Protective effect of alirocumab, a PCSK9 inhibitor, on the sciatic nerve of rats with diabetic peripheral neuropathy

Abstract

Dyslipidemia has been considered a risk factor for diabetic peripheral neuropathy. Proprotein convertase subtilisin-like/Kexin 9 inhibitor (PCSK9) inhibitors are a new type of lipid-lowering drug currently in clinical use. The role of PCSK9 in diabetic peripheral neuropathy is still unclear. In this study, the effect of alirocumab, a PCSK9 inhibitor, on the sciatic nerve in rats with diabetic peripheral neuropathy and its underlying mechanisms were investigated. The diabetic peripheral neuropathy rat model was established by using a high-fat diet combined with streptozotocin injection, and experimental subjects were divided into normal, diabetic peripheral neuropathy, and alirocumab groups. The results showed that Alirocumab improved nerve conduction, morphological changes, and small fiber deficits in rats with DPN, possibly related to its amelioration of oxidative stress and the inflammatory response.

DIABETIC PERIPHERAL NEUROPATHY (DPN) is one of the most prevalent complications of diabetes [1, 2]. Nearly half of patients with diabetes have developed neuropathy during their lifetime [3]. Clinically, patients with DPN usually initially experience the following symptoms: pain, tingling, numbness, balance problems and weakness [4]. DPN can greatly impact a person’s quality of life and may lead to lower-limb amputation [5]. Currently, there is less effective treatment for DPN in the clinic, except for glucose control and lifestyle modification. However, intensive glycemic control does not significantly improve the clinical outcome of peripheral neuropathy in type 2 diabetic patients [6]. Therefore, it is imperative to explore alternative modifiable factors that could potentially impact the progression of DPN.

The pathogenesis of DPN, as widely recognized, encompasses several factors, including hyperglycemia, dyslipidemia, microvascular dysfunction, and impaired insulin signaling. In recent years, there has been growing interest in the relationship between lipid metabolism and DPN. Hyperlipidemia is considered an early risk factor for DPN [7, 8]. Many experimental and clinical studies have indicated that the underlying pathogenic mechanisms of DPN are inflammation and oxidative stress-induced sciatic nerve damage [9]. The accumulation of free radicals and reduced activity of antioxidant enzymes cause redox imbalance, which promotes oxidative damage in DPN [10-12]. Treatment of DPN rats with antioxidants has been found to slow the decrease in nerve conduction velocity [13].

Proprotein convertase subtilisin-like/Kexin 9 (PCSK9) is a critical regulatory factor of plasma LDL-c, which enhances the sorting and transport capacity of cell surface LDL receptors and increases circulating LDL-c levels [14]. PCSK9 inhibitors have been incorporated into the guidelines of the American Diabetes Association and widely used to treat hyperlipidemia, atherosclerosis, and other diseases [15]. In addition to their lipid-lowering effects, recent studies have shown that PCSK9 inhibitors also have anti-inflammatory, autophagy-inhibiting, and oxidative stress-relieving effects [16-18]. The use of the PCSK9 inhibitor evolocumab has been found to have antioxidant and cell-protective effects to counteract oxidative damage [19]. Since there is a lack of studies confirming the association between PCSK9 inhibitors and DPN progression, we hypothesized that PCSK9 inhibitors have an ameliorative effect on DPN by ameliorating oxidative stress and inflammatory responses and conducted this experiment.

To investigate the potential efficacy of the PCSK9 inhibitor alirocumab in the context of DPN, we employed a T2DM DPN rat model and explored the effects of alirocumab injection in improving neuromorphology, oxidative stress and neuroinflammation.

Method and Materials

Animals and establishment of the DPN model and drug administration

Thirty five-week-old male Sprague-Dawley rats were purchased from Shanghai Jihui Experimental Animal Breeding Co., Ltd. Animal breeding followed the regulations of the Shanghai Animal Committee, with the rats being housed in a suitable environment at a temperature of 25°C and a 12-hour light-dark cycle and having access to food and water ad libitum. Prior to modeling, the rats were fed regular chow for one week to adapt.

The normal group continued to be fed regular chow, while the other rats were fed 45% fat-fed energy feed (Xietong Bio, China) for six weeks after one week of adaptation to regular chow. They were then fasted for 12 hours (but not water deprived) and injected with streptozotocin (STZ) (Sigma, Germany) at a dose of 35 mg/kg and resumed feeding. After three days, a 1 μL tail vein microblood sample was collected, and blood glucose was measured using Blood Glucose and Ketone monitoring systems (Abbott, USA). Rats with blood glucose levels over 16.7 mmol/L were considered successfully modeled. The DPN model was validated by the lowering of nerve conduction velocity (NCV, <40 m/s) [20]. The model rats were randomly divided into the DPN group and the alirocumab group and continued to be fed a 45% fat-fed energy diet for another 4 weeks. At the same time, rats in the Alirocumab group were intraperitoneally injected with Alirocumab at a dose of 10 mg/kg once a week for 4 consecutive weeks.

Measurement of sciatic nerve conduction velocity

At week four after Alirocumab injection, nerve conduction velocity measurements were performed on rats under anesthesia using 7% aqueous chloral hydrate (0.5 mL/100 g) (n = 4). Motor nerve conduction velocity (MNCV): The first stimulation site was in the sciatic fossa, and the second stimulation site was in the ankle. Both were inserted percutaneously with 2 needle electrodes, electrodes were spaced 2 mm apart, grounded caudally, skin temperature was kept at 30 degrees, square wave 10–20 mA, 40 μs pulse width, nerve was stimulated, and the distance between the 2 stimulation sites was measured with 2 needle electrodes. The distance between the two stimulation sites was measured, MNCV(m/s) = distance/difference in latency.

Sensory nerve conduction velocity (SNCV): the same method as MNCV, the sciatic fossa and the ankle were recorded with a square wave (2 mA, 40 μs pulse width). The SNCV was calculated by the same method as before (MNCV is the motor nerve conduction velocity).

Measurement of blood glucose and blood lipids

We measured blood glucose levels by tail vein sampling at 0, 1, 2, 3, and 4 weeks after STZ injection. Blood lipid analysis was performed by cardiac blood sampling at the end of the 4th week.

The whole blood specimens were placed at 4°C for 2 hours, followed by centrifugation at 3,000 rpm for 15 minutes. The supernatant was collected, and the lipid indices were determined automatically using an automatic biochemical analyzer. The kits used for the analysis were purchased from Changchun Huili in China.

Detection of systemic markers of oxidative stress

We used the MEIMIAN enzyme-linked immunosorbent assay (ELISA) kit (China) to determine oxidative stress enzyme activity in serum as follows: Prepare standard and blank wells. Different concentrations of standard were added to the standard wells, and no samples or enzyme-labeled reagents were added to the blank wells. Prepare sample wells. Next, 40 μL of sample diluent and 10 μL of test sample were added and mixed gently. Then, 100 μL of enzyme-labeled reagent was added to each well except the blank well. The cells were covered with a sealing film and incubated at 37°C for 60 minutes. Discard the liquid, add wash solution to each well, let it stand for 30 seconds, discard it, and repeat 5 times. Then, the sample was allowed to dry. Then, 50 μL of color reagent A was added, and 50 μL of color reagent B was added. The wells were mixed and incubated in the dark at 37°C for 15 minutes. Fifty microliters of stop solution was added, the blank well was used to zero, and the absorbance (OD value) was measured at 450 nm with an ELISA reader. The contents of rat glutathione peroxidase (GSH-Px), malondialdehyde (MDA), superoxide dismutase (SOD), and reduced glutathione (GSH) in the sample were calculated through the standard curve.

Transmission electron microscopy and G-ratio calculation

The nerve tissue was fixed in 2.5% glutaraldehyde solution at 4°C overnight. The samples were then rinsed with phosphate buffer, postfixed with 1% osmium acid, and dehydrated with ethanol. The tissue was embedded with epoxy resin and a sclerosing agent, and block trimming was performed. The trimmed block was stained with uranyl acetate and filmed for transmission electron microscopy observation. The G-ratio statistics were analyzed using ImageJ software [21].

Immunofluorescence and Intraepidermal Nerve Fiber (IENF) Counting

Rat foot pad tissue was fixed in 10% formalin at room temperature, paraffin-embedded, and subjected to antigen retrieval. The tissue was labeled with anti-PGP9.5 antibody (ab108986, Abcam, UK) for nerve fibers, followed by washing with PBS and incubation with Alexa Fluor 488 streptavidin conjugate (Thermo, USA) at room temperature for 60 minutes. The tissue was washed again with PBS and sealed with an anti-fluorescence quenching agent (Thermo, USA) before being stored at 42°C. The samples were photographed under a fluorescence microscope. In each group, four random sites were selected to calculate the number of nerve fibers per millimeter within the epidermis.

Isolation of the sciatic nerve from rats

The rats were administered full anesthesia with a 7% chloral hydrate solution at a dose of 0.5 mL per 100 grams of their body weight. Following this, the targeted area was sterilized, and excess hair was carefully shaved using a shaver. To access the sciatic nerve, a precise incision was made on the skin over the sciatic region, ensuring it was of an appropriate size to expose the buttocks and the sciatic bone. The sciatic nerve was meticulously located by delicately removing the surrounding tissue with microtome tweezers. Typically, the sciatic nerve is situated beneath the gluteal muscle group, and the removal of the surrounding fatty tissue aided in accurately pinpointing the nerve. The separation of the sciatic nerve was done gently using microscopic forceps or suitable tools, with utmost care taken to prevent any damage to the nerve. Upon successful separation, the sciatic nerve was then carefully cut from the popliteal fossa to the buttock and subsequently stored at –80°C for further experiments.

RNA extraction and quantitative real-time PCR

RNA extraction was performed using 50 mg of tissue and 1 mL of TRIzol (Thermo, USA). After homogenization, the upper layer was collected in a new Eppendorf (EP) tube (approximately 400 μL), mixed with 600 μL of isopropanol, and left to stand for 10 minutes. The sample was then centrifuged at 12,000 × g for 10 minutes, and the supernatant was discarded, leaving behind the white RNA precipitate. Next, 1 mL of 75% ethanol was added, and the sample was centrifuged at 7,500 × g for 5 minutes at 4°C. The ethanol was discarded, and the RNA precipitate was air-dried until it became clear. The RNA was then dissolved in 20 μL of DEPC water for reverse transcription and qRT-PCR. The primer sequences are shown in Supplementary Table 1. To transcribe RNA into cDNA, a Universal Reverse Transcription Kit (LR-0103B, Noren-Bio, China) was used following this protocol: 30°C for 30 minutes, 42°C for 30 minutes, and 85°C for 10 minutes. Then, the resulting cDNA was detected with ComSYBR qPCR Mix (with ROX) (LK-0107BB, Noren-Bio, China) and the MX3000P Real-Time PCR System (Agilent, Germany). The qPCR program included denaturation at 95°C for 3 minutes, followed by 40 cycles of 95°C for 12 seconds and 62°C for 40 seconds.

Western blot

Each tissue sample was added to 100 μL of tissue cell lysis buffer (Noren Bio, China) and thoroughly mixed to ensure complete lysis. The lysate was then transferred to a new centrifuge tube. Next, 10 μL of the sample was directly mixed with 10 μL of 2× SDS-PAGE loading buffer, followed by thorough mixing. The mixture was heated at 100°C for 5 minutes, cooled on ice, and centri fuged at 12,000 × g for 5 minutes to remove insoluble precipitates. The samples were loaded onto a 10% SDS-PAGE gel, with a maximum of 20 μL per well. After electrophoresis, the PVDF membrane (Millipore, USA) was soaked in methanol for 1 minute. Semidry electrophoretic transfer was performed using a Semi-Dry Cell (Bio-Rad, USA) with transfer conditions set at 30 mA for 60 minutes. Following transfer, the membrane was blocked overnight at 4°C using blocking buffer (1× TBS, 0.1% Tween-20, 5% nonfat dry milk). The next day, the membrane was washed three times for 15 minutes each with 1× TBST (1× TBS, 0.1% Tween-20). The primary antibody, appropriately diluted, was added and incubated at 37°C for 2 hours. Subsequently, the membrane was washed four times for 10 minutes each with 1× TBST. The diluted secondary antibody was added and incubated at 37°C for 2 hours. The membrane was then washed four times for 10 minutes each with 1× TBST. Chemiluminescent detection was performed using Super-GL ECL Ultra-Sensitive Luminescent Liquid (Noren-Bio, China), and the X-ray film was exposed. After development and fixation, the dried film was analyzed using a gel imaging system, with Gel-Pro Analyzer software utilized for analysis in this experiment. See Supplementary Table 2 for antibody information and concentrations.

Statistical analysis

Statistical analysis was performed by using GraphPad Prism 9. Statistical results are expressed as the mean ± standard deviation. One-way ANOVA and t tests were used for comparisons between groups. p < 0.05 was considered statistically significant.

Results

Effects of alirocumab on blood glucose and blood lipids in DPN rats

Fig. 1A shows that there was no significant difference in blood glucose between the normal and DPN groups before STZ injection (p = 0.1248). The DPN group rats showed a significant increase in blood glucose, reaching above 16.7 mmol/L one week after STZ injection and maintaining this level for the following four weeks, as shown in Fig. 1B. The blood glucose level in the alirocumab group rats showed no significant difference compared with that in the DPN group. Blood lipids were measured after 4 weeks of alirocumab injection, and the DPN group rats showed a significant increase in TG, CHO, and LDL and a decrease in HDL compared to the normal group, while the alirocumab group rats had a significant decrease in TG, CHO, and LDL and an increase in HDL compared to the DPN group, as shown in Fig. 1C–F.

Fig. 1

Alirocumab improves blood lipids without affecting blood glucose in rats. (A) Blood glucose before STZ injection; (B) Blood glucose changes in 4 weeks after STZ injection; (C–F) Levels of triglycerides (TG), cholesterol (CHO), high-density lipoprotein (HDL), and low-density lipoprotein (LDL) in rat serum. Normal group: rats not injected with STZ; DPN: rats with diabetic peripheral neuropathy; Alirocumab: DPN rats injected with alirocumab. Each group n = 6. (^##p < 0.001, ^###p < 0.0001, ns = not statistically significant).

Alirocumab improves nerve conduction velocity and intraepidermal nerve fiber density in DPN rats

Due to the insidious onset of DPN, nerve conduction velocity (NCV) testing has become an important early indicator of peripheral neuropathy, as nerve electrophysiological changes often precede symptoms. It has high specificity and is widely used to evaluate large nerve fiber dysfunction. Fig. 2A, B show that the MNCV and SNCV of the DPN group were significantly lower than those of the normal group (^#p < 0.01). However, in the group of rats that received alirocumab injections, there was a significant improvement in both MNCV and SNCV compared to the DPN group (^#p < 0.01), indicating that alirocumab treatment had a positive effect on nerve conduction.

Fig. 2

The impact of alirocumab on sciatic nerve conduction velocity and epidermal nerve fiber density in rats. (A, B) The results showed that MNCV and SNCV were measured in each group of rats. (C, D) showed that the effect of alirocumab on intraepidermal nerve fiber density (IENFD) in rats. INEDF was 30.3 ± 3.56 in the normal group, 12.7 ± 3.10 in the DPN group, and 25.7 ± 2.22 in the alirocumab group. Each group n = 4. (^#p < 0.01). The white arrows indicate intraepidermal nerve fibers.

Intraepidermal nerve fiber density (IENFD) is a measure of the number of nerve fibers present per unit area of the epidermis. It is used to assess small fiber deficit injury. The study found that (Fig. 2C, D) DPN rats had a significant decrease in IENFD compared to the normal group (^#p < 0.01), indicating small fiber deficit injury in the DPN group. However, the injection of alirocumab increased IENFD in DPN rats (^#p < 0.01), suggesting that alirocumab treatment had a positive impact on the density of intraepidermal nerve fibers.

Alirocumab improves sciatic nerve morphology in DPN rats

By using transmission electron microscopy (TEM), we found that in the DPN group, the cross-section of the sciatic nerve showed several abnormalities. These included loose arrangement of myelinated nerves, unclear boundaries of the myelin sheath, demyelination, and thinning and disordered arrangement of the myelin lamellae, as shown in Fig. 3A. These observations indicate structural damage to the myelin sheath in the sciatic nerve of rats with DPN.

Fig. 3

Effects of alirocumab on the morphology of rat sciatic nerve and g-ratio. (A) Electron microscopy was used to examine the sciatic nerve morphology in both the DPN and Alirocumab groups. The results showed that the myelin sheaths in the DPN group were irregular and had demyelination, while the alirocumab group had significant improvement with thicker and intact myelin sheaths, as observed under both 5 μm and 1 μm electron microscopy. (B) The g-ratio in both the DPN and Alirocumab groups increased with the axon diameter. (C) The g-ratio in the DPN group was 0.7207 ± 0.07211, while in the alirocumab group, it was significantly reduced to 0.5656 ± 0.87792 (^#p < 0.01).

In contrast, in the group of rats treated with alirocumab injections, although demyelination was still present in the sciatic nerve, the morphology appeared more intact. The arrangement of myelinated nerves was more regular, and the myelin lamellae appeared denser and structurally more uniform. This suggests that alirocumab treatment had a positive effect on the preservation and organization of myelin in the sciatic nerve of rats with DPN.

The g-ratio is a measure of the ratio between the diameter of the axon (nerve fiber) and the thickness of the myelin sheath. A higher g-ratio indicates a thinner myelin sheath. The g-ratio in the alirocumab-treated rats was significantly lower than that in the DPN group, indicating that alirocumab alleviated myelin damage in the sciatic nerve of rats with DPN, as shown in Fig. 3B, C.

Alirocumab alleviates oxidative stress in DPN rats

Fig. 4 shows that in the DPN group, malondialdehyde (MDA) and superoxide dismutase (SOD) levels were elevated compared to those in the normal group (^#p < 0.01). MDA is a marker of lipid peroxidation, which is a consequence of oxidative damage. Elevated MDA levels suggest increased lipid peroxidation in DPN rats. SOD is an antioxidant enzyme that helps to neutralize superoxide radicals. The increased SOD levels indicate an upregulation of the antioxidant defense system in response to oxidative stress in DPN.

Fig. 4

Effects of alirocumab on oxidative stress in rats. (A) Levels of MDA in each group of rats. The serum levels of MDA in normal rats were 1.45 ± 0.3342, in the DPN group it was 3.28 ± 0.5513, and in the alirocumab group it was 2.67 ± 0.3583; (B) Levels of SOD in each group of rats. The serum levels of SOD in normal rats were 4.40 ± 0.9994, in the DPN group it was 7.72 ± 0.7020, and in the alirocumab group it was 6.47 ± 1.0097; (C) Levels of GSH in each group of rats. The serum levels of GSH in normal rats were 272.35 ± 20.35291, in the DPN group it was 172.1467 ± 34.17406, and in the alirocumab group it was 203.4333 ± 52.5562; (D) Levels of GSH-Px in each group of rats. The serum levels of GSH-Px in normal rats were 14.875 ± 1.885351, in the DPN group it was 9.901667 ± 1.70346, and in the alirocumab group it was 9.783333 ± 1.490942. (*p < 0.05, ^#p < 0.01), each group had n = 6.

Furthermore, the study found that glutathione (GSH) and glutathione peroxidase (GSH-Px) levels were decreased in DPN rats compared to normal rats (^#p < 0.01). GSH is an important antioxidant that helps to detoxify reactive oxygen species, and GSH-Px is an enzyme that utilizes GSH to neutralize hydrogen peroxide. The reduced levels of GSH and GSH-Px suggest a depletion of antioxidant capacity in DPN rats, potentially leading to increased oxidative damage.

On the other hand, rats injected with alirocumab showed a decrease in MDA and SOD levels compared to the DPN group (*p < 0.05). This indicates that Alirocumab treatment resulted in a reduction in lipid peroxidation and the antioxidant response in the rats with DPN. However, there was no significant difference in GSH and GSH-Px levels between the alirocumab-treated rats and the DPN group. This suggests that Alirocumab may not have had a significant impact on the GSH antioxidant system in this study.

Alirocumab reduces inflammatory factors in the sciatic nerve of DPN rats

In our previous research and other studies, inflammatory factors such as TNF-α, IL-1β, and IL-6 have been shown to be associated with DPN [22-24]. Therefore, in this experiment, we chose TNF-α, IL-1β, and IL-6 as the inflammatory targets of the DPN sciatic nerve. SIRT1 is a member of the Sirtuin family, which enhances mitochondrial function and provides protection against metabolic disease [25]. Sirtuins deacetylate Nrf2 and contribute to its ROS-reducing effects by producing antioxidant enzymes [26]. Overexpression of SIRT1 protein in neurons can contribute to the reversal of neuropathy as well as increase intraepidermal nerve fibers in high-fat diet mice. Previous studies on atherosclerosis have found that pharmacological Sirt1 activation reduces plasma LDL-C levels by inhibiting PCSK9 secretion, thereby increasing hepatic LDL receptor availability and continuous LDL-C clearance [27].

In our research, as shown in Fig. 5A–C, the mRNA levels of TNF-α, IL-1β, and IL-6 were increased in the sciatic nerve of rats in the DPN group compared to the normal group, while the mRNA levels of the anti-inflammatory and antioxidant enzyme Sirt1 were decreased in the DPN group (*p < 0.05, ^#p < 0.01). In the group injected with alirocumab, the levels of TNF-α, IL-1β, and IL-6 mRNA were decreased, and Sirt1 mRNA levels were increased compared to those in the DPN group (*p < 0.05, ^#p < 0.01).

Fig. 5

Effects of alirocumab on mRNA levels of inflammatory factors and oxidative stress in the sciatic nerve of rats. (A) mRNA levels of TNF-α in the sciatic nerve of each group of rats. (B) mRNA levels of IL-6 in the sciatic nerve of each group of rats. (C) mRNA levels of IL-1β in the sciatic nerve of each group of rats. (D) mRNA levels of Sirt1 in the sciatic nerve of each group of rats. (*p < 0.05, ^#p < 0.01). Normal group, n = 6; DPN group, n = 6; Alirocumab group, n = 5.

Alirocumab upregulates the expression of myelin-related genes in sciatic nerve

In addition to exploring the effects of alirocumab on inflammation and oxidative stress in rats, we also examined rat sciatic nerve myelin-related protein genes, such as Mbp and Plp. As shown in Fig. 6A, in the DPN group, the mRNA expression of myelin basic protein (MBP) was decreased in the sciatic nerve compared to that in the normal group (*p < 0.05). MBP plays a crucial role in the formation and maintenance of the myelin sheath. The reduced mRNA expression of MBP suggests impaired myelination or loss of myelin in the sciatic nerve of rats with DPN. Additionally, the mRNA expression of MLKL, a necrosis-related factor, was increased in the DPN group compared to the normal group (^#p < 0.01). MLKL is associated with necroptosis, a type of programmed cell death [28]. The increased expression of MLKL suggests an upregulation of necroptotic processes in the sciatic nerve of rats with DPN (Fig. 6B).

Fig. 6

Effects of alirocumab on mRNA and protein levels of myelin-associated genes in rat sciatic nerve. (A) mRNA levels of MBP in each group of rats’ sciatic nerve; (B) mRNA levels of MLKL in each group of rats’ sciatic nerve. Normal group, n = 6; DPN group, n = 6; Alirocumab group, n = 5. (C) Protein expression levels of myelin-associated proteins MBP and PLP and necrosis-associated factor MLKL in the sciatic nerve of rats in each group. Each group had n = 3. (*p < 0.05, ^#p < 0.01).

However, in the group of rats injected with alirocumab, the mRNA expression of MBP was significantly upregulated (Fig. 6A), while the mRNA expression of MLKL was significantly downregulated in the sciatic nerve compared to the DPN group (Fig. 6B) (*p < 0.05, ^#p < 0.01).

Furthermore, Fig. 6C, D provide additional evidence supporting these findings. They showed that the levels of myelin-related proteins, such as myelin basic protein (MBP) and proteolipid protein (PLP), were decreased in the sciatic nerve of rats in the DPN group compared to the normal group. Conversely, in the alirocumab injection group, the levels of MBP and PLP were increased, while the levels of MLKL were decreased compared to those in the DPN group. These observations further support the notion that alirocumab injection positively influences the levels of myelin-related proteins and reduces necrosis-related factors in the sciatic nerve of rats with DPN.

Discussion

To our knowledge, this study demonstrates for the first time that Alirocumab can improve peripheral neuropathy in diabetic rats. Specifically, our research demonstrated that alirocumab ameliorates sciatic nerve conduction and morphological alterations and diminishes small fiber nerve loss in DPN rats. These effects may be related to the regulation of oxidative stress and inflammation. These findings suggest that alirocumab holds potential as a therapeutic approach for DPN.

Blood glucose management is the cornerstone of diabetes and its complication control [29]. In the present study, alirocumab did not significantly affect blood glucose levels in rats, which contradicts the results of a previous Mendelian randomization study that showed an association between the PCSK9 variants associated with lower LDL-c and higher circulating fasting glucose concentrations [30]. Another study showed that glucose clearance is significantly impaired in Pcsk9 KO mice fed a standard or high-fat diet for 20 weeks compared to wild-type animals. In contrast, impaired glucose clearance was restored in liver-selective Pcsk9 knockout mice [31]. Notably, liver-derived PCSK9 is the primary target of PCSK9 inhibitor monoclonal antibodies, such as alirocumab. This finding explains the results of our study. Clinical studies have also demonstrated that Alirocumab does not increase the risk of new-onset diabetes [32]. Our results support this view and are consistent with the findings of other clinically relevant studies [33, 34].

In recent years, there has been controversy regarding lipid-lowering therapy in the treatment of DPN. An observational cohort study suggested that statin or fibrate therapy can prevent the development of diabetic peripheral sensory neuropathy [35]. In vitro and in vivo experiments have also shown that atorvastatin can improve sciatic nerve injury and apoptosis induced by diabetes [36]. A prospective study by Svendsen, TDK. et al. found that statin use significantly increased IENFD compared to patients not taking statins, although small fiber function did not improve [37]. However, other research has suggested that the use of lipid-lowering drugs may increase the risk of peripheral neuropathy. A retrospective survey found that the incidence of peripheral neuropathy in type 2 diabetes patients treated with statins (22.9%) was significantly higher than that in the untreated group (15.5%) and positively correlated with the incidence of peripheral neuropathy [38]. The mechanism of statin-induced peripheral neuropathy side effects remains unclear. It may be related to alterations in cholesterol synthesis, interference with cholesterol-rich neuronal membranes, or inhibition of the activity of ubiquinone (coenzyme Q10), a mitochondrial respiratory chain enzyme, leading to neuronal damage [39]. Our research findings support the view that lipid-lowering therapy can improve DPN [35, 36]. Specifically, the PCSK9 inhibitor alirocumab can rescue the loss of small nerve fibers and improve NCV in DPN rats, which is a novel finding. The relationship between changes in blood lipids and DPN in a rat model can be complex and multifaceted. Although Alirocumab primarily targets blood lipids, its effects on neuropathy in this specific context may involve several mechanisms: 1) High LDL-cholesterol levels can contribute to inflammation, which plays a role in nerve damage associated with neuropathy [7]. Lowering LDL-cholesterol may help reduce inflammation and its detrimental effects on nerves. 2) Elevated cholesterol levels can increase oxidative stress, which is implicated in nerve damage [40]. Lowering LDL-cholesterol may reduce oxidative stress and mitigate neuropathy. 3) Dyslipidemia is associated with endothelial dysfunction and microvascular damage, which can contribute to nerve damage in DPN [41, 42]. Improving vascular health may help alleviate some of the symptoms associated with DPN.

In our previous research and other studies, inflammatory factors such as TNF-α, IL-1β, and IL-6 have been shown to be associated with DPN [22-24]. The effect of PCSK9 inhibition on inflammation is currently under discussion. Previous studies have found that PCSK9 expression in atherosclerotic samples is positively correlated with the ratio of IL-6, IL-1β, and LC3B II/I, indicating that PCSK9 is related to inflammatory responses [18, 43]. However, a recent editorial pointed out that PCSK9 inhibition may increase cellular inflammation, depending on the cell type [44]. In a study of experimental autoimmune encephalomyelitis mice, treatment with alirocumab did not affect the proliferation and polarization of self-reactive T cells during the experimental autoimmune encephalomyelitis period [45]. Our results supported that PCSK9 inhibition could alleviate the inflammatory response.

In fact, oxidative stress is an important factor in the development of impaired nerve blood flow and function. Thus, the treatment of diabetic rats with antioxidants essentially corrects both nerve blood flow and NCV deficits [46]. Oxidative damage promotes nerve structural changes, such as axonal degeneration, segmental demyelination, and apoptosis of Schwann cells, leading to the subsequent damage and/or loss of myelinated and unmyelinated fibers in DPN. Oxidative stress could lead to the activation of the NF-κB pathway, and activation of the NF-κB inflammatory response attenuates Nrf2-antioxidant signaling, which could also in turn aggravate oxidative stress [12]. Additionally, our past studies have found that inhibition of TNF-α restores nerve injury, including improvement of NCV, reduction of nerve fiber demyelination, lamellar and axonal structural disturbances, and increase of MBP expression in neural tissues [47]. In this study, PCSK9 inhibitors were found to have both ameliorative inflammatory and oxidative stress effects in DPN rats. Since there is an interaction between oxidative stress and inflammation and previous studies have shown that alirocumab improves oxidative stress in rats with biliary cirrhosis [48], we hypothesize that the primary effect of alirocumab in this study is to improve oxidative stress in rats with DPN.

As a novel lipid-lowering agent, the efficacy of PCSK9 inhibitors has been compared with that of other types of lipid-lowering agents in various diseases. For instance, a meta-analysis of lipid-lowering therapy and the risk of hemorrhagic stroke found that statins increased the risk of hemorrhagic stroke in a drug dose-dependent manner, whereas PCSK9 inhibitors did not increase the risk of hemorrhagic stroke [49]. In terms of neurological studies, a prior Mendelian randomization study examining the effects of PCSK9 and HMG-CoA reductase inhibition on cognitive function noted that no genetic evidence of PCSK9-related adverse effects was discovered. In contrast, adverse neurocognitive effects linked with HMGCR inhibition were observed, which may be offset by the cardiovascular benefits of statins [50]. However, no comparisons of the effects of PCSK9 inhibitors with other types of lipid-lowering agents in DPN exist, highlighting the need for additional studies to investigate them.

Acknowledgments

The authors would like to thank Jinshan Hospital, Fudan University for providing the experimental site and facilities.

Disclosure

None of the authors have any potential conflicts of interest associated with this research.

Author Contributions

Conceptualization, X Shi and Y Chen; methodology, N Cui and Y Huang; software, N Cui; validation, X Shi and Y Chen; formal analysis, M Wang; investigation, N Cui; resources, X Lu; data curation, N Cui; writing—original draft preparation, N Cui; writing—review and editing, Y Chen; visualization, N Cui; supervision, X Shi; project administration, X Shi; funding acquisition, X Shi and Y Feng. All authors have read and agreed to the published version of the manuscript.

Funding

This research received financial support from several sources, including grants from the Fund of Shanghai Municipal Health Commission (201940362, 20204Y0246), Jinshan Science and Technology Commission (2019-03-02), and the Outstanding Young Talents training plan of Jinshan District Health Committee (JSYQ201903).

Supplementary Table 1

Primer Sequences for PCR

Name	Primer	Sequences
Mlkl	Forward primer	GTGTGCATGGCCTGCTACAG
	Reverse primer	CCAGGGCAGCAGTAATGTCA
Mbp	Forward primer	AGGGAGGACAACACCTTCAAAG
	Reverse primer	GGGATCTTCTTGGATGGTCTGA
Sirt1	Forward primer	TGTTTCCTGTGGGATACCTGA
	Reverse primer	TGAAGAATGGTCTTGGGTCTTT
TNF-α	Forward primer	GCATGATCCGAGATGTGGAACTG
	Reverse primer	GAGAAGAGGCTGAGGCACAGACAC
IL-1β	Forward primer	TTGGGCTGTCCAGATGAGA
	Reverse primer	CGAGATGCTGCTGTGAGAT
IL-6	Forward primer	TGAAACCCTAGTTCATATCTTCAAACA
	Reverse primer	CTCCTTCTGTGACTCTAACTTCTCCAT
Actin	Forward primer	CGTAAAGACCTCTATGCCAACA
	Reverse primer	GGAGGAGCAATGATCTTGATCT

Supplementary Table 2

Antibody Information and Concentrations for Western Blot

Antibody	Company	Concentration
HRP- conjugated goat anti- mouse IgG	CST	1:1,000
HRP- conjugated goat anti- rabbit IgG	CST	1:1,000
MBP	Proteintech (10458-1-AP)	1:1,000
MLKL	Abcam (ab243142)	1:500
GAPDH	CST	1:1,000
PLP	Abcam (ab254363)	1:500

References

• 1   Feldman  EL,  Callaghan  BC,  Pop-Busui  R,  Zochodne  DW,  Wright  DE, et al. (2019) Diabetic neuropathy. Nat Rev Dis Primers 5: 42.
• 2   Rogers  MA,  Hutcheson  JD,  Okui  T,  Goettsch  C,  Singh  SA, et al. (2021) Dynamin-related protein 1 inhibition reduces hepatic PCSK9 secretion. Cardiovasc Res 117: 2340–2353.
• 3   Iqbal  Z,  Azmi  S,  Yadav  R,  Ferdousi  M,  Kumar  M, et al. (2018) Diabetic peripheral neuropathy: epidemiology, diagnosis, and pharmacotherapy. Clin Ther 40: 828–849.
• 4   Callaghan  BC,  Cheng  HT,  Stables  CL,  Smith  AL,  Feldman  EL (2012) Diabetic neuropathy: clinical manifestations and current treatments. Lancet Neurol 11: 521–534.
• 5   Selvarajah  D,  Kar  D,  Khunti  K,  Davies  MJ,  Scott  AR, et al. (2019) Diabetic peripheral neuropathy: advances in diagnosis and strategies for screening and early intervention. Lancet Diabetes Endocrinol 7: 938–948.
• 6   Callaghan  BC,  Little  AA,  Feldman  EL,  Hughes  RAC (2012) Enhanced glucose control for preventing and treating diabetic neuropathy. Cochrane Database Syst Rev 6: CD007543.
• 7   Eid  S,  Sas  KM,  Abcouwer  SF,  Feldman  EL,  Gardner  TW, et al. (2019) New insights into the mechanisms of diabetic complications: role of lipids and lipid metabolism. Diabetologia 62: 1539–1549.
• 8   Smith  AG,  Singleton  JR (2013) Obesity and hyperlipidemia are risk factors for early diabetic neuropathy. J Diabetes Complications 27: 436–442.
• 9   Syed  AA,  Reza  MI,  Yadav  H,  Gayen  JR (2023) Hesperidin inhibits NOX4 mediated oxidative stress and inflammation by upregulating SIRT1 in experimental diabetic neuropathy. Exp Gerontol 172: 112064.
• 10   Xie  J,  Song  W,  Liang  X,  Zhang  Q,  Shi  Y, et al. (2020) Protective effect of quercetin on streptozotocin-induced diabetic peripheral neuropathy rats through modulating gut microbiota and reactive oxygen species level. Biomed Pharmacother 127: 110147.
• 11   Wu  YB,  Shi  LL,  Wu  YJ,  Xu  WH,  Wang  L, et al. (2012) Protective effect of gliclazide on diabetic peripheral neuropathy through Drp-1 mediated-oxidative stress and apoptosis. Neurosci Lett 523: 45–49.
• 12   Lin  Q,  Li  K,  Chen  Y,  Xie  J,  Wu  C, et al. (2023) Oxidative stress in diabetic peripheral neuropathy: pathway and mechanism-based treatment. Mol Neurobiol 60: 4574–4594.
• 13   Cameron  NE,  Cotter  MA,  Archibald  V,  Dines  KC,  Maxfield  EK (1994) Anti-oxidant and pro-oxidant effects on nerve conduction velocity, endoneurial blood flow and oxygen tension in non-diabetic and streptozotocin-diabetic rats. Diabetologia 37: 449–459.
• 14   Lambert  G,  Sjouke  B,  Choque  B,  Kastelein  JJP,  Hovingh  GK (2012) The PCSK9 decade. J Lipid Res 53: 2515–2524.
• 15   Grundy  SM,  Stone  NJ,  Bailey  AL,  Beam  C,  Birtcher  KK, et al. (2019) 2018 AHA/ACC/AACVPR/AAPA/ABC/ACPM/ADA/AGS/APhA/ASPC/NLA/PCNA Guideline on the management of blood cholesterol: a report of the american college of cardiology/American Heart Association Task Force on Clinical Practice Guidelines. Circulation 139: e1082–e1143.
• 16   Momtazi-Borojeni  AA,  Sabouri-Rad  S,  Gotto  AM,  Pirro  M,  Banach  M, et al. (2019) PCSK9 and inflammation: a review of experimental and clinical evidence. Eur Heart J Cardiovasc Pharmacother 5: 237–245.
• 17   Ding  Z,  Wang  X,  Liu  S,  Shahanawaz  J,  Theus  S, et al. (2018) PCSK9 expression in the ischaemic heart and its relationship to infarct size, cardiac function, and development of autophagy. Cardiovasc Res 114: 1738–1751.
• 18   D’Onofrio  N,  Prattichizzo  F,  Marfella  R,  Sardu  C,  Martino  E, et al. (2023) SIRT3 mediates the effects of PCSK9 inhibitors on inflammation, autophagy, and oxidative stress in endothelial cells. Theranostics 13: 531–542.
• 19   Safaeian  L,  Mirian  M,  Bahrizadeh  S (2022) Evolocumab, a PCSK9 inhibitor, protects human endothelial cells against H2O2-induced oxidative stress. Arch Physiol Biochem 128: 1681–1686.
• 20   Shi  X,  Chen  Y,  Nadeem  L,  Xu  G (2013) Beneficial effect of TNF-α inhibition on diabetic peripheral neuropathy. J Neuroinflammation 10: 69.
• 21   Goebbels  S,  Oltrogge  JH,  Kemper  R,  Heilmann  I,  Bormuth  I, et al. (2010) Elevated phosphatidylinositol 3,4,5-trisphosphate in glia triggers cell-autonomous membrane wrapping and myelination. J Neurosci 30: 8953–8964.
• 22   Cheng  YC,  Chiu  YM,  Dai  ZK,  Wu  BN (2021) Loganin ameliorates painful diabetic neuropathy by modulating oxidative stress, inflammation and insulin sensitivity in streptozotocin-nicotinamide-induced diabetic rats. Cells 10: 2688.
• 23   Baum  P,  Kosacka  J,  Estrela-Lopis  I,  Woidt  K,  Serke  H, et al. (2016) The role of nerve inflammation and exogenous iron load in experimental peripheral diabetic neuropathy (PDN). Metabolism 65: 391–405.
• 24   Luo  Q,  Feng  Y,  Xie  Y,  Shao  Y,  Wu  M, et al. (2019) Nanoparticle-microRNA-146a-5p polyplexes ameliorate diabetic peripheral neuropathy by modulating inflammation and apoptosis. Nanomedicine 17: 188–197.
• 25   Jalgaonkar  MP,  Parmar  UM,  Kulkarni  YA,  Oza  MJ (2022) SIRT1-FOXOs activity regulates diabetic complications. Pharmacol Res 175: 106014.
• 26   Patel  S,  Khan  H,  Majumdar  A (2022) Crosstalk between sirtuins and Nrf2: SIRT1 activators as emerging treatment for diabetic neuropathy. Metab Brain Dis 37: 2181–2195.
• 27   Miranda  MX,  van Tits  LJ,  Lohmann  C,  Arsiwala  T,  Winnik  S, et al. (2015) The Sirt1 activator SRT3025 provides atheroprotection in Apoe–/– mice by reducing hepatic Pcsk9 secretion and enhancing Ldlr expression. Eur Heart J 36: 51–59.
• 28   Zhan  C,  Huang  M,  Yang  X,  Hou  J (2021) MLKL: Functions beyond serving as the Executioner of Necroptosis. Theranostics 11: 4759–4769.
• 29   Monami  M,  Adalsteinsson  JE,  Desideri  CM,  Ragghianti  B,  Dicembrini  I, et al. (2013) Fasting and post-prandial glucose and diabetic complication. A meta-analysis. Nutr Metab Cardiovasc Dis 23: 591–598.
• 30   Schmidt  AF,  Swerdlow  DI,  Holmes  MV,  Patel  RS,  Fairhurst-Hunter  Z, et al. (2017) PCSK9 genetic variants and risk of type 2 diabetes: a mendelian randomisation study. Lancet Diabetes Endocrinol 5: 97–105.
• 31   Da Dalt  L,  Ruscica  M,  Bonacina  F,  Balzarotti  G,  Dhyani  A, et al. (2019) PCSK9 deficiency reduces insulin secretion and promotes glucose intolerance: the role of the low-density lipoprotein receptor. Eur Heart J 40: 357–368.
• 32   Ray  KK,  Colhoun  HM,  Szarek  M,  Baccara-Dinet  M,  Bhatt  DL, et al. (2019) Effects of alirocumab on cardiovascular and metabolic outcomes after acute coronary syndrome in patients with or without diabetes: a prespecified analysis of the ODYSSEY OUTCOMES randomised controlled trial. Lancet Diabetes Endocrinol 7: 618–628.
• 33   Cao  YX,  Liu  HH,  Dong  QT,  Li  S,  Li  JJ (2018) Effect of proprotein convertase subtilisin/kexin type 9 (PCSK9) monoclonal antibodies on new-onset diabetes mellitus and glucose metabolism: a systematic review and meta-analysis. Diabetes Obes Metab 20: 1391–1398.
• 34   Monami  M,  Sesti  G,  Mannucci  E (2019) PCSK9 inhibitor therapy: a systematic review and meta-analysis of metabolic and cardiovascular outcomes in patients with diabetes. Diabetes Obes Metab 21: 903–908.
• 35   Davis  TME,  Yeap  BB,  Davis  WA,  Bruce  DG (2008) Lipid-lowering therapy and peripheral sensory neuropathy in type 2 diabetes: the Fremantle Diabetes Study. Diabetologia 51: 562–566.
• 36   Gürpinar  T,  Ekerbiçer  N,  Harzadin  NU,  Barut  T,  Tarakçi  F, et al. (2011) Statin treatment reduces oxidative stress-associated apoptosis of sciatic nerve in diabetes mellitus. Biotech Histochem 86: 373–378.
• 37   Svendsen  TK,  Krøigård  T,  Wirenfeldt  M,  Schrøder  HD,  Bak  S, et al. (2020) Statin use and peripheral nerve function—a prospective follow-up study. Basic Clin Pharmacol Toxicol 126: 203–211.
• 38   Hammad  MA,  Syed Sulaiman  SA,  Alghamdi  S,  Mangi  AA,  Aziz  NA, et al. (2020) Statins-related peripheral neuropathy among diabetic patients. Diabetes Metab Syndr 14: 341–346.
• 39   Vaughan  TB,  Bell  DSH (2005) Statin Neuropathy Masquerading as Diabetic Autoimmune Polyneuropathy. Diabetes Care 28: 2082.
• 40   Alrafiah  A (2021) Thymoquinone protects neurons in the cerebellum of rats through mitigating oxidative stress and inflammation following high-fat diet supplementation. Biomolecules 11: 165.
• 41   Pek  SLT,  Sum  CF,  Yeoh  LY,  Lee  SBM,  Tang  WE, et al. (2017) Association of apolipoprotein-CIII (apoC-III), endothelium-dependent vasodilation and peripheral neuropathy in a multi-ethnic population with type 2 diabetes. Metabolism 72: 75–82.
• 42   Pasha  R,  Azmi  S,  Ferdousi  M,  Kalteniece  A,  Bashir  B, et al. (2022) Lipids, lipid-lowering therapy, and neuropathy: a narrative review. Clin Ther 44: 1012–1025.
• 43   Ding  Z,  Pothineni  NVK,  Goel  A,  Lüscher  TF,  Mehta  JL (2020) PCSK9 and inflammation: role of shear stress, pro-inflammatory cytokines, and LOX-1. Cardiovasc Res 116: 908–915.
• 44   Schmid  JA (2022) PCSK9 inhibition might increase endothelial inflammation. Atherosclerosis 362: 26–28.
• 45   Vigne  S,  Duc  D,  Peter  B,  Rebeaud  J,  Yersin  Y, et al. (2022) Lowering blood cholesterol does not affect neuroinflammation in experimental autoimmune encephalomyelitis. J Neuroinflammation 19: 42.
• 46   Ford  I,  Cotter  MA,  Cameron  NE,  Greaves  M (2001) The effects of treatment with alpha-lipoic acid or evening primrose oil on vascular hemostatic and lipid risk factors, blood flow, and peripheral nerve conduction in the streptozotocin-diabetic rat. Metabolism 50: 868–875.
• 47   Shi  X,  Chen  Y,  Nadeem  L,  Xu  G (2013) Beneficial effect of TNF-α inhibition on diabetic peripheral neuropathy. J Neuroinflammation 10: 69.
• 48   Huang  HC,  Hsu  SJ,  Chang  CC,  Chuang  CL,  Hou  MC, et al. (2022) Effects of PCSK-9 inhibition by alirocumab treatments on biliary cirrhotic rats. Int J Mol Sci 23: 7378.
• 49   Sanz-Cuesta  BE,  Saver  JL (2021) Lipid-lowering therapy and hemorrhagic stroke risk: comparative meta-analysis of statins and PCSK9 inhibitors. Stroke 52: 3142–3150.
• 50   Rosoff  DB,  Bell  AS,  Jung  J,  Wagner  J,  Mavromatis  LA, et al. (2022) Mendelian randomization study of PCSK9 and HMG-CoA reductase inhibition and cognitive function. J Am Coll Cardiol 80: 653–662.