2025 Volume 48 Issue 5 Pages 545-554
The central histamine system is involved in several physiological behaviors and neurological disorders, including the sleep–wake cycle, anxiety-related behaviors (both high and low anxiety), and attention deficit hyperactivity disorder (ADHD). Histamine is synthesized from l-histidine by histidine decarboxylase (HDC) and primarily metabolized by histamine-N-methyltransferase (HNMT) in the central nervous system. We previously reported that mice with intermittent sleep deprivation may exhibit impulsive-like symptoms resembling ADHD and low-anxiety behavior. However, the specific role of histaminergic systems in these behaviors remains unclear. In this study, we evaluated HDC expression levels in the hypothalamus as well as the expression of histamine H1 to H4 receptors and HNMT in the hypothalamus and frontal cortex of sleep-deprived mice. Moreover, the effects of administering histidine, a histamine precursor, and inhibitors of each histamine receptor on sleep deprivation-induced low-anxiety and impulsive-like behaviors were examined using an elevated plus maze test. The expressions of HDC and histamine H1 and H3 receptors in the hypothalamus increased, while that of histamine H1 receptors in the frontal cortex of sleep-deprived mice decreased. The low-anxiety and impulsive-like behaviors in intermittent sleep-deprived mice significantly decreased and increased, respectively, following the administration of histamine H1 and H3 receptor blockers and histidine. Collectively, these findings suggest that the low-anxiety behavior and impulsive-like ADHD symptoms induced by intermittent sleep deprivation may result from the overstimulation of histamine H1 and H3 receptors by elevated histamine, together with increased hypothalamic HDC expression. Furthermore, they suggest that sufficient sleep may contribute to ameliorating ADHD symptoms.
Histamine is synthesized from the amino acid l-histidine by histidine decarboxylase (HDC) and metabolized by histamine-N-methyltransferase (HNMT) in the central nervous system. Histamine acts on four G protein-coupled receptors: histamine H1, H2, H3, and H4 (coupling to Gαq, Gαs, Gαi/o, and Gαi/o proteins, respectively). Histamine-containing neurons are located in the tuberomammillary nucleus of the posterior hypothalamus and project to most regions in the brain. These neurons fire tonically and exclusively during wakefulness.1–4) Histamine also regulates various neurobiological functions and behavioral responses, including the sleep–wake cycle and both high- and low-anxiety-related behavior.1–13)
Schneider et al. reported the effects of administering histamine H1 and H2 receptor blockers on anxiety-related behaviors as well as anxiety-related behaviors in receptor-deficient mice.4) Moreover, Verma and Jain reported that ethanol-induced low-anxiety behavior is suppressed by histamine H2 receptor blockers but promoted by histamine H1 receptor blockers.6) Conversely, the phenotype of histamine H3 receptor-deficient mice has been suggested to exhibit both high and low anxiety, and administering histamine H3 receptor blockers induces anxiety-like behavior.5,8–10) Moreover, an absence of histamine H3 receptor stimulation may change the concentrations of non-histaminergic neurotransmitters, as the histamine H3 receptor acts not only as an auto-receptor for histamine but also as a hetero-receptor for other neurotransmitters.11,14) Research investigating histamine H4 receptor-deficient mice and histamine H4 receptor-associated drugs has demonstrated that the stimulation of histamine H4 receptors plays a role in low-anxiety behavior.5,12,13)
The elevated plus-maze (EPM) test is widely employed to investigate anxiety-related behavior, leveraging the natural aversion of rodents to open space.15,16) We previously investigated the effects of disturbed sleep habits on emotions using the platform method in mice subjected to intermittent sleep deprivation and observed abnormal behaviors, including low-anxiety, impulsive, hyperactive, and inattention-like behaviors.17–20) In addition, we previously demonstrated that low-anxiety behavior detected in the EPM test may serve as a useful animal model for replicating impulsivity-like symptoms in attention deficit hyperactivity disorder (ADHD).17) However, the role of histaminergic systems in the low-anxiety behavior and impulsive-like symptoms of ADHD associated with intermittent sleep deprivation has not been fully elucidated.
In the present study, we investigated the role of histamine in emotion regulation in sleep deprivation-induced low-anxiety and impulsive-like behaviors using histamine receptor blockers in a mouse model. We further examined HDC expression levels in the hypothalamus as well as the expression levels of histamine receptors and HNMT in the hypothalamus and frontal cortex of intermittent sleep-deprived mice. In addition, the effect of administering histidine, the histamine precursor, on low-anxiety and impulsive-like behaviors in intermittent sleep-deprived mice was investigated.
Male ddY mice (weight: 19–21 g; age: 4 weeks) were purchased from Japan SLC (Hamamatsu, Japan) and housed under constant temperature (23 ± 1°C) and humidity (55 ± 5°C) conditions, on a 12/12 h light–dark cycle (light from 0700 to 1900 h; dark from 1900 to 0700 h). The animals were provided with standard food and tap water ad libitum. All experiments were performed according to the protocol approved by the Ethics Committee for Care and Use of Laboratory Animals of Tohoku Medical and Pharmaceutical University (Ethic ID No. 19019-cn and No. 20062-cn). Moreover, all experiments complied with the ARRIVE guidelines and followed the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978).
Drugs and TreatmentThe following drugs were used: l-histidine (FUJIFILM Wako Pure Chemical Corporation, Osaka, Japan), pyrilamine (selective histamine H1 receptor blocker, Sigma-Aldrich, St. Louis, MO, U.S.A.), zolantidine (selective brain-penetrating histamine H2 receptor blocker, Tocris Bioscience, Minneapolis, MN, U.S.A.), thioperamide (histamine H3 receptor blocker, Sigma-Aldrich), and JNJ-7777120 (selective histamine H4 receptor blocker, Tocris Bioscience). JNJ-7777120 was suspended in saline containing 0.5% Tween 80; all other reagents were dissolved in saline. l-Histidine was intraperitoneally administered 120 min prior to the beginning of the behavioral test (volume: 0.2 mL/10 g body weight). Pyrilamine, zolantidine, and thioperamide were intraperitoneally administered 30 min before the start of the behavioral test (volume: 0.1 mL/10 g body weight). JNJ-7777120 was orally administered 60 min before the start of the behavioral test (volume: 0.1 mL/10 g body weight). The dose and routes of administration used in this study were based on those generally used in mouse and rat experiments.21–23)
Intermittent Sleep DeprivationThe small-platform method is commonly used to deprive rats and mice of rapid eye movement (REM) sleep. Although REM sleep deprivation causes significant physiological and psychological damage in experimental animals, we have modified this method to minimize the induced damage. Specifically, mice were deprived of REM sleep (20 h/d) intermittently using the small-platform method as reported by Yaoita et al.17) Briefly, a small platform (4.5 cm high, 1.8 cm diameter) was placed in the center of a plastic water tank cage (22.0 × 15.0 × 12.5 cm). The mice were individually placed on the platform for 20 h within the plastic water tank cage, which was filled with water to a height of 3.5 cm. After 20 h of REM sleep deprivation, each mouse was allowed to rest for 4 h in a normal plastic cage (22.0 × 15.0 × 12.5 cm). This was repeated until day 3 (intermittent sleep deprivation). All mice had ad libitum access to food and water during the trial period. Control groups were housed in plastic cages (32.0 × 21.0 × 12.5 cm).
Behavioral TestAnxiety-related and impulsive-like behaviors were evaluated using the EPM test.17,24) The apparatus used for the EPM consisted of two open arms without walls (6 × 30 cm) and two closed arms (6 × 30 cm) (10-cm walls), arranged facing each other, and a central platform (9 × 9 cm) that joined each arm crosswise. The floor and walls of the apparatus were constructed using acrylic plates and placed 40 cm above the floor. Initially, the animal was placed on the central platform of the maze with its head facing toward the closed arm. The activity of each mouse in the maze was recorded for 5 min using a video camera mounted on the ceiling. The time spent in the open arm without walls and the number of entries into each arm were automatically analyzed using ANY-maze software version 7 (Stoelting Company, Wood Dale, IL, U.S.A.). After each session, the test area was cleaned with a sheet soaked in 20% ethanol.
Quantitative PCR and Western BlottingThe mice were sacrificed by decapitation without anesthesia, and the hypothalamus and frontal cortex were isolated on ice, as described by Glowinski and Iversen.25) Briefly, the hypothalamus was carefully isolated to a depth of 2 mm using curved forceps. After removing the olfactory bulbs, the frontal cortex between the olfactory bulb side and the striatum side was dissected with a micro spatula in a scraping manner, while avoiding contact with the subcortical striatum. Total RNA was analyzed using a BioRad CFX96 system (Bio-Rad, Hercules, CA, U.S.A.). The relative expression of the target genes were determined using the 2–DCT method and normalized to the expression of elongation factor 1a1 (EF1a1).26) The primers and antibodies used in this study are listed in Tables 1 and 2, respectively. Western blotting was performed following the standard procedures.17)
| Gene | Forward | Reverse |
|---|---|---|
| HDC | CCGAGGGGGAGGTGTCTTAC | CGAGCGAGCTTCAGG |
| HNMT | CTTGCATGAGGAGCTTATTTTCT | CTGGGATTGAGCTGGATTTG |
| H1 receptor | TCTTTGGCATCCTCCCACCTC | ACCGCATVATCACTTCACCT |
| H2 receptor | TGTTCGCGTTGCCATCTCTTTG | GGTGCATTGCCCCTCTGGT |
| H3 receptor | AGCCCCGCACCAGACAAC | CAACGCCGGTCGCACAAG |
| H4 receptor | GAACGCCCAAACGGTGTG | AGCCTCTGGAACGCCT TGA |
| EF1a1 | ATTCCGGCAAGTCCACCACAA | CATCTCAGCAGCCTCCTTCTCAAAC |
| Antibody | Source |
|---|---|
| Anti-HDC antibody, rabbit polyclonal antibody | Abcam |
| Anti-GAPDH antibody, rabbit polyclonal antibody | Cell Signaling |
| Anti-rabbit IgG, HRP-linked antibody | Cell Signaling |
GraphPad Prism software version 8 (GraphPad Inc., San Diego, CA, U.S.A.) was used to perform statistical analysis. Experimental values are expressed as the mean ± standard error of the mean (S.E.M.). The statistical significance of the difference between two means was evaluated using a Student’s unpaired t-test, and a one-way ANOVA, followed by Dunnett’s or Tukey’s test, was used for multiple comparisons. p-Values of less than 0.05 were considered statistically significant.
First, to elucidate the role of the histamine system, we investigated the effects of the histamine precursor histidine on low-anxiety and impulsive-like behaviors in mice subjected to intermittent sleep deprivation. Figure 1B shows the total number of arm entries and the percentage of time spent in the open arms without walls when mice were administered histidine at the end of intermittent sleep deprivation. We found that histidine had a significant effect on the percentage of time spent in the open arms without walls in mice with intermittent sleep deprivation (one-way ANOVA [F (2, 19) = 4.195, p = 0.0310]; Fig. 1B, bottom). The post hoc Dunnett’s test revealed that the percentage of time spent in the open arm without walls was significantly higher in the histidine-treated intermittent sleep deprivation group (200 and 800 mg/kg) than in the saline-treated intermittent sleep deprivation group (p < 0.01; Fig. 1B, bottom). However, no significant differences were observed in the total number of arm entries in the intermittent sleep deprivation group (one-way ANOVA [F (2, 19) = 0.3628, p = 0.7004]; Fig. 1B, top). By contrast, there were no significant differences in the total number of arm entries and the percentage of time spent in the open arm without walls between the histidine-treated and saline-treated control groups (one-way ANOVA [F (2, 21) = 0.4280, p = 0.6574 (Fig. 1A, top)] and [F (2, 21) = 0.8501, p = 0.4415 (Fig. 1A, bottom)], respectively).
The upper panel shows the total number of arm entries, and the bottom panel shows the time spent in the open arm (%). The data are expressed as mean ± S.E.M., n = 8 (A), 7–8 (B). *p < 0.05 indicates a significant difference from the saline-treated group.
The exacerbation of low-anxiety and impulsive-like behaviors elicited by intermittent sleep deprivation following the administration of histidine in the above-described experiments suggests altered histamine regulation in intermittent sleep-deprived mice. Given that histamine is synthesized by HDC, we investigated HDC mRNA and protein expression levels in the hypothalamus in the intermittent sleep deprivation and control groups (Fig. 2). We revealed that mRNA and protein expression levels of HDC in the hypothalamus were significantly higher in the intermittent sleep deprivation group than in the control group (unpaired t-test: p = 0.0318 and 0.0024, respectively) (Fig. 2).
The data are expressed as mean ± S.E.M., n = 5 (A), 4 (B). *p < 0.05 and **p < 0.01 indicate significant differences from the control group.
We compared the differences in the mRNA expression levels of each histamine receptor in the hypothalamus and frontal cortex between the intermittent sleep deprivation and control groups (Fig. 3). The levels of histamine H1 and H3 receptor mRNA in the hypothalamus were significantly elevated in the intermittent sleep deprivation group compared with those in the control group (unpaired t-test: p = 0.0393 and 0.003, respectively) (Figs. 3A, 3C). Moreover, no significant changes in the expressions of histamine H2 and H4 receptors in the hypothalamus of intermittent sleep deprivation groups were observed (unpaired t-test: p = 0.4646 and p = 0.9595, respectively) (Figs. 3B, 3D). Additionally, in the frontal cortex, histamine H1 receptor mRNA levels were significantly lower in the intermittent sleep deprivation group than those in the control group (unpaired t-test: p = 0.0195) (Fig. 3A). No significant changes were observed in the expressions of histamine H2, H3, and H4 receptors in the frontal cortex of intermittent sleep deprivation groups (unpaired t-test: p = 0.1820, p = 0.7456, and p = 0.1123, respectively) (Figs. 3B–3D).
The data are expressed as mean ± S.E.M., n = 5. *p < 0.05 and **p < 0.01 indicate significant differences from the control group.
Given that histamine is primarily metabolized by HNMT in the brain, we subsequently compared HNMT mRNA expression levels in the hypothalamus and frontal cortex between the intermittent sleep deprivation and control groups.11) No significant changes in HNMT mRNA levels were observed in either the hypothalamus or frontal cortex between the intermittent sleep deprivation and control groups (unpaired t-test: p = 0.3411 and 0.9217, respectively) (Fig. 3E).
Effect of Histamine H1 and H3 Receptor Blockers on Low-Anxiety and Impulsive-Like Behaviors Induced by Intermittent Sleep Deprivation Evaluated Using the EPM TestFigures 4 and 5 show the improvements in low-anxiety and impulsive-like behaviors induced by intermittent sleep deprivation in the EPM test following the administration of pyrilamine (selective histamine H1 receptor blocker) and thioperamide (histamine H3 receptor blocker). One-way ANOVA revealed that pyrilamine and thioperamide had significantly different effects on the percentage of time spent in the open arms without walls in the intermittent sleep deprivation group (one-way ANOVA [F (2, 27) = 3.929, p = 0.0318 (Fig. 4B, bottom)] and [F (3, 39) = 3.419, p = 0.0255 (Fig. 5B, bottom)], respectively). The post-hoc Dunnett’s test revealed that the percentage of time spent in the open arms without walls was significantly lower in the pyrilamine-treated (15 mg/kg) and thioperamide-treated (5 mg/kg) intermittent sleep deprivation groups than that in the saline-treated intermittent sleep deprivation group (p < 0.0177, Fig. 4B, bottom; p < 0.0232, Fig. 5B, bottom, respectively). However, no significant differences were observed in the total number of arm entries between the pyrilamine-and thioperamide-treated intermittent sleep deprivation groups (one-way ANOVA [F (2, 27) = 1.320, p = 0.2839 (Fig. 4B, top)] and [F (3, 39) = 1.417, p = 0.2523 (Fig. 5B, top)], respectively).
The upper panels show the total number of arm entries, and the bottom panels show the time spent in the open arm (%). The data are expressed as mean ± S.E.M., n = 8–10 (A), 8–11 (B). *p < 0.05 indicates a significant difference from the saline-treated group.
The upper panels show the total number of arm entries, and the bottom panels show the time spent in the open arm (%). The data are expressed as mean ± S.E.M., n = 10–12 (A), 8–15 (B). *p < 0.05 indicates a significant difference from the saline-treated group.
Furthermore, there were no significant differences in the total number of arm entries and the percentage of time spent in the open arms without walls between the zolantidine-treated (selective brain-penetrating histamine H2 receptor blocker) and saline-treated intermittent sleep deprivation groups (one-way ANOVA [F (2, 32) = 0.9552, p = 0.3954 (Fig. 6B, top)] and [F (2, 32) = 3.059, p = 0.0608 (Fig. 6B, bottom)], respectively). Similarly, no significant differences were observed in the total number of arm entries and the percentage of time spent in the open arms without walls between the JNJ-7777120-treated (selective histamine H4 receptor blocker) and tween-treated intermittent sleep deprivation groups (one-way ANOVA [F (2, 18) = 2.650, p = 0.0980 (Fig. 7B, top)] and [F (2, 18) = 1.018, p = 0.3810 (Fig. 7B, bottom)], respectively).
The upper panels show the total number of arm entries, and the bottom panels show the time spent in the open arm (%). The data are expressed as mean ± S.E.M., n = 8–10 (A), 10–15 (B).
The upper panels show the total number of arm entries, and the bottom panels show the time spent in the open arm (%). The data are expressed as mean ± S.E.M., n = 8–12 (A), 5–8 (B).
As depicted in Fig. 4A (pyrilamine), 5A (thioperamide), 6A (zolantidine), and 7A (JNJ-777120), the administration of each drug had no significant effect on the total number of arm entries and the percentage of time spent in the open arms without walls in the control group (one-way ANOVA [F (2, 24) = 1.639, p = 0.2152 (Fig. 4A, top)]; [F (2, 24) = 1.702, p = 0.2035 (Fig. 4A, bottom)]; [F (3, 38) = 1.274, p = 0.2970 (Fig. 5A, top)]; [F (3, 38) = 2.368, p = 0.0859 (Fig. 5A, bottom)]; [F (2, 24) = 1.642, p = 0.2146 (Fig. 6A, top)]; [F (2, 24) = 1.161, p = 0.3301 (Fig. 6A, bottom)]; [F (2, 26) = 0.01125, p = 0.9878 (Fig. 7A, top)]; and [F (2, 26) = 0.4897, p = 0.6183 (Fig. 7A, bottom)], respectively).
The key findings of the present study can be summarized as follows: (i) low-anxiety and impulsive-like behaviors induced by intermittent sleep deprivation observed in EPM tests were intensified by the administration of l-histidine (Fig. 1); (ii) both HDC mRNA and protein expression levels were elevated in the hypothalamus of intermittent sleep-deprived mice (Fig. 2); (iii) histamine H1 and H3 receptor mRNA expression levels were significantly increased in the hypothalamus of intermittent sleep-deprived mice, but not those of HNMT and histamine H2 and H4 receptors (Fig. 3); (iv) in the frontal cortex of intermittent sleep-deprived mice, histamine H1 receptor mRNA expression levels were significantly reduced, but not those of HNMT and histamine H2, H3, and H4 receptors (Fig. 3); and (v) low-anxiety and impulsive-like behaviors induced by intermittent sleep deprivation in the EPM test were improved by administering histamine H1 and H3 receptor blockers (Figs. 4 and 5), but not histamine H2 and H4 receptor blockers (Figs. 6 and 7).
The central histamine system regulates diverse physiological functions, including the sleep–wake cycle.2,3) Moreover, HDC knock-out mice exhibit sleep fragmentation and increased REM sleep during the light period.2) In addition, we previously demonstrated that intermittent sleep deprivation in mice induces low-anxiety and impulsive-like behaviors.17) Moreover, HDC knock-out mice and animals fed an l-histidine-deficient diet exhibit high levels of anxiety.27,28) In the present study, we found that the mRNA and protein expression levels of HDC in the hypothalamus of intermittent sleep-deprived mice were increased, and administering l-histidine amplified the low-anxiety and impulsive-like behaviors. These findings suggest that the elevated amount of histamine produced in the hypothalamus of intermittent sleep-deprived mice may play a role in the development of low-anxiety and impulsive-like behaviors.
It is established that histamine H1 to H4 receptors are widely present in the brain.1) Investigating the mRNA expression levels of each histamine receptor in the hypothalamus and frontal cortex of intermittent sleep-deprived mice revealed that the mRNA expression levels of histamine H1 and H3 receptors in the hypothalamus were increased, while the expression of histamine H2 and H4 remained unchanged. The H1 receptor is coupled to phospholipase C (PLC) through Gαq.2,4) Das et al. reported that stimulation of the histamine H1 receptor up-regulated both the mRNA and protein expression levels of the histamine H1 receptor.29) The administration of histamine or histamine H1 receptor agonists induces wakefulness, whereas histamine H1 receptor blockers promote sleep.2) Intermittent sleep-deprived mice have been demonstrated to exhibit hyperactivity rather than falling asleep, even immediately after completing 3–5 d of intermittent sleep deprivation.17–20) These findings suggest that histamine H1 receptor signaling, including the activation of PLC and the increase in inositol triphosphate (IP3) and diacylglycerol (DAG) concentrations, may increase in the hypothalamus of intermittent sleep-deprived mice, and the increase in the expression levels of histamine H1 receptors in the hypothalamus may play a role in maintaining wakefulness, similar to the increases in HDC mRNA and protein expression levels described above.
The histamine H3 receptor, found in neuronal cells in the brain, functions as both an auto- and hetero-receptor.11,14) The stimulation of the histamine H3 receptor inhibits adenylyl cyclase (AC) and decreases cyclic adenosine monophosphate (cAMP) concentrations.2,5) Specifically, as an auto-receptor, the histamine H3 receptor regulates the synthesis and release of histamine; its activation suppresses histamine release and promotes sleep. Conversely, inhibition of the histamine H3 receptor promotes wakefulness in conditions such as narcolepsy.2,3) The release of histamine in the hypothalamus and other target regions is at its peak during wakefulness.2) In this study, although the mice remained awake after intermittent sleep deprivation was concluded, we observed a significant increase in histamine H3 receptor expression levels in the hypothalamus, a significant decrease in histamine H1 receptor expression levels, and a trend toward non-significant decreases in histamine H2 and H4 receptor expression levels in the frontal cortex. These findings suggest that histamine levels may be increased in the hypothalamus; however, stimulation of receptors in areas projecting from the hypothalamus, such as the frontal cortex, may remain insufficient, indicating that reduced histamine levels in the frontal cortex may be associated with a decrease in cAMP concentration due to the overstimulation of Gαi/o-coupled histamine H3 receptors in the hypothalamus.
The central histamine system is also involved in anxiety-related behaviors in animals, and all histamine receptors, from H1 to H4, have been implicated in anxiety-related behaviors (both high and low anxiety).1,3–14) We revealed that administering selective histamine H1 and H3 receptor blockers improved intermittent sleep deprivation-elicited low-anxiety and impulsive-like behaviors. Conversely, histamine H2 and H4 receptor blockers had no effect, indicating that intermittent sleep deprivation-induced low-anxiety and impulsive-like behavior is caused by stimulation of histamine of H1 and H3 receptors.
The administration of histamine H1 receptor blockers is reported to induce anxiety-like behavior or suppress low-anxiety behaviors, indicating that histamine H1 receptor blockers increase anxiety behavior.6,30–32) These reports support the findings of the present study, wherein low-anxiety and impulsive-like behaviors induced by intermittent sleep deprivation in mice were suppressed by the selective histamine H1 receptor blocker pyrilamine. However, some studies have reported contrasting findings.4) In addition, Easton et al. reported that the induction of both high- and low-anxiety behaviors via the histamine H1 receptor depends on the drug dose, administration site, species differences, and type of behavioral experiment used.31) Conversely, Zarrindast et al. reported that microinjection of pyrilamine into the hippocampal CA1 region improves histamine-induced low-anxiety behavior in the EPM test.32) Therefore, it is speculated that the increased histamine H1 receptor signaling in the hippocampal CA1 region may be involved in the low-anxiety and impulsive-like behaviors observed in intermittent sleep-deprived mice.
Histamine H3 receptor knock-out mice exhibit both high- and low-anxiety phenotypes.5,8–10) Rizk et al. reported that these differences arise as a result of anxiety-inducing situations.8) Because histamine H3 receptors are coupled to Gαi/o, histaminergic neurons are activated by histamine H3 receptor blockers, increasing the levels of histamine and other neurotransmitters such as serotonin, substance P, GABA, glutamate, acetylcholine, norepinephrine, and dopamine in the brain.11,14) However, the detailed mechanisms underlying histamine H3 receptor inhibition, particularly the specific auto- or hetero-receptors responsible for histamine H3 receptor-mediated behavioral changes, have not been fully elucidated. Meanwhile, Imaizumi and Onodera reported that the histamine H3 receptor blocker thioperamide induces anxiogenic effects.9) Moreover, Lee et al. found that thioperamide alleviated drug-induced low-anxiety behavior.33) These reports support the results of this study, which demonstrated that thioperamide improved low-anxiety and impulsive-like behaviors in intermittent sleep-deprived mice.
The nucleus accumbens has gained prominence as a candidate brain region involved in the low-anxiety and impulsive-like behavior induced by histamine H3 receptor stimulation. Zhang et al. reported that histaminergic neurons selectively inhibit glutamatergic synaptic transmission via histamine H3 receptors in the nucleus accumbens, producing an anxiolytic effect (low-anxiety behavior).34) Although the nucleus accumbens was not examined in this study, it is speculated that the low-anxiety and impulsive-like behaviors in intermittent sleep-deprived mice may be linked to the inhibition of glutamate neurons in this region mediated by histamine H3 receptors.
The central histamine nervous system is also known to play a role in neurological disorders such as ADHD.35,36) It is known that the administration of ADHD medications such as methylphenidate increases histamine levels in the frontal cortex of rats and that this increase may contribute to the improvement of ADHD symptoms.37,38) Previously, we reported that intermittent REM sleep deprivation induces various abnormal behaviors, including low-anxiety behavior and impulsive-like symptoms, which can be used as a model that simulates ADHD symptoms.17) Furthermore, Darweesh et al. recently reported that patients with ADHD have markedly decreased REM sleep time, which has a significant impact on symptoms,39) further supporting our ADHD model.17–20) Therefore, the results of this study suggest that increased H1 and H3 receptor signaling in the hypothalamus and decreased H1 signaling in the frontal cortex may contribute to the symptoms of ADHD and that sufficient sleep may help alleviate these symptoms.
In this study, we used the EPM test to evaluate anxiety-related and impulsive-like behaviors based on previous reports.15–20,24) Besides the EPM test, there are other experimental methods to evaluate them. However, anxiety-related behaviors have been reported to depend on the type of behavioral experimental methods, the drug dose, the administration site, and the species differences.31) Therefore, using different methods may clarify new findings and deeper interpretations. Additionally, while this study examined the expression levels of each histamine receptor in the hypothalamus and frontal cortex, specific locations and cell types require further investigation to clarify their detailed functions.
In conclusion, these findings suggest that the low-anxiety behaviors and impulsive-like symptoms of ADHD induced by intermittent sleep deprivation may be caused by overstimulation of histamine H1 and H3 receptors by elevated histamine, accompanied with elevated hypothalamic HDC expression. Therefore, our findings suggest that sufficient sleep may contribute toward alleviating ADHD symptoms.
This study was supported by JSPS KAKENHI Grant Nos. 24700433, 26500014, 17K00768, 19K10229, and 22K05528. The authors declare no potential conflicts of interest with respect to the authorship and/or publication of this article.
H. I. and K. K. contributed to the conception, design, data acquisition, analysis, and interpretation. F. Y. contributed to the conception, design, data acquisition, analysis, and interpretation, drafted and critically revised the manuscript. M. T. and K. T.-N. contributed to the conception and design and critically revised the manuscript. All authors have given final approval and agreed to be accountable for all aspects of the work.
The authors declare no conflict of interest.
