2025 Volume 48 Issue 5 Pages 606-612
Detecting low-frequency genetic mutations is crucial for genetic testing, especially in cancer diagnostics. Wild-type blocking PCR identifies these genetic mutations using a blocking oligonucleotide that is fully complementary to wild-type DNA. The blocking oligonucleotide selectively binds to wild-type DNA, inhibiting its amplification by DNA polymerase and allowing preferential amplification of mutant DNA. Bridged nucleic acids (BNAs), with high binding affinities for cDNA, are often incorporated into the blocking oligonucleotide to enhance inhibition. However, the effects of BNA positioning within the blocking oligonucleotide on wild-type DNA amplification inhibition are poorly understood. To address this issue, we evaluated the effects of different BNA positions on amplification inhibition efficacy by comparing blocking oligonucleotides with varying numbers of BNAs at the 5′ end, 3′ end, and central region. Results indicated that BNAs at the 5′ end enhanced the inhibition efficacy, whereas BNAs at the 3′ end notably diminished the inhibition efficacy. Likewise, increasing the number of BNAs in the central region generally decreased the inhibition efficacy. This is one of the first studies to report the importance of BNA positioning in the amplification inhibition efficacy of blocking oligonucleotides.
Methods for detecting low-frequency genetic mutations are essential for genetic testing, especially for cancer diagnostics.1) Wild-type blocking PCR (WTB-PCR) is an effective method for identifying low-frequency genetic mutations. WTB-PCR uses a blocking oligonucleotide (BON) that is fully complementary to the wild-type DNA. During the PCR extension phase, the BON binds downstream of the primer, thereby inhibiting DNA polymerase-mediated elongation and suppressing wild-type DNA amplification. By contrast, BON cannot effectively bind to mutant DNA because of mismatches at the mutation site, resulting in preferential mutant DNA amplification (Fig. 1). To achieve this selective amplification, BONs should be designed to exhibit differential binding affinities to wild-type and mutant DNA.
(A) During the PCR extension phase, the blocking oligonucleotide (BON) binds downstream of the primer, thereby inhibiting DNA polymerase-mediated elongation and suppressing the amplification of wild-type DNA. (B) The BON does not effectively bind to the mutant DNA due to the mismatches at the mutation site, resulting in preferential mutant DNA amplification.
BONs can be composed of either DNA or RNA.2–4) However, nucleic acid analogs, such as bridged nucleic acids (BNAs) and peptide nucleic acids (PNAs), are frequently used to enhance selective wild-type DNA amplification inhibition.5–8) 2′,4′-BNA/LNA was the first BNA developed in 1997,9,10) featuring a methylene bridge between the 2′-oxygen and 4′-carbon of the ribose ring. Since then, various BNA derivatives have been developed, including 2′,4′-BNANC[NMe].11,12) The chemical bridge stabilizes the furanose ring of the BNAs in the N-type conformation, reducing entropy loss during hybridization with complementary strands and thereby enhancing binding affinity. In contrast to PNAs, BNAs can be incorporated at any position within oligonucleotides, providing flexibility when designing BONs that effectively inhibit wild-type DNA amplification. However, the impact of BNA positioning on amplification inhibition efficacy is not yet well understood.
This study aimed to investigate the effects of BNA positioning on the amplification inhibition efficacy of BONs. In this study, we focused on how positioning BNAs within BONs affects the efficacy of inhibiting wild-type DNA amplification. The inhibition efficacy of BONs with varying BNA positions was assessed using real-time PCR.
Previous studies have reported BONs ranging from 6 to over 20 bases; however, a consensus regarding their optimal length remains elusive. Selecting an appropriate length is critical for achieving optimal specificity and binding affinity. Oligonucleotides should generally be >18 bases to specifically bind to a single target sequence within the 3.2 billion base pairs of the human genome.13) While longer oligonucleotides increase specificity, they may exhibit binding affinity even with a single mismatch, inhibiting the amplification of both wild-type and mutant DNA. We designed an 18-base blocking oligonucleotide to balance specificity and affinity. Blocking oligonucleotide variants were designed by incorporating BNAs at various positions: 5′ end, 3′ end, and central region of the oligonucleotide (Fig. 2A). We used 2′,4′-BNANC[NMe] as a BNA in this study, containing a six-membered bridged structure with an N-O linkage.8)
(A) BON variants were synthesized for this study. The nomenclature for BONs reflects the sequential arrangement of BNA and DNA bases from the 5′ end. (B) Evaluation of the amplification inhibition efficacy of BONs. The difference in cycle threshold (Ct) with and without BON (ΔCt) was used to indicate inhibition efficacy, where a higher ΔCt suggests greater inhibition efficacy.
DNA oligonucleotides and BONs were synthesized and purified using high-performance liquid chromatography by GeneDesign (Osaka, Japan). Table 1 lists the oligonucleotide sequences. The model template DNA was synthesized by EuroFins Genomics (Tokyo, Japan). The plasmid was constructed by incorporating randomly designed sequences into the pEX-A2J2 vector. Three random sequences of the model template DNA, each comprising 150 bases, were generated using the RAND function in Microsoft Excel 2021. Supplementary Fig. 1 presents the designed sequences and positions of the primers and BONs.
| Template | Forward primer | BON | Reverse primer |
|---|---|---|---|
| Template A | ACGCAGATGGAACGTAGACC | ACAACCCTGCAGTGTGCG | CTGTCAGCCATATGGTCCGG |
| Template B | CCGGACCATATGGCTGACAG | ATTAGGGGATCCTTGGCC | TGTACCAGGTCAGAGCTTCAG |
| Template C | CTGAAGCTCTGACCTGGTACA | GGTGCCTCTAGAACTCGC | GCTCCGCTTTAAGTTCGTGA |
Each sequence is presented in the 5′ to 3′ direction. Supplementary Fig. 1 shows the position of each oligonucleotide along the template DNA.
Real-time PCR was performed using SuperFi II DNA polymerase (Thermo Fisher Scientific, MA, U.S.A., #12361050), known for its high fidelity, to minimize the occurrence and subsequent amplification of mutant DNA resulting from PCR errors. The amplification process was monitored by measuring the fluorescence intensity of EvaGreen Plus dye (Biotium, CA, U.S.A., #31077), which emits fluorescence after binding to double-stranded DNA. The reaction mixture composition was: 1 × SuperFi II Buffer, 200 μM of dNTPs (Thermo Fisher Scientific, #R0192), 1 × SuperFi II DNA polymerase, 1 × EvaGreen Plus, 25 nM of ROX reference dye (Thermo Fisher Scientific, #12223012), 100 fg of template plasmid, 0.5 μM of forward primer, 0.5 μM of reverse primer, and varying BON concentrations. Reactions were carried out on the QuantStudio 5 system (Thermo Fisher Scientific, #A28133) with the following thermal cycling protocol: initial denaturation at 98°C for 30 s, followed by 40 cycles of 98°C for 10 s, 60°C for 10 s, and 72°C for 15 s. The inhibition efficacy of each blocking oligonucleotide was quantified by measuring the increase in the cycle threshold (Ct) in the presence of blocking oligonucleotide (ΔCt; Fig. 2B). Ct is the cycle number at which the fluorescence signal exceeds a certain threshold.
Statistical AnalysisAll results are presented as the mean ± standard deviation (S.D.) from three technical replicates. Statistical analysis was conducted using Welch’s t-test, and p-values were adjusted using Holm’s method to correct for multiple comparisons. The analysis was performed using the R software (version 4.2.3), and p-values < 0.05 were considered statistically significant.
We selected 18 nucleotides as the length of BONs to balance specificity and affinity, as described in the “Materials and Methods.” We synthesized BONs by incorporating BNAs at various positions: the 5′ end, 3′ end, and central region of the oligonucleotide (Fig. 2A). As a reference BON, we developed BON 1-6-4-7-0. In this construct, a single BNA was placed at the 5′ end to inhibit DNA polymerase extension; 4 BNAs were integrated into the central region, which is assumed to have a mismatch with mutant DNA, to enhance the differential binding affinity of the BON to the wild-type versus mutant DNA. The nomenclature for the BONs reflects the sequential arrangement of the BNAs and DNA bases from the 5′ end, and the number of BNAs is underlined. For example, “BON 1-7-2-8-0” indicates a sequence starting with 1 BNA base, followed by 7 DNA bases, 2 BNA bases, 8 DNA bases, and then 0 BNA base (Fig. 2A).
Evaluation of Amplification Inhibition by BONWe used real-time PCR and the fluorescent dye EvaGreen Plus to evaluate the effect of BNA positioning on the inhibition of amplification by BON, as described in the “Materials and Methods.” Considering the potential impact of DNA sequence variability on inhibition efficacy, we synthesized three distinct 150-base pair artificial sequences (Template A, Template B, and Template C) as model template DNAs. Specific primers and BONs for each sequence were synthesized and evaluated (Table 1, Supplementary Fig. 1).
Effects of BNAs at the 3′ EndTo evaluate the effect of adding BNA at the 3′ end of BONs on amplification inhibition efficacy, we compared the reference construct BON 1-6-4-7-0 to BON 1-6-4-6-1, which includes an additional BNA at the 3′ end. We also designed BON 1-7-3-7-0 and BON 1-7-3-6-1, containing three BNAs in the central region instead of four (i.e., BON 1-6-4-7-0 and BON 1-6-4-6-1) and assessed their inhibition efficacy (Fig. 2A, 3′ BNA variants). For Template A, BON 1-6-4-7-0 and BON 1-7-3-7-0, lacking BNA at the 3′ end, increased the Ct value by up to 10 cycles and showed concentration-dependent amplification inhibition (Fig. 3A; orange and green circles, respectively). By contrast, BON 1-6-4-6-1 and BON 1-7-3-6-1, with BNAs at their 3′ ends, exhibited minimal inhibition across all tested BON concentrations (Fig. 3A; orange and green squares, respectively). Although the degree of amplification inhibition differed from that of Template A, similar trends were observed for Templates B and C; BON 1-6-4-7-0 and BON 1-7-3-6-1 exhibited concentration-dependent inhibition, whereas BON 1-6-4-6-1 and BON 1-7-3-6-1 showed negligible inhibition at any concentration (Figs. 3B, 3C). These results indicate that regardless of the template sequence, adding BNA at the 3′ end of BON eliminates amplification inhibition. Based on these findings, subsequent investigations were conducted using BON without a BNA at the 3′ end.
The ΔCt values for different BON concentrations, with and without BNA at the 3′ end, are represented by squares and circles, respectively. Each panel shows the result for the specified template. A higher ΔCt indicates greater inhibition efficacy. Data represent the mean ± S.D. from three technical replicates.
Incorporating BNAs at the 5′ end is essential for effective amplification inhibition as the 5′ end of the BON interacts with DNA polymerase, sterically blocking DNA elongation. To evaluate the effects of the number of BNAs at the 5′ end on the amplification inhibition efficacy, we compared the inhibition efficacy of BON 1-6-4-7-0 with that of BON 3-4-4-7-0, which included two additional BNAs at the 5′ end. Similar to the 3′ end evaluations, we designed additional BONs, BON 1-6-5-6-0 and BON 3-4-5-6-0, to evaluate the inhibition efficacy (Fig. 2A, 5′ BNA variants).
Using Template A, BON 3-4-4-7-0 demonstrated greater amplification inhibition across all BON concentrations than BON 1-6-4-7-0 (Fig. 4A). Although the differences in amplification inhibition were less pronounced for Templates B and C, BON 3-4-4-7-0 consistently showed enhanced inhibition efficacy at all concentrations. Similarly, BON 3-4-5-6-0 exhibited greater amplification inhibition than BON 1-6-5-6-0 across all templates (Figs. 4D–4F). The impact of increasing BNAs at the 5′ end was more pronounced in BONs with five BNAs in the central region (BON 1-6-5-6-0 and BON 3-4-5-6-0: Figs. 4D–4F) than in those with four BNAs (BON 1-6-4-7-0 and BON 3-4-4-7-0: Figs. 4A–4C). However, a consistent trend was observed where an increase in BNAs at the 5′ end correlated with greater amplification inhibition efficacy.
The ΔCt values for different concentrations of (A–C) BON 1-6-4-7-0 and BON 3-4-4-7-0, and (D–F) BON 1-6-5-6-0 and BON 3-4-5-6-0 are represented by circles and triangles, respectively. Each panel shows the result for the specified template. Data represent the mean ± S.D. from three technical replicates.
We designed and evaluated a series of BONs to evaluate the effect of the number of BNAs in the central region on the amplification inhibition efficacy. The variants were derived from BON 1-6-4-7-0 and varied in the number of BNAs, ranging from 2 to 5 (Fig. 2A, central BNA variants). For variants with an odd number of BNAs, two constructs were synthesized. For one construct, the BNAs were positioned more toward the 5′ end, and for the other, they were positioned more toward the 3′ end, as illustrated by BON 1-6-3-8-0 and BON 1-7-3-7-0 (Fig. 2).
Initially, we evaluated the amplification inhibition efficacy of these variants at various concentrations. BON 1-6-5-6-0 exhibited reduced amplification inhibition across all concentrations and templates tested (Figs. 5A–5C; solid red line). The differences in the degree of amplification inhibition among the BON variants decreased as the concentration increased (Figs. 5A–5C; e.g., 2.0 μM).
(A–C) The ΔCt values for different BON concentrations containing various numbers of BNAs are shown in the graph. (D–F) The ΔCt values for the BONs at 0.25 μM are compared. Statistical significance of all combinations of groups was tested using Welch’s t-test, with p-values adjusted using Holm’s method. Statistically significant differences are demonstrated using compact letter display. Groups not sharing any letter are significantly different (p < 0.05). Supplementary Table 1 shows the exact p-value of each comparison. Each panel shows the result for the specified template. Bars represent the mean ± S.D. from three technical replicates, and points represent the ΔCt values for each replicate.
Subsequently, we compared the inhibition efficacy of each BON at a concentration of 0.25 μM, which is below the concentration at which the inhibition efficacy plateaued (Figs. 5D–5F). For Template C, no significant differences were observed among the BON variants, except for BON 1-6-5-6-0 (Fig. 5F). For Templates A and B, the most significant amplification inhibition was observed with BON 1-6-3-8-0, and the inhibition efficacy decreased with an increase in the number of BNAs in the central region. Furthermore, when comparing the two constructs of BON variants containing the same odd number of BNAs in the central region, the construct with BNAs positioned toward the 5′ end demonstrated significantly greater inhibition efficacy (Figs. 5D, 5E; striped bar vs. solid bar). For instance, both BON 1-5-5-7-0 and BON 1-6-5-6-0 contain five BNAs in the central region, but BON 1-5-5-7-0 exhibited significantly greater amplification inhibition.
We examined the influence of the BNA positioning in BONs on the inhibition of wild-type DNA amplification. Although the degree of amplification inhibition varied among the templates used, the impact of BNA positioning was similar. BNA incorporation at the 3′ end diminished the inhibitory effect, whereas incorporation at the 5′ end enhanced the inhibition efficacy. Increasing the number of BNAs near the 3′ end within the central region generally decreased the inhibition efficacy.
Originally, we designed three templates to evaluate the potential impact of DNA sequence variability on the inhibition efficacy. Variability in amplification inhibition was observed across the templates with the greatest amplification inhibition observed with Template C, followed by B and A. Therefore, DNA sequence variability is likely to affect amplification inhibition. BONs with greater GC content near the 5′ end exhibited greater amplification inhibition, possibly due to stronger binding affinity near the 5′ end. Another possibility is that the higher-order structure of the template DNAs differed among Templates A, B, and C, affecting the accessibility of BON to the templates. Despite the differences observed among the templates, a similar trend in the impact of BNA positioning on amplification inhibition was observed, indicating that the positioning of the BNAs is critical for inhibition efficacy.
WTB-PCR uses BONs to bind to the template DNA to terminate DNA extension (Fig. 1). Thus, the binding affinity of the BONs to the template DNA is an important factor affecting inhibition efficacy. The introduction of 2′,4′-BNANC[NMe] was previously found to enhance the binding affinity of the oligonucleotide with complementary strands.14) Thus, incorporating BNAs, regardless of their positioning within the BON, was anticipated to enhance the inhibition efficacy. However, BNAs at the 3′ end or in the central region of the BONs reduced the inhibition efficacy. Notably, BNA at the 3′ end almost eliminated the inhibition efficacy.
The mechanism underlying the loss of inhibition efficacy when BNAs are positioned at the 3′ end is unclear. One hypothesis is that BONs lacking BNA at the 3′ end are elongated by DNA polymerase, stabilizing BON-template binding. The bulky structure of BNA at the 3′ end may obstruct elongation and stabilization, diminishing the inhibition efficacy. However, previous research on WTB-PCR has shown amplification inhibition using non-extendable BONs, such as those fully substituted with PNA or modified with a C3-spacer at the 3′ end.7,15) As these non-extendable BONs contained a higher modified nucleic acid proportion compared with the BONs used in this study, it is conceivable that they did not require extension due to their higher binding affinity.
In the central region, the most significant amplification inhibition was observed with BON 1-6-3-8-0, and the inhibition efficacy decreased with an increase in the number of BNAs. Comparison of BONs with an equivalent odd number of BNAs in the central region revealed that constructs with BNAs positioned toward the 3′ end showed significantly lower inhibition efficacy than those positioned toward the 5′ end. The SuperFi II DNA polymerase used in this study is assumed to be made based on an archaeal DNA polymerase,16) and it has been reported that one of the archaeal DNA polymerases, KOD polymerase, interacts with primers up to the 7th base from the 3′ end.17) This suggests that introducing BNAs up to the 7th position could disrupt the interaction of SuperFi II DNA polymerase and BON (equivalent to primer in the above case), thereby obstructing BON extension. Other factors may also be involved in the difference in inhibition efficacy since BON 1-6-4-7-0 and BON 1-5-5-7-0 demonstrated differences in inhibition efficacy despite having the same 7 unmodified DNA at the 3′ end.
In our evaluations of BNAs at the 5′ end, the inhibition efficacy was enhanced when the number of BNAs was increased. DNA polymerases that exhibit 5′–3′ exonuclease activity (e.g., Taq DNA polymerase) are known to degrade the 5′ end of the BON. Hence, previous studies introduced modified nucleic acids at the 5′ end to prevent this degradation.2) However, the occurrence of degradation was considered negligible in this study because SuperFi II DNA polymerase does not exhibit 5′–3′ exonuclease activity. Thus, BNAs at the 5′ end likely enhance amplification inhibition by increasing local binding affinity (Fig. 1).
In conclusion, our study demonstrated that the amplification inhibition efficacy of BONs depends on the positioning of the BNAs. Incorporation of BNAs at the 5′ end enhanced the inhibition efficacy, whereas incorporation at the 3′ end and central region reduced the inhibition efficacy. To the best of our knowledge, this is the first study to reveal the significant contribution of modified nucleic acid positioning on the amplification inhibition efficacy. We anticipated that BNAs will increase binding affinity and thus inhibition efficacy when incorporated into the BON; however, our results showed a reduction in inhibition efficacy when BNAs were incorporated at the 3′ end and central region of the BON. This unexpected finding provides valuable insight into future BON design. Future research exploring the differences in the inhibition efficacy between wild-type and mutant DNA sequences may further elucidate optimal BON designs.
This work was supported by JSPS KAKENHI Grant No. JP22K18235 and AMED Grant Nos.: JP19mk0101163, JP23mk0121255, and JP24mk0121290.
The authors declare no conflict of interest.
This article contains supplementary materials.
