2025 Volume 48 Issue 5 Pages 555-562
Pulmonary arterial hypertension (PAH) is a progressive disorder that lacks a validated and effective therapy. Thus, further investigation of the pathogenesis of PAH will help explore novel treatments. The increase in T helper 17 (Th17) cell-mediated pro-inflammatory response and reduction of regulatory T (Treg) cell-mediated anti-inflammatory effect exacerbates PAH progression. Increasing evidence indicates that 5-hydroxytryptamine (5-HT) is closely related to Th17 and Treg polarization. Here, a decrease of 5-HT was found in hypoxia-induced CD4 + T cells. Hypoxia also resulted in a reduction in Treg cells and an increase in Th17 cells, but the addition of 5-HT rescued Th17/Treg balance, confirming that hypoxia destroyed Th17/Treg balance by inducing a 5-HT decrease. Furthermore, we found that 5-HT-restored Th17/Treg balance mitigated primary pulmonary artery smooth muscle cell (PASMC) proliferation, migration, and contraction, which are important factors in vascular remodeling in PAH. In summary, our findings demonstrate that hypoxia-induced 5-HT decline interferes with the balance of Th17/Treg, which affects the biofunction of PASMCs, thus accelerating PAH development. 5-HT-mediated Th17/Treg balance is expected to act as a novel immunotherapy for PAH treatment.
Pulmonary arterial hypertension (PAH) is a kind of syndrome caused by pulmonary arterial blood flow limitation, which increases pulmonary vascular resistance and leads to right ventricular afterload.1) Hypoxia is one of the important causes of PAH, and its mechanism involves many aspects of pathophysiological changes.2) Hypoxia induces vascular smooth muscle cell proliferation, migration, and contraction, which leads to irreversible changes in pulmonary vascular structure.3) Moreover, hypoxia results in an inflammatory response in lung tissues, promotes the release of pro-inflammatory cytokines, and recruits immune cells.4) It also affects the differentiation of CD4+ T cells, especially T helper 17 (Th17) and regulatory T (Treg) cell balance. The increase of Th17 cells and the decrease of Treg cells lead to increased inflammatory response and further deterioration of vascular remodeling.5,6) The therapeutic effect of clinically applied drugs is also mainly to alleviate pulmonary vasoconstriction, but the effect is not very satisfactory. Therefore, the mechanism of PAH needs to be further studied to find more effective therapeutic targets. Studies have shown that immune abnormalities are closely related to PAH. The aggregation of inflammatory cells, such as T cells, macrophages, mast cells, and dendritic cells, perpetuate the release of cytokines and chemokines, eventually leading to vascular remodeling of PAH through vascular cell proliferation, migration, collagen deposition, in-situ thrombosis, and other processes.7,8) Among them, T cells, especially CD4 + T cells, have been shown to play a key role in pulmonary vascular remodeling and PAH development. CD4 + T cells differentiate into different subpopulations, including helper T cells (Th1, Th2, Th9, Th17) and regulatory T cells (Tregs).9,10) Interleukin 17 (IL-17) secretion by Th17 cells promotes hypoxia-induced PAH progression in rats, while inhibition of Th17 cells significantly attenuates hypoxia-induced pressure rise and remodeling.6) By contrast, Treg cells improve PAH by regulating inflammation of the pulmonary blood vessel wall and inhibiting pulmonary artery remodeling.5) These results suggest an imbalance in the proportion of CD4+ T cell subtypes, leading to an abnormal immune response that affects PAH development. However, the specific mechanism of T cell action on PAH still needs to be further explored.
5-Hydroxytryptamine (5-HT) is an important vasoactive substance, which is closely related to various physiological and pathological mechanisms.11) 5-HT takes part in the PAH process by affecting the proliferation and apoptosis of pulmonary smooth muscle cells.12,13) Moreover, 5-HT is synthesized and secreted by T cells,14) which also express 5-HT receptor.15) CD4 + T cells in 5-HT-deficient mice exhibit a transformation to Th17 phenotypes.16) 5-HT promotes the proliferation of Treg cells and the expression of Treg cell surface markers in the brain after ischemic stroke.17) However, what role 5-HT plays in T cells during PAH and whether this role influences PAH development is still unclear.
Therefore, this study intends to study the effects of 5-HT changes in PAH on T cell differentiation and the effects of such effects on pulmonary artery smooth muscle cells, aiming to further reveal the pathological mechanism of PAH.
All animal experiments were approved by the Ethics Committee of the School of Medicine, Xi’an Jiaotong University. The establishment of PAH mouse models refers to previous methods.18) Eight-week-old C57BL/6 male mice were exposed to chronic hypoxia (10% O2) with Animal Oxygen Concentration Experimental System (TOW-INT TECH, China). The control mice were raised in normoxic conditions. After 4 weeks, the right ventricular systolic pressure (RVSP) was measured. Then their lung tissues and serum were collected for further analysis.
CD4+ T Cell Isolation and Cell CultureLung or spleen tissues were cut into small pieces and then the pieces were pressed through a cell strainer to obtain single-cell suspension. CD4+ T cells were isolated from tissues by magnetic bead separation with Mouse CD4 MicroBeads (Miltenyi, Germany). Briefly, 107 cells were incubated for 10 min at 4 °C with 10 µL of CD4 beads and 90 µL of buffer. The samples were passed by a magnetic sorting column so that labeled cells remained in the column, and the column was washed to remove unabsorbed cells. CD4+ T cells were incubated in normoxia (21% O2) or hypoxia (3% O2).19) Three-gas incubators (O2, CO2, N2) were used to control oxygen concentrations. By adjusting the ratio of N2 to oxygen, the desired oxygen environment was achieved. Mouse primary PASMCs were purchased from iCell., and cultured with smooth muscle growth medium (iCell). For co-culture, CD4+ T cells were treated with 200 ng/mL 5-HT, and incubated in hypoxic or normoxic conditions. After 24 h, CD4+ T cells were harvested and then cultured with PASMCs under normoxic conditions for 24 h. In the co-culture system, CD4+ T cells are suspension cells, while PASMCs are adherent cells. Thus, PASMCs were able to be separated from co-culture by removal medium and repeated washing with PBS. Finally, PASMCs were collected and used for further analysis.
Flow CytometryThe purity of isolated CD4+ T cells was greater than 98%, as verified by flow cytometry. 106 cells were incubated with PE-conjugated CD4 antibodies (Lianke) for 30 min at 4 °C, then cells were collected for flow cytometric analysis. Additionally, for detection of IL-17 and 5 µL FOXP3, the cell suspension was incubated with Fixation/Permeabilization solution for 30 min, and then the cells were washed with Permeabilization Buffer, centrifuge, and the supernatant was discarded. Subsequently, cells were resuspended and incubated with FITC-conjugated IL-17 (Thermo Fisher Scientific, Waltham, MA, U.S.A.) and APC-conjugated FOXP3 (Lianke) for 30 min. Flow cytometry was performed using a NovoCyte instrument (Agilent).
Enzyme-Linked Immunosorbent Assay5-HT levels of serum, lung, and cell supernatant were determined using a Mouse 5-HT Enzyme-Linked Immunosorbent Assay (ELISA) Kit (FineTest, Wuhan, China) following the manufacturer’s instructions.
Quantitative Real-Time PCRTotal RNA was extracted from CD4+ T cells and then reverse-transcribed into cDNA. Quantitative Real-time PCR (RT-qPCR) was carried out on a Real-time PCR system (BIONEER, Daejeon, Korea) using SYBR Green (Solarbio, Beijing, China). The β-actin was used as a control gene. Gene-specific PCR primers are shown in Table 1.
| Gene | Primer sequence (5′→3′) |
|---|---|
| 5-HT1A | Forward: GGGACAGGCGGCAACGATA |
| Reverse: CAGCAACCACGCAGGCATT | |
| 5-HT2A | Forward: GGATTTACCTGGATGTGC |
| Reverse: TGTAGCCCGAAGACTGG | |
| FOXP3 | Forward: CACCTTCTGCTGCCACTG |
| Reverse: GCCTTGCCTTTCTCATCC | |
| IL-22 | Forward: CTGCTTCTCATTGCCCTGTG |
| Reverse: GTGCGGTTGACGATGTATGG | |
| RhoA | Forward: TTCGGAATGACGAGCACA |
| Reverse: TGAGGCACCCAGACTTTT | |
| ROCK1 | Forward: GTGATGGCTATTATGGA |
| Reverse: CAGGGAAAGTAAGTGAA | |
| RORγT | Forward: AACAGGGTCCAGACAGCC |
| Reverse: CACCTCCTCCCGTGAAA | |
| IL-17 | Forward: CTACCTCAACCGTTCCAC |
| Reverse: TCTCAGGCTCCCTCTTC | |
| IL-10 | Forward: ACATACTGCTAACCGACTC |
| Reverse: TCTTCAGCTTCTCACCC | |
| TGF-β | Forward: GCGGTGCTCGCTTTGTA |
| Reverse: CACTGCTTCCCGAATGTC | |
| β-Actin | Forward: GCCAGAGCAGTAATCTCCTTCT |
| Reverse: AGTGTGACGTTGACATCCGTA |
PASMCs were seeded on slides, fixed with 4% paraformaldehyde (Sinopharm, Beijing, China) for 15 min, and blocked with 1% BSA for 15 min. Then, the samples were incubated with α-SMA (Affinity, San Francisco, CA, U.S.A.) or Ki67 (Affinity) antibodies overnight at 4 °C. After washing with PBS, they were subject to a second antibody Cy3-Goat Anti-Rabbit immunoglobulin G (IgG) (Proteintech, Rosemont, IL, U.S.A.) for 60 min. The samples were subsequently incubated with DAPI (Aladdin, Riverside, CA, U.S.A.) and images were taken with a fluorescence microscope (Olympus, Tokyo, Japan).
CCK-8 AssayPASMCs were seeded in 96-well plates and incubated with CCK-8 for 2 h. Then, a microplate reader was used to measure the optical density at 450 nm.
Wound Healing AssayCell migration was assessed by wound healing assay. In brief, PASMCs were seeded in plates. After reaching 100% confluence, a scratch was performed on the cell monolayer using a sterile pipet tip. After washing with PBS to remove cell debris, cells were imaged under a microscope (Olympus).
Transwell AssayPASMC migration was also evaluated by Transwell assay. 5 × 103 cells were seeded in the upper chamber in 200 µL fetal bovine serum (FBS)-free culture medium, and 800 µL 10% FBS containing medium was put into the bottom chambers. After culturing for 24 h, suspended cells in the upper chambers were cleaned out. PASMCs attached to the bottom membrane were fixed with 4% paraformaldehyde and stained with crystal violet (Amresco, Solon, OH, U.S.A.). The microscope was used to photograph pictures and the number of cells was counted.
Cell Contraction AssayCell contraction assay kits (Cell Biolabs, San Diego, CA, U.S.A.) were utilized to assess the PASMC contractile capability. PASMCs (2 × 106 cells/mL) were mixed with collagen gel working solution, seeded on 24-well plates, and then incubated at 37 °C for 1 h. After gel polymerization, a cell culture medium was added to each well, and the collagen gel size changes were imaged and quantified.
Measurement of the Intracellular Concentration of Free Calcium Ions ([Ca2+]i)[Ca2+]i was evaluated using Fluo-4 AM (Maokang), a fluorescent dye that penetrates cell membranes and specifically binds to Ca2+. PASMCs were seeded in 24-well plates, after adding 2 µM assay solution into 24-well plates, PASMCs were incubated for 30 min. Finally, imaging was performed using a microscope.
Western BlotCell total proteins were harvested using RIPA lysis buffer (Proteintech) and a bicinchoninic acid (BCA) kit (Proteintech) was used to determine the protein concentrations. Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to PVDF membranes (Thermo Fisher Scientific). Then, the membranes were blocked with 5% skimmed milk buffer. They were subsequently probed at 4 °C overnight with primary antibodies: anti-RhoA (Proteintech) and anti-ROCK1 (Proteintech). Thereafter, the membranes were incubated with goat anti-mouse IgG-HRP. Next, the protein signals were visualized with an ultra-sensitive ECL chemiluminescence kit (Proteintech), and the protein image was taken using the Tanon imaging system.
Statistical AnalysisResults were expressed as means ± standard deviation (S.D.). Statistical significance was tested at the 95% confidence level (p < 0.05) with one-way ANOVA or an unpaired t-test.
Mice exposed to chronic hypoxia for 4 weeks to induce PAH (Fig. 1A) exhibited increased RVSP and RVHI in the PAH mice compared with the normoxic controls (Fig. 1B). Previous reports have shown that 5-HT levels increased in the serum and lung tissues.12,20) In our study, we found that the level of 5-HT was also raised in the serum and lung (Figs. 1C, 1D). On the contrary, the 5-HT level in CD4 + T cells isolated from lung tissues decreased (Fig. 1E). Moreover, the mRNA expression of 5-HT1A and 5-HT2A was determined and we found that their expression also reduced (Fig. 1F). Furthermore, as shown in Fig. 1G, we observed an increase of Th17 cells and a reduction of Treg cells in CD4+ T cells from lung tissues of PAH mice compared with the controls.
(A) Eight-week-old C57BL/6 male mice were exposed to chronic hypoxia for 4 weeks. The control mice were raised in normoxic conditions. (B) Right ventricular systolic pressure (RVSP) and right ventricular hypertrophy index (RVHI). (C) The level 5-HT in serum. (D) Level 5-HT in the lung. (E) CD4 + T cells were isolated from the lung, and the level of 5-HT was detected. (F) mRNA expression of 5-HT1A and 5-HT2A. (G) The percentage of Th17 (IL-17+) and regulatory T cells (Treg, FOXP3+) in CD4 + T cells was assessed by flow cytometry. Data represent the mean ± standard deviation (S.D.). **p < 0.01, and *p < 0.05.
Next, we investigated the 5-HT level in CD4 + T cells under a hypoxic environment. CD4 + T cells were isolated from the spleen (Fig. 2A) and then cultured in normoxic or hypoxic environments. We found that the 5-HT level was reduced after hypoxia (Fig. 2B). Additionally, decreased expression of 5-HT1A and 5-HT2A mRNA with hypoxia was also observed (Fig. 2C).
(A) CD4 + T cells were isolated from the spleen. (B) CD4 + T cells were cultured in normoxic or hypoxic environments for 24 h. The level of 5-HT was detected. (C) mRNA expression of 5-HT1A and 5-HT2A. Data represent the mean ± S.D. **p < 0.01.
We further explored whether 5-HT influences the balance between Th17 and Treg cells under hypoxic conditions. The results showed that Th17 cells increased and Treg cells decreased under hypoxia, whereas this trend was reversed after 5-HT treatment (Fig. 3A). RORγT and FOXP3 are specific transcription factors of Th17 and Treg cells, respectively, and are closely related to their differentiation. We found that RORγT expression was upregulated and FOXP3 was downregulated after hypoxia, but 5-HT reversed the effect of hypoxia on CD4 + T cells (Fig. 3B). We also determined the levels of Th17- and Treg-related cytokines IL-17, IL-22, IL-10, and TGF-β. Hypoxia significantly raised the mRNA levels of IL-17 and IL-22 while it reduced those of IL-10 and TGF-β in CD4 + T cells. However, hypoxia-induced influence was inhibited by 5-HT treatment (Fig. 3C). These findings suggested a hypoxia-induced reduction of 5-HT levels in CD4+ T cells, resulting in increased Th17 differentiation and decreased Treg differentiation.
(A) CD4 + T cells were treated with 5-HT (200 ng/mL) and then cultured in normoxic or hypoxic environments. The percentage of Th17 (IL-17+) and regulatory T cells (Treg, FOXP3+) in CD4 + T cells was assessed by flow cytometry. (B) mRNA expression of 5-HT1A and 5-HT2A. (C) mRNA expression of IL-17, IL-22, IL-10, and TGF-β. Data represent the mean ± S.D. **p < 0.01, and *p < 0.05.
PASMC dysfunction is thought to play a key role in PAH. First, the PASMCs in vitro were identified using SMC marker α-SMA (Fig. 4A). Whereafter, CD4 + T cells were co-cultured with PASMCs (Fig. 4B). Enhanced proliferation of PASMC is crucial for the mechanism underlying pulmonary vascular remodeling in PAH. Results from the CCK8 assay revealed that hypoxia-induced CD4 + T cells promoted PASMC viability, whereas hypoxia-induced CD4 + T cells with 5-HT treatment attenuated PASMC viability (Fig. 4C). Furthermore, as shown in Fig. 4D, Ki67 staining exhibited that hypoxia-induced CD4 + T cells led to a significant increase of Ki67-positive PASMCs compared with controls. Hypoxia-induced CD4 + T cells with 5-HT treatment reduced the increase in the proportion of Ki67-positive PASMCs (Fig. 4D). Moreover, hypoxia-induced the reduction of α-SMA protein expression, while the trend was reversed after 5-HT treatment (Fig. 4E).
(A) α-SMA expression in PASMCs was detected by immunofluorescent (IF) staining, scale bar: 50 µm. (B) CD4 + T cells were treated with 5-HT (200 ng/mL), and then cultured in normoxic or hypoxic environments. CD4 + T cells were cocultured with PASMCs for 24 h. (C) The cell viability in PASMCs was detected by CCK8 assay. (D) Ki67 expression in PASMCs, scale bar: 50 µm. (E) The protein expression of α-SMA. Data represent the mean ± S.D. **p < 0.01.
Abnormal PASMC migration and contraction are prominent pathophysiological processes of PAH. As shown in Figs. 5A and 5B, CD4 + T cells under hypoxia increased the migrated ability of PASMCs, which were partially suppressed by 5-HT. The contractile capability of PASMCs was enhanced after culture with hypoxia induced-CD4 + T cells, while 5-HT-treated CD4 + T cells suppressed PASMC contraction (Fig. 5C). Moreover, Ca2+-related signals are vital for PASMC migration and contraction. [Ca2+]i in PASMCs was detected using Fluo-4 AM. We found that hypoxia-induced CD4 + T cells exhibited a promotion effect on [Ca2+]i increase in PASMCs, but partially blocked by hypoxia-induced CD4 + T cells with 5-HT exposure (Fig. 5D).
Cell migration of PASMCs was assessed by (A) wound-healing assay and (B) transwell migration assay. (C) The contraction of PASMCs was determined by cell contraction assay. (D) Intracellular calcium was measured by Fluo-4/AM, scale bar: 100 µm. Data represent the mean ± S.D. **p < 0.01, and *p < 0.05.
The RhoA/ROCK signaling pathway is one of the important contributors to PASMC dysfunction in PAH. Hypoxia induced-CD4 + T cells upregulated RhoA and ROCK expression both in mRNA and protein levels (Figs. 6A, 6B).
(A) mRNA expression of RhoA and ROCK1. (B) Protein expression of RhoA and ROCK1. (C) Under hypoxia conditions, 5-HT expression in CD4+ T cells is decreased, which leads to CD4+ T cells being prone to differentiate toward Th17 cells, thus promoting the proliferation, migration, and contraction of PASMCs, and finally causing PAH. Data represent the mean ± S.D. **p < 0.01.
PAH is characterized by complex pathobiology including pulmonary vascular remodeling and stiffening of the pulmonary arteries.21) New therapies focusing on the endothelin, prostacyclin, and nitric oxide (NO) pathways have been developed in the past two decades. Endothelin receptor antagonists effectively improve pulmonary vascular resistance, exercise tolerance, and QOL. However, it may cause side effects such as abnormal liver function, edema, and anemia.22) Prostacyclin has strong vasodilation and anti-proliferation effects, while it is administered in a complex manner, causes side effects such as headache, and diarrhea, and long-term use may lead to drug tolerance.23) NO is an important vasodilator and improves pulmonary vascular resistance and motor capacity, but it may cause side effects such as low blood pressure, headaches, and indigestion. In addition, the regulation of the NO pathway has a limited effect on some patients.24) Although the above treatments have made progress in improving the symptoms and prognosis of patients with PAH, there are still limitations. In the present study, we provided evidence that the decreased level of 5-HT in CD4 + T cells under hypoxic conditions, caused the balance of Th17/Treg cells to tilt toward Th17 cells, thereby promoting PASMC proliferation, migration, and contraction (Fig. 6C). Our study suggests that therapeutic strategies targeting the 5-HT signaling pathway in immune regulation may be complementary or alternative to PAH treatment. Future studies should further explore the clinical translational potential of these new targets.
Previous studies have implicated 5-HT in the pathogenesis of PAH. Specifically, clinical studies confirm that patients with PAH have increased 5-HT levels both in serum and lung endothelial cells.20,25) Animal models of PAH reveal an increase in plasma 5-HT levels in hypoxic PAH rats.12) Our findings also demonstrated that 5-HT levels were raised in serum and lung tissues. However, in striking contrast, a hypoxic environment caused 5-HT levels to decrease in CD4+ T cells; moreover, the expression of the 5-HT receptor was downregulated, which also inhibited the uptake of 5-HT by CD4+ T cells from the outside. These findings also explained why 5-HT concentrations were reduced in CD4+ T cells but increased in serum. Thus, the role of 5-HT may vary across different cell types.
The T-lymphocyte subsets, which include Tregs and Th17, play different roles in PAH. Th17 cells cause inflammatory responses in hypoxia-induced PAH models by the secretion of IL-17, whereas suppression of Th17 cells attenuated the remodeling response to chronic hypoxia.6) In addition, it has been demonstrated that Treg cells contribute to immunosuppressive progress and alleviate PAH through regulating inflammation and inhibiting pulmonary artery remodeling.5) It can be seen that the Th17/Treg balance is critical for PAH. CD4+ T cell differentiation is significantly affected by 5-HT, especially the balance between Th17 and Treg cells. CD4 + T cells in 5-HT-deficient mice exhibit increased Th17 differentiation.16) It increases the production of pro-inflammatory factors such as IL-17A and IL-22. Additionally, 5-HT promotes the expression levels of Treg cell surface markers,17) and the loss of Treg cells further exacerbates the inflammatory response and tissue damage. To further investigate what role dose 5-HT plays in CD4 + T cells and whether this role affects PAH, CD4 + T cells were treated with hypoxia and we found that 5-HT also decreased after hypoxia. Besides, 5-HT exerts its biological functions via binding to various 5-HT receptors. In our work, the expression of 5-HT receptor 5-HT1A and 5-HT2A reduced in hypoxia-treated CD4 + T cells, suggesting that these functions were blocked to some extent. Furthermore, 5-HT treatment restored the Th17/Treg balance in CD4 + T cells under hypoxia conditions. The decrease in Tregs may be attributable to reduced expression of FOXP3, a transcription factor for maintaining Treg cell quantity and function.26) Similarly, increased Th17 cells are due to elevated RORγT mRNA expression levels.27) Our results were consistent with those reported in the literature, confirming that hypoxia-induced 5-HT inhibition caused an increase in the Th17/Treg ratio.
We next aimed to understand how 5-HT-caused CD4 + T cell differentiation involves PAH procession. The proliferation of PASMCs and migration of PASMCs to the intima are regarded as the main pathogenesis of pulmonary vascular remodeling.28,29) It has been reported that IL-17 promotes proliferation and migration of PASMCs.30) On the contrary, Treg treatment reduces PASMC proliferation.31) Consistent with the literature reports, our findings revealed that 5-HT-induced Treg cell differentiation blocked PASMC proliferation and migration. Moreover, PASMC contraction controls vascular lumen size and increases pulmonary vascular resistance.32) Our results also demonstrated that increased Treg cell differentiation caused by 5-HT alleviated PASMC contraction. These findings suggested that enhancement of the 5-HT level in CD4+ T cells effectively inhibited the pathological process of PASMCs. Additionally, if we analyze levels of 5-HT levels and 5-HT receptors in different T cell subpopulations, the pathological significance of 5-HT in the development and progression of PAH will be further illustrated. Future studies should address this limitation to better understand the contribution of CD4+ T cell-derived 5-HT to PAH pathogenesis.
In conclusion, our study proved that hypoxia-induced 5-HT decline disturbs the Th17/Treg balance and thus promotes PASMC proliferation, migration, and contraction, eventually aggravating PAH progression.
Our findings provide insights into the role of 5-HT in CD4+ T cell regulation under hypoxia, the analysis of the 5-HT release capacity, and 5-HT receptor expression of Treg and Th17 cells.
This research was supported by grants from the General Project of Shaanxi Provincial Department of Science and Technology-Social Development Field (Grant number 2021SF-256) and the Group Medical Aid Project of Department of Science and Technology of Xizang Autonomous Region (grant number XZ2019ZR-ZY73(Z)).
The authors declare no conflict of interest.
