Food Science and Technology Research
Online ISSN : 1881-3984
Print ISSN : 1344-6606
ISSN-L : 1344-6606
Original papers
Characterization of the palI Gene of Aspergillus oryzae
Motoaki Sano , Akiko Kobayashi, Shinichi Ohashi
Author information
JOURNAL OPEN ACCESS FULL-TEXT HTML

2014 Volume 20 Issue 1 Pages 155-159

Details
Abstract

The palI gene promotes plasma membrane localization of PalH in Aspergillus nidulans. We analyzed the role of palI in the ambient pH signal transduction pathway of A. oryzae by disrupting the palI gene. Polymerase chain reaction and Southern hybridization analyses indicated that homologous recombination occurred at the resident palI locus. palI disruption resulted in significantly decreased pacC expression and alkaline protease activity. Based on these results, we believe that palI plays an important role in the ambient pH signal transduction pathway of A. oryzae. While the palI-disrupted strain showed some growth on plates at alkaline pH, the palH-disrupted strain showed no growth. Thus, the results indicate that palI plays an important but not essential role in the pH signal transduction pathway of A. oryzae.

Introduction

The fungus Aspergillus oryzae is widely used in the industrial manufacturing of soy sauce and sake. Soy sauce production by solid-state fermentation involves many proteolytic and carbohydrase enzymes. The alkaline protease (Alp) of A. oryzae, a serine protease with an alkaline pH optimum, is used to hydrolyze the raw materials, a step considered to be very important for the delicious flavor of soy sauce. An improved Alp designed using protein engineering techniques is expected to be useful for the efficient production of soy sauce by A. oryzae (Murakami et al., 1991); however, the effect of ambient pH on Alp regulation in A. oryzae needs to be determined.

Extracellular pH is a key environmental signal that influences growth, physiology, and differentiation. Genes involved in the production of secreted enzymes, permeases, and exported metabolites, all of which must function at ambient pH, and genes involved in internal pH homeostasis are also likely to be influenced by ambient pH (Peñalva and Arst, 2002). In A. nidulans, alkaline protease (prtA) is strongly expressed under alkaline ambient conditions. PacC regulates the expression of prtA. Thus, PacC activates the transcription of alkaline-expressed genes (e.g., alkaline phosphatase [palD] and isopenicillin-N synthetase [ipnD]) and represses the transcription of acid-expressed genes (e.g., acid phosphatase [pacA] and GABA permease [gabA]). Additionally, pacC itself is an alkaline-expressed gene subject to autogenous transcriptional activation (Tilburn et al., 1995).

Under alkaline conditions, a signal transferred via the pal ambient pH signal transduction pathway (composed of palA, B, C, F, H, and I gene products) induces the activation of the transcription factor PacC (Selvig and Alspaugh, 2011). The alkaline pH-sensing module in the plasma membrane is composed of a 7-transmembrane-domain receptor, PalH, a 3-transmembrane-domain protein, palI, and an arrestin-related protein, PalF (Calcagno-Pizarelli et al., 2007). PalH is the ambient pH sensor, palI promotes the plasma membrane localization of PalH, and PalF helps in internalizing the pH signal from the cell surface receptor. PalA and PalC interact with Vps23, the main component of ESCRT-III (Peñas et al., 2007). PalA, a BRO1 domain-containing protein that binds two YPXL/I motifs in PacC, is required for the first ambient pH-dependent PacC proteolytic cleavage, which is probably catalyzed by the calpain-like cysteine protease PalB (Galindo et al., 2012). PacC is activated when a region of its C-terminus is proteolytically cleaved; the full-length form of PacC is inactive as either a transcriptional activator or repressor (Denison, 2000).

Rim9/palI, a member of the Sur7 family, contains a signal sequence and a block of three potential transmembrane helices. There are two classes of Rim9/palI proteins: the long proteins (476 - 756 amino acids), such as palI, that contain the Sur7 domain with a C-terminal extension, and the short proteins (225 - 399 amino acids), such as Rim9, that essentially contain only the Sur7 domain. Saccharomyces cerevisiae and Candida albicans have both long and short proteins. While short Rim9 proteins are required for alkaline-associated stress responses, deletions of the long-form genes do not produce a significant stress response phenotype. It appears that in fungal species such as A. nidulans that have only the long form of a palI-like protein, this element functions in the stress response (Yan et al., 2012). However, the role of palI in the ambient pH signal transduction pathway of A. oryzae remains unclear.

In a previous study, palH disruption caused a significant decrease in pacC expression and alkaline protease activity (Dohmoto et al., 2010). These results indicated that palH from A. oryzae and A. nidulans likely functions as an ambient pH sensor. Therefore, palH has an important function in the ambient pH signal transduction pathway of A. oryzae. In this study, we investigated the effect of palI disruption on pacC expression and Alp activity in A. oryzae. The results of our experiments may be applicable to soy sauce production.

Materials and Methods

Strains and culture conditions    A. oryzae ΔLigD and ΔpyrG strains were used as hosts for transformation. The control strain was transformed using only the pyrG gene. The palI disruption and control strains were grown on yeast-peptone-dextrose (YPD) medium at 30°C for 24 h. DNA was extracted using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA) according to the manufacturer's protocol.

Construction of transformant strains    ΔpalI was created using the procedure described by Tamano et al. (2007). The palI gene disruption cassette was generated by fusion polymerase chain reaction (PCR) using the Expand High Fidelity PCR System (Roche, Diagnostics, Mannheim, Germany). The 5′- and 3′-arms of the palI gene were amplified from genomic DNA with the primers LU/LL (5′-arm) and RU/RL (3′-arm). The pyrG gene was amplified with the primer pair PU/PL. Amplified fragments were purified using the Wizard Gel extraction kit (Promega, Madison, WI). The 5′-flanking:pyrG:3′-flanking amplicon (1:3:1 molar ratio) was used as a template. The PCR products were used for a second round of PCR with the primer pair LU/RL to fuse the 5′ and 3′ regions of the target gene at each end of the pyrG gene. The primer sequences (5′→3′) were as follows: TCGCGAAAGCTGTGGTATGCTA (LU), CACAGGGTACGTCTGTTGTGAGTTGCGGGTTTGAGAAGCATGG (LL), CAAACCCGCAACTCACAACAGACGTACCCTGTGATGTTC (PU), TAGTGTAGCCGAGATAACTGCACCTCAGAAGAAAAGGATG (PL), TTCTTCTGAGGTGCAGTTATCTCGGCTACACTAATGGTGCGTC (RU), and TCAGGGTATAGGGTATCGTGAG (RL). The amplified fragment was purified with the Wizard Gel extraction kit and used for transformation.

Fungal transformation was carried out essentially as described by Takahashi et al. (2004). The uridine prototrophic transformants were isolated by growing consecutively twice from single spores. Southern hybridization of genomic DNA was performed following digestion with XbaI. A DNA fragment containing sequence upstream of the palI gene was used as a probe. The DIG-DNA labeling and detection kit (Roche, Germany) was used for signal detection.

Expression analysis by real-time PCR    To analyze the expression of pacC and alp using real-time PCR (qPCR), we isolated total RNA and mRNA from the control and disrupted strains. These strains were precultured at 30°C for 24 h in minimal medium (MM; 2% glucose, 1.2% NaNO3, 0.3% KH2PO4, 0.1% KCl, and 0.1% MgSO4) containing 0.025% yeast extract. The main culture was then established for 3 or 24 h at 30°C in MM containing 0.2% casamino acids buffered to pH 8.0 using 0.1 M Tris-HCl (pH 9.5). Total RNA was extracted using RNAiso Plus reagent (TaKaRa, Shiga, Japan) according to the manufacturer's instructions. mRNA was purified using an Oligotex-dT30 < super > mRNA Purification Kit (TaKaRa) following the manufacturer's protocol. Reverse transcription and qPCR were performed according to the methods reported by Kobayashi et al. (2007) using the SuperScript III Platinum Two-Step qRT-PCR Kit with SYBR Green (Invitrogen, Carlsbad, CA, USA). Relative quantification was performed using the 2−ΔΔCt technique (Applied Biosystems User Bulletin 2). The sequences (5→3) of the palI primers were GAGCCTTTCGTGACTGGATCA (forward primer) and GCGGTCATCATCACTCTCATGT (reverse primer); the alp primers were designed according to methods reported by Dohmoto et al. (2010). Histone H1 was used as an endogenous control.

Alp activity    To determine Alp activity, we extracted proteins from the control and disrupted strains. These strains were grown at 30°C for 3 d on 5 g wheat bran containing 4 mL water. Alp was extracted according to the method reported by Ushijima et al. (1990), and Alp activity was determined as described by Tatumi et al. (1989).

Results and Discussion

Gene disruption and phenotype analysis of the resulting mutant    We identified the palI gene from A. oryzae (AO090020000143) by a homology search using palI (GenBank accession no. AN4853.2) from A. nidulans palI. palI from A. oryzae was homologous to palI from other organisms. For example, A. oryzae palI showed 53% homology to palI from A. nidulans, 70% homology to palI from A.fumigatus, and 86% homology to palI from A. flavus. In addition, similarly to A. nidulans, A. oryzae expressed only the long-form PalI-like protein, and not the short Rim9 protein (Yan et al., 2012). These results confirmed A. oryzae palI disruption.

To analyze palI function in A. oryzae, a palI-disrupted mutant of A. oryzae was constructed. Disruption of the palI gene was confirmed by Southern hybridization and PCR (data not shown). Southern hybridization was used to confirm transformation of the palI gene cassette disrupted by homologous recombination. We observed the expected hybridization signals at 3.9 kb and 1.9 kb using digested genomic DNA isolated from the control and disrupted strains, respectively (Fig. 1). These results showed successful homologous recombination at the resident palI locus. Furthermore, the expression of palI in the palI-disrupted strain was undetectable at the qPCR level (data not shown).

Fig. 1.

Southern hybridization analysis of palI disruptants Southern hybridization of genomic DNA obtained from control and palI disrupted strains. The lanes contain 20 µg of genomic DNA isolated from palI-disrupted strain (lane 1) and control strain (lane 2).

The A. oryzae palI-disrupted strain showed some growth on alkaline pH plates (Fig. 2) but normal growth on acid pH plates. Similarly, A. nidulans mutants for palI showed some growth at alkaline pH; however, palA, B, C, F, and H mutants do not grow at alkaline pH (Denison et al., 1998). Dohmoto et al. (2010) also showed that growth of an A. oryzae palH-disrupted strain was completely inhibited at pH 8. These data suggest that palI plays an important role but is not essential for the pH signal transduction pathway of A. oryzae.

Fig. 2.

Growth phenotype of palI disruptants

The control and palI disruptant (ΔpalI) strains were grown at 30°C for 5 d on CD agar. The medium was buffered to pH 4.0 using 0.1 M citrate-phosphate (pH 3.8) and to pH 8.0 using 0.1 M Tris-HCl (pH 9.5). The values are colony size (cm).

Analysis of pacC gene expression    To analyze the expression of pacC by qPCR, we isolated total RNA and purified mRNA from the control and disrupted strains. The transcription factor PacC was strongly expressed in the control strains under alkaline conditions. Proteolysis of PacC in A. nidulans is an essential and pH-sensitive step in the regulation of gene expression by ambient pH (Denison, 2000). Figure 3 shows the relative expression of pacC in the control and disrupted strains (n = 3). The nonspecific bands obtained using PCR were identified by polyacrylamide gel electrophoresis; however, no nonspecific band could be detected (data not shown). The expression of pacC in the palI-disrupted strain was approximately 4.3-fold less than that of the control strain. In A. nidulans, pacC is itself expressed under alkaline conditions and is subject to autogenous transcriptional activation (Tilburn et al., 1995). pacC transcript levels are low in the absence of pal signal transduction. Therefore, the pal signal transduction pathway could not operate in the palI-disrupted strain, and the expression of pacC decreased. This finding suggests that palI is important for the expression of pacC under alkaline conditions.

Fig. 3.

Comparison of pacC gene expression in control and palI disruptant strains by qPCR

Gene expression in the control strain was considered to be 1.0. The error bar indicates standard deviation. The main culture was 3 h at 30°C

Analysis of alp gene expression    We investigated the influence of palI disruption on alp expression and Alp activity. The relative expression of alp in the control strain was approximately 1.5-fold higher when the main culture was established for 3 h and 8.7-fold higher when the main culture was established for 24 h than in the palI-disrupted strain (data not shown). alp expression decreased in the palI-disrupted strain because the pal signal transduction pathway did not function in this strain.

Figure 4 shows the relative Alp activity in the control and disrupted strains (n = 3). The Alp activity in the palI-disrupted strain decreased to 29% of the control. Thus, palI disruption had significant effects on Alp activity. We concluded that pH signal transduction was interrupted by the disruption of palI, leading to reduction in Alp activity. On the other hand, Alp activity in the palH-disrupted strain is reportedly 6.3% of the control (Dohmoto et al., 2010). The influence on Alp activity in the palH-disrupted strain was greater than in the palI-disrupted strain, which indicates that PalH is more important than PalI.

Fig. 4.

Comparison of Alp activity in control and palI disruptant strains

The Alp activity of the control strain was considered to be 100%. The error bar indicates standard deviation

In conclusion, we analyzed the role of PalI in the ambient pH signal transduction pathway in A. oryzae. We found that palI disruption affected PacC expression and Alp activity. Our results predicted that PacC regulates the expression of alp and that the pal ambient pH signal transduction pathway induces the activation of the transcription factor PacC. Furthermore, palI of A. oryzae is similar to that of A. nidulans and is an alkaline-pH-sensing module in the plasma membrane. Thus, PalI has an important function in the ambient pH signal transduction pathway of A. oryzae. The palI-disrupted strain demonstrated decreased expression of pacC and some growth on alkaline pH plates. Therefore, PalI plays an accessory but not an essential role in the pH signal transduction pathway.

This information regarding Alp regulation may be useful in soy sauce production. In addition, if activation of the transcription factor PacC is regulated, implementation of this technology could improve the efficiency of soy sauce production. We intend to analyze this ambient pH signal transduction pathway in greater detail in future studies.

Acknowledgements    This work was supported by the MEXT (Ministry of Education, Culture, Sports, Science and Technology) Supported Program for the Strategic Research Foundation at Private Universities, 2009 - 2013. We thank Harue Kitagawa for technical assistance.

References
 
© 2014 by Japanese Society for Food Science and Technology

This article is licensed under a Creative Commons [Attribution-NonCommercial-ShareAlike 4.0 International] license.
https://creativecommons.org/licenses/by-nc-sa/4.0/
feedback
Top