< 0.0001	3.6	< 0.0001	1.55 ± 0.11	0.1624	2.70 ± 0.22	< 0.0001	1.7	0.0002
IVL	Involucrin	1.01 ± 0.11	2.34 ± 0.42	0.0626	2.72 ± 0.55	0.0091	1.2	0.9697	3.71 ± 1.02	< 0.0001	6.77 ± 0.45	< 0.0001	1.8	< 0.0001	3.98 ± 0.78	< 0.0001	7.79 ± 0.42	< 0.0001	2.0	< 0.0001
FLG	Filaggrin	1.00 ± 0.10	1.84 ± 0.60	0.9276	2.74 ± 1.16	0.4103	1.5	0.9315	2.06 ± 0.35	0.8208	7.26 ± 1.63	< 0.0001	3.5	< 0.0001	2.91 ± 1.26	0.2315	8.69 ± 1.58	< 0.0001	3.0	< 0.0001
HRNR	Hornerin	1.01 ± 0.16	1.08 ± 0.26	0.9917	0.97 ± 0.05	0.9994	0.9	0.9159	1.17 ± 0.08	0.6907	1.12 ± 0.14	0.9266	1.0	0.9985	1.30 ± 0.03	0.1000	1.21 ± 0.13	0.4357	0.9	0.9699
RPTN	Repetin	1.12 ± 0.56	0.74 ± 0.31	0.9303	1.99 ± 0.52	0.2357	2.7	0.0297	0.70 ± 0.09	0.8931	5.75 ± 0.89	< 0.0001	8.2	< 0.0001	1.06 ± 0.40	0.9999	4.76 ± 0.38	< 0.0001	4.5	< 0.0001
EVPL	Envoplakin	1.01 ± 0.20	0.95 ± 0.17	0.9999	0.92 ± 0.04	0.9991	1.0	0.9999	0.99 ± 0.06	0.9999	1.47 ± 0.50	0.2931	1.5	0.2434	1.22 ± 0.26	0.9422	1.50 ± 0.42	0.2266	1.2	0.7817
PPL	Periplakin	1.00 ± 0.11	1.27 ± 0.17	0.4435	1.53 ± 0.11	0.0118	1.2	0.4913	1.79 ± 0.23	0.0001	2.08 ± 0.08	< 0.0001	1.2	0.3518	1.78 ± 0.29	0.0002	2.31 ± 0.24	< 0.0001	1.3	0.0107
SPRR1A	Small proline-rich protein 1A	1.00 ± 0.12	2.02 ± 0.52	0.5682	3.14 ± 0.28	0.0158	1.6	0.4446	3.31 ± 0.51	0.0082	4.14 ± 0.58	0.0003	1.2	0.7578	4.73 ± 1.86	< 0.0001	6.90 ± 0.14	< 0.0001	1.4	0.0135
SPRR2A	Small proline-rich protein 2A	1.01 ± 0.12	1.78 ± 0.39	0.8937	7.54 ± 0.86	< 0.0001	4.2	< 0.0001	3.63 ± 0.33	0.0099	21.16 ± 1.60	< 0.0001	5.8	< 0.0001	3.94 ± 1.13	0.0034	16.91 ± 1.09	< 0.0001	4.3	< 0.0001
SPRR2B	Small proline-rich protein 2B	1.01 ± 0.16	2.02 ± 0.92	0.9999	12.99 ± 3.69	0.0408	6.4	0.0730	3.28 ± 0.77	0.9947	46.57 ± 6.65	< 0.0001	14.2	< 0.0001	7.15 ± 2.37	0.6138	51.32 ± 10.7	< 0.0001	7.2	< 0.0001
LCE2A	Late cornified envelope 2A	1.16 ± 0.74	1.57 ± 1.30	0.9999	3.60 ± 0.70	0.9223	2.3	0.9663	1.36 ± 0.33	0.9999	18.34 ± 4.27	< 0.0001	13.5	< 0.0001	2.40 ± 0.84	0.9974	20.52 ± 6.90	< 0.0001	8.6	< 0.0001
LCE2B	Late cornified envelope 2B	1.11 ± 0.62	1.36 ± 0.62	0.9999	2.77 ± 0.34	0.4336	2.0	0.6176	1.24 ± 0.27	0.9999	10.04 ± 1.55	< 0.0001	8.1	< 0.0001	2.17 ± 0.29	0.8480	8.87 ± 2.46	< 0.0001	4.1	< 0.0001
Cornification enzymes
TGM1	Transglutaminase 1	1.00 ± 0.10	1.83 ± 0.38	0.8879	4.52 ± 0.56	0.0009	2.5	0.0131	3.42 ± 0.35	0.0302	7.98 ± 1.90	< 0.0001	2.3	< 0.0001	4.26 ± 1.14	0.0020	9.91 ± 1.12	< 0.0001	2.3	< 0.0001
TGM3	Transglutaminase 3	1.02 ± 0.20	1.74 ± 0.41	0.4650	2.63 ± 0.99	0.0042	1.5	0.2405	3.14 ± 0.28	0.0002	3.72 ± 0.34	< 0.0001	1.2	0.6858	4.39 ± 0.66	< 0.0001	3.38 ± 0.28	< 0.0001	0.8	0.1383
TGM5	Transglutaminase 5	1.04 ± 0.34	1.50 ± 0.22	0.8197	2.24 ± 0.33	0.0300	1.5	0.3664	1.87 ± 0.25	0.2348	5.76 ± 0.86	< 0.0001	3.1	< 0.0001	2.66 ± 0.56	0.0018	6.00 ± 0.50	< 0.0001	2.2	< 0.0001
Desquamation enzymes
KLK5	Kallikrein 5	1.00 ± 0.09	1.13 ± 0.29	0.9947	2.15 ± 0.30	0.0002	1.9	0.0007	1.68 ± 0.17	0.0343	4.04 ± 0.35	< 0.0001	2.4	< 0.0001	1.70 ± 0.30	0.0284	3.63 ± 0.36	< 0.0001	2.1	< 0.0001
KLK7	Kallikrein 7	1.01 ± 0.15	1.87 ± 0.51	0.8852	6.61 ± 0.97	< 0.0001	3.5	< 0.0001	3.66 ± 0.39	0.0186	19.88 ± 1.98	< 0.0001	5.4	< 0.0001	3.68 ± 1.02	0.0177	10.19 ± 0.93	< 0.0001	2.8	< 0.0001

The transcriptional levels of various genes in NHEK cells treated for 48 h with various concentration of Lipo-SLP (25–100 µg/mL) and Lipo-cont (25–100 µg/mL). Relative mRNA expression levels are expressed as the means ± S.D. of quadruplicate cultures. The experiment was repeated at least three times, and one representative data is shown. Lipo-Cont and Lipo-SLP indicate control liposome and liposomal SLPPE, respectively. Statistical analysis was done with Tukey’s HSD test, and the p-values less than 0.05 are indicated with bold letters. The comprehensive results of statistical analyses are shown in Supplementary Table S1.

Although the mRNA levels for hornerin and periplakin in comparison with Lipo-Cont did not significantly increase at every concentration tested, other structural proteins were upregulated significantly at some concentrations. In particular, small proline-rich protein 2B exhibited the highest upregulation. For the cornification enzymes, TGM1 and TGM5 showed upregulation at various concentrations of Lipo-SLP (25–100 µg/mL), whereas the mRNA levels of TGM3 did not at any concentration. mRNA levels for the desquamation enzymes KLK5 and KLK7 were upregulated significantly at all tested concentrations. Regarding the effects of control (Lipo-Cont), as shown in Table 3, a higher level of gene expression was observed for some genes in the Lipo-Cont treatment at 50 µg/mL or higher compared with the blank culture (Lipo-Cont 50 µg/mL, 8 out of 17 genes; Lipo-Cont 100 µg/mL, 10 out of 17 genes).

Effect of Lipo-SLP on FLGp and KLK5p Production in NHEK Cells

We next examined the effects of Lipo-SLP on the production of FLGp and KLK5p in the supernatant of cultured NHEK cells treated with various concentrations of Lipo-SLP (25–100 µg/mL) or Lipo-Cont (25–100 µg/mL) for 48 h. Levels of FLGp and KLK5p in the culture media increased significantly in a dose-dependent manner compared with the blank culture (Figs. 3, 4). On the other hand, even in Lipo-Cont at any concentration tested (25, 50, 100 µg/mL), statistically significant increase in both FLGp and KLK5p compared with blank condition were observed as well. However, when comparing between Lipo-SLP and corresponding Lipo-Cont, the gene expression levels were higher in Lipo-SLP than Lipo-Cont in almost all cases other than in FLGp at 25 µg/mL (Figs. 3, 4).

Fig. 3. Measurement of Filaggrin Production (FLGp) Using an ELISA Kit

NHEK cells were cultured with or without various concentrations of Lipo-SLP (25–100 µg/mL) or Lipo-Cont (25–100 µg/mL). The concentration of FLGp in the culture media was measured using an ELISA kit. (A) Data of FLGp production are expressed in a bar graph as means with S.D. of quadruplicate culture supernatants. The experiment was repeated at least three times, and one representative data is shown. (B) Significant probabilities between all combinations of the conditions determined by Tukey’s HSD test. p-Values <0.05 are shown in bold letters. Con25, Con50, Con100, Lipo25, Lipo50, and Lipo100 denote Lipo-Cont (25 µg/mL), Lipo-Cont (25 µg/mL), Lipo-Cont (50 µg/mL), Lipo-SLP (25 µg/mL), Lipo-SLP (50 µg/mL), and Lipo-SLP (100 µg/mL), respectively.

Fig. 4. Measurement of Kallikrein 5 Production (KLK5p) Using an ELISA Kit

NHEK cells were cultured with or without various concentrations of Lipo-SLP (25–100 µg/mL) or Lipo-cont (25–100 µg/mL). The KLK5p concentration in culture media was measured using an ELISA kit. (A) Data of KLK5p production are expressed in a bar graph as means with S.D. of quadruplicate culture supernatants. The experiment was repeated at least three times, and one representative data is shown. (B) Significant probabilities between all combinations of the conditions determined by Tukey’s HSD test. p-Values <0.05 are shown in bold letters. Con25, Con50, Con100, Lipo25, Lipo50, and Lipo100 denote Lipo-Cont (25 µg/mL), Lipo-Cont (25 µg/mL), Lipo-Cont (50 µg/mL), Lipo-SLP (25 µg/mL), Lipo-SLP (50 µg/mL), and Lipo-SLP (100 µg/mL), respectively.

DISCUSSION

SLPPE is a placental extract prepared from the non-aqueous fraction of porcine placenta, differing from conventional water-soluble placental extracts. SLPPE primarily contains amphiphilic molecules, including SM, lysophosphatidylcholine (LPC), PC and ceramide. Sigruener et al.¹⁹⁾ reported that sphingoid bases, such as sphinganine, sphingosine and phytosphingosine, promote the differentiation of keratinocytes. Tokudome et al.²⁰⁾ reported that SM-based liposomes applied to a three-dimensional cultured human skin model increased the amount of ceramide 2 significantly. Therefore, given the various activities of sphingolipids on epidermal cells, we examined the effect of SLPPE on cultured NHEK cells. In qRT-PCR analysis, the effects of SLPPE on NHEKs included a significant increase in the expression of structural proteins such as LOR, FLG, IVL, and stratum corneum enzymes TGM1 and TGM5. As these components constitute the CE, it is anticipated that SLPPE promotes barrier function by accelerating epidermal turnover. Kalinin et al.²¹⁾ described the structural features and assembly of CE in three stages. The first stage involves the expression of envoplakin and periplakin, which bind to keratin intermediate filaments. Subsequently, the expression of TGM1 and IVL begins, initiating IVL cross-linking, followed by the commencement of cross-linking between envoplakin and IVL. The second stage marks the initiation of cornfield formation, during which cytoplasmic lamellar bodies are extruded in the case of the epidermis. The third stage involves CE reinforcement, with LOR and small proline-rich proteins (SPRs) accumulating. It is speculated that TGM3 begins to cross-link LOR, leading to the formation of insoluble polymer aggregates.

SLPPE did not show an increase in the expression of envoplakin and periplakin playing roles at the early stages of CE formation, however, SLPPE increased the expression of LOR, IVL, SPRs and TGM1 genes, which are required for the next step of CE formation. Therefore, SLPPE may contribute to CE assembly.

Xie et al.²²⁾ showed that adding sonicated phosphatidylglycerol (PG) liposomes to a murine keratinocyte culture inhibited the proliferation of keratinocytes while promoting differentiation. Specifically, PGs rich in unsaturated fatty acids were reported to have these effects, whereas PGs rich in saturated fatty acids stimulated the proliferation of mouse keratinocytes. In our experiments, SLPPE was found to contain six types of PG, including saturated fatty acids such as stearic acid (18 : 0), and palmitic acid (16 : 0) (Table 2). We observed that SLPPE did not induce proliferation but promoted gene expression of several molecules in human NHEK cells. Xie et al.²²⁾ used 6.25–100 µg/mL PG, which is similar to the concentrations of SLPPE used in our experiments. However, we hypothesize that the concentration of PG in SLPPE was too low to enhance NHEK cell proliferation, although the concentration of PG in SLPPE was not determined. Additionally, in our study, we used SLPPE liposomes for encapsulation, whereas Xie et al.²²⁾ used sonicated PG. This difference in preparing liposomes may contribute to the observed differences. Further investigation into the effect of high proportions of LPC and PC in SLPPE with fatty acids should provide insights into their influence on the differentiation of NHEK cells.

Furthermore, SLPPE significantly increased the mRNA expression levels of KLK5 and KLK7 in NHEK cells (Table 3). However, a higher level of gene expression was observed in the Lipo-Cont treatment alone compared to the blank culture. Specifically, with Lipo-Cont treatment alone, a statistically significant increase in expression was observed in a dose-dependent manner. The liposomes used in this study consisted of DOPC and DOPG, and DOPG was previously reported to stimulate the proliferation of mouse keratinocytes.²²⁾ Therefore, it is possible that some components of liposomes, such as DOPG, may be involved in the increase in gene expression observed in Lipo-Cont treatment.

The concentration of KLK5p in the culture supernatant of NHEK cells treated with SLPPE also showed a significant increase. KLK5 is a serine protease postulated to facilitate the desquamation of the stratum corneum.²³⁾

Recently, substances that increase the production of KLK5 have been explored as potential cosmetic additives because of their role in promoting stratum corneum desquamation in the skin. Studies have indicated that KLK5 activity decreases in the melanin-rich stratum corneum, contributing to stagnation in desquamation.²⁴⁾ Additionally, cosmetics containing substances that promote KLK5p have been reported to reduce skin dullness.²⁵⁾

Ishida et al.²⁶⁾ demonstrated that a rosemary extract activates KLK7 in NHEK cells and conducted experiments on human skin. The results showed that the rosemary extract increased the activity of KLK7 significantly in the stratum corneum and thus reduced dullness. Aioi and colleagues¹¹⁾ reported that water-soluble PPE prepared by freeze-thawing has anti-wrinkle effects on human skin. Using HaCaT cells, they reported an enhancement in the expression of FLG, ceramide synthase 3, TGM1 and KLK7.¹¹⁾

In our study, SLPPE was demonstrated to activate KLK5 and KLK7, suggesting the potential to promote melanin excretion and improve dullness. However, it is currently unclear whether promoting gene expression in NHEK cells has an effect on desquamation, and further research is required.

Ceramide is known to have many functions, including epidermal permeability barrier function and proliferation and differentiation of epidermal cells.²⁷⁾ Since SLPPE also contains 92 types of ceramides, we would like to study the relationship with the function of promoting cornification. On the other hand, SLPPE does not contain amino acids but instead contains amphipathic substances such as sphingomyelin. SLPPE is expected to improve skin dullness through KLK5 activity, which was not included in PPE. The combination of both placental extracts may achieve synergetic effects. Future research will examine the active components of SLPPE and further explore its mechanisms of action.

Acknowledgments

We thank Dr. Yasuhiko Komatsu at Snowden Co., Ltd. for the critical reading and discussion of the manuscript.

Conflict of Interest

MT and YD are employees of Snowden Co., Ltd. The remaining authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.

Supplementary Materials

This article contains supplementary materials.

REFERENCES

• 1) Sakamoto K, Kasahira T, Nakakawaji K, Hayashi M, Takahashi I. Influence of Laennec on the regeneration of liver after partial hepatectomy. Tokyo Ika Daigaku Zassi., 33, 271–278 (1975).
• 2) Karasawa Y, Iwasaki Y, Kagawa S, Kimura Y, Kobayashi H, Kobayashi K, Saito M, Tsuyuguchi M. Clinical treatment test of Melsmon on menopausal disorder. Medication and Treatment, 9, 1–10 (1981).
• 3) Koike K, Yamamoto Y, Suzuki N, Yamazaki R, Yoshikawa C, Takano F, Takuma K, Sugiura K, Inoue M. Efficacy of porcine placental extract on climacteric symptoms in peri- and postmenopausal women. Climacteric, 16, 28–35 (2013).
• 4) Yoshikawa C, Koike K, Takano F, Sugiura K, Suzuki N. Efficacy of porcine placental extract on wrinkle widths below the eye in climacteric women. Climacteric, 17, 370–376 (2014).
• 5) Kitanohara M, Yamamoto T, Masunaga S, Ohishi M, Komatsu Y, Nagase M. Effect of porcine placental extract on the mild menopausal symptoms of climacteric women. Climacteric, 20, 144–150 (2017).
• 6) Nagase M, Watanabe C, Kitanohara M, Nishiya M, Okada T, Ohishi M, Komatsu Y. Improvement of aspects of subjective sleep quality of healthy volunteers by ingestion of porcine placental extract: a randomized cross-over pilot study. Front. Nutr., 7, 550287 (2020).
• 7) Yoshikawa C, Takano F, Ishigaki Y, Okada M, Kyo S, Suzuki N, Sugiura K, Koike K. Effect of porcine placental extract on collagen production in human skin fibroblast in vitro. Gynecol. Obstet. (Sunnyvale), 3, 1000186 (2013).
• 8) Nair B, Elmore AR. Final report on the safety assessment of human placental protein, hydrolyzed human placental protein, human placental enzymes, human placental lipids, human umbilical extract, placental protein, hydrolyzed placental protein, placental enzymes, placental lipids, and umbilical extract. Int. J. Toxicol., 21 (Suppl. 1), 81–91 (2002).
• 9) Watanabe T, Tahara K, Hirano E. Evaluating the impact of a cream containing horse placental extract on eye corner wrinkles in healthy women: single-blind comparative study. JMIR Dermatol., 6, e51070 (2023).
• 10) Nagae M, Nishio T, Ohnuki K, Shimizu K. Effect of oral administration of equine placental extract supplement on the facial skin of healthy adult women: a randomized, double-blind, placebo-controlled study. Health Sci. Rep., 5, e522 (2022).
• 11) Aioi A, Muromoto R, Mogami S, Nishikawa M, Ogawa S, Matsuda T. Porcine placenta extract reduced wrinkle formation by potentiating epidermal hydration. J. Cosmet. Dermatol. Sci. Appl., 11, 101–109 (2021).
• 12) Tebakari M, Katoh S, Hashimoto H, Kawashima J, Takano F. Porcine placenta extract modulates the expression of skin functional proteins in cultured human fibroblasts and keratinocytes. Pharmacometrics, 88, 1–6 (2015).
• 13) Takano F, Tebakari M, Hashimoto H, Mori Y, Nakamura M, Wagatsuma S, Yoshida S, Kawashima J, Yasuda T, Fushiya S. Placenta extracts selectively promote the proliferation of specific progenitor cells derived from murine marrow in vitro. Pharmacometrics, 89, 83–90 (2015).
• 14) Tebakari M, Daigo Y, Ishikawa H, Nakamura M, Kawashima J, Takano F. Anti-inflammatory effect of the water-soluble portion of porcine placental extract in lipopolysaccharide-stimulated RAW264.7 murine macrophage cells. Biol. Pharm. Bull., 41, 1251–1256 (2018).
• 15) “The Japanese Standards of Quasi-Drug Ingredients. 2021”: ‹https://www.mhlw.go.jp/content/000839905.pdf›, accessed 25 March, 2021.
• 16) Lee EJ, Kamli MR, Bhat AR, Pokharel S, Lee DM, Kim SH, Kim TI, Hong S, Choi I. Effect of porcine placenta steroid extract on myogenic satellite cell proliferation, transdifferentiation, and lipid accumulation. In Vitro Cell. Dev. Biol. Anim., 48, 326–333 (2012).
• 17) Löfgren L, Forsberg G-B, Ståhlman M. The BUME method: a new rapid and simple chloroform-free method for total lipid extraction of animal tissue. Sci. Rep., 6, 27688 (2016).
• 18) Yamazaki H, Minami J, Ichikawa T, Kondo M. Analysis of polycyclic aromatic hydrocarbons in raw and broiled fishes. Shokuhin Eiseigaku Zasshi, 18, 368–374_1 (1977).
• 19) Sigruener A, Tarabin V, Paragh G, Liebisch G, Koehler T, Farwick M, Schmitz G. Effect of sphingoid bases on the sphingolipidome in early keratinocyte differentiation. Exp. Dermatol., 22, 677–679 (2013).
• 20) Tokudome Y, Uchida R, Yokote T, Todo H, Hada N, Kon T, Yasuda J, Hayashi H, Hashimoto F, Sugibayashi K. Effect of topically applied sphingomyelin-based liposomes on the ceramide level in a three-dimensional cultured human skin model. J. Liposome Res., 20, 49–54 (2010).
• 21) Kalinin AE, Kajava AV, Steinert PM. Epithelial barrier function: assembly and structural features of the cornified cell envelope. BioEssays, 24, 789–800 (2002).
• 22) Xie D, Seremwe M, Edwards JG, Podolsky R, Bollag WB. Distinct effects of different phosphatidylglycerol species on mouse keratinocyte proliferation. PLOS ONE, 9, e107119 (2014).
• 23) Caubet C, Jonca N, Brattsand M, Guerrin M, Bernard D, Schmidt R, Egelrud T, Simon M, Serre G. Degradation of corneodesmosome proteins by two serine proteases of the kallikrein family, SCTE/KLK5/hK5 and SCCE/KLK7/hK7. J. Invest. Dermatol., 122, 1235–1244 (2004).
• 24) Furuta M, Honma T. Mechanism of excretion of melanin present in the stratum corneum mediated by desquamation-related enzyme KLK5. Cosmetic Stage, 16, 23–27 (2022).
• 25) Nokami N, Ishida T, Ishiguro Y, Yamahara M. A study of factors involved in the skin dullness. The 29th IFSCC Congress. Poster No. 200 (2016).
• 26) Ishida T, Otuki T, Miyama R, Yoshikawa Y, Nokami N, Yamahara M. Decrease of skin dullness via increased activity of epidermal exfoliation enzyme by rosemary extract. J. Soc. Cosmet. Chem. Jpn., 54, 258–263 (2020).
• 27) Uchida Y, Park K. Ceramides in skin health and disease: an update. Am. J. Clin. Dermatol., 22, 853–866 (2021).