Construction of Quintuple Protease and Double Amylase Gene Deletant for Heterologous Protein Production in Aspergillus oryzae KBN616

Abstract

We constructed a quintuple protease (alp, npII, pepE, npI, pepA) and double amylase (taaG3, taaG1) gene deletant, KO4, for the development of a heterologous gene expression system for an industrial shoyu koji mold, Aspergillus oryzae KBN616. Multiple gene deletion was performed using the Latour system, a simple and effective chromosome modification method developed in Schizosaccharomyces pombe. Gene deletion was confirmed by Southern blot analysis for protease genes and PCR amplification for amylase genes. Deletion of the five protease genes reduced the extracellular protease activity to approximately 1.0% of the level of the parent strain. Double deletion of the amylase genes completely eliminated all detectable α-amylase activity. These results indicate the construction of a host strain applicable to the efficient production and purification of heterologous proteins.

Introduction

The filamentous fungus Aspergillus oryzae has been employed for the production of traditional Japanese fermented foods and industrial enzymes for more than a thousand years. A. oryzae is considered an attractive microorganism for heterologous gene expression and foreign protein production due to its ability to secrete large amounts of enzymes such as amylases and proteases. Attempts have been made to improve the production and purification of heterologous proteins in Aspergillus at the (post)translational level (Gouka et al., 1997).

Proteolytic degradation of recombinant gene products by host-specific proteases results in low production yields of heterologous proteins. To overcome this problem, double, quintuple, and decuple protease gene disrupted strains were constructed (Jin et al., 2007, Maruyama and Kitamoto, 2008, Yoon et al., 2009, Yoon et al., 2011). The use of such strains resulted in a significant improvement in the production of bovine chymosin or human lysozyme as a reporter heterologous protein because of the synergistic effects of multiple protease gene disruptions. However, culture conditions and distinct characteristics of the strain employed affect the expression profiles of protease genes (te Biesebeke et al., 2005, Jin et al., 2007). The information regarding A. oryzae RIB40 proteases cannot be applied completely to the heterologous protein production of other A. oryzae strains.

Coexpression of endogenous secretory proteins and heterologous proteins can lead to competition within the secretory pathway, resulting in reduced heterologous protein production. In addition, endogenous proteins secreted in the culture medium interfere with the purification of the produced heterologous proteins. To overcome this issue, Taka-amylase A (TAA) was suppressed by RNA interference with the taa genes, since A. oryzae secretes TAA abundantly in the culture medium and the taa gene promoter is frequently used for homologous or heterologous protein production (Nemoto et al., 2009).

In our previous studies, a transformation system was developed for an industrial shoyu koji mold, A. oryzae KBN616, and several genes from this strain were overexpressed or repressed to elucidate their functions in shoyu production (Kitamoto et al., 1995, Kitamoto et al., 1996, Kitamoto et al., 1998a, Kitamoto et al., 1998b, Kitamoto et al., 1999a, Kitamoto et al., 1999b, Kitamoto et al., 2001a, Kitamoto et al., 2001b). Furthermore, heterologous genes from other fungi were successfully expressed and secreted in this strain in order to characterize the gene products (Yoshino-Yasuda et al., 2011, Yoshino-Yasuda et al., 2012, Chaya et al., 2014).

In this paper, to develop an efficient heterologous gene expression system for A. oryzae KBN616, multiple gene deletion was performed using the Latour system, a simple and effective chromosome modification method developed in Schizosaccharomyces pombe (Hirashima et al., 2006). As a result, we constructed a quintuple protease (alp, npII, pepE, npI, pepA) and double amylase (taaG3, taaG1) gene deletant with significantly low protease and no amylase activities.

Materials and Methods

Fungal strains, culture media and transformation    A. oryzae wild-type strain, KBN616 (Kitamoto et al., 1993), and pyrG gene disrupted strain, P4 (Mahmud et al., 2013), were used as DNA donors and for transformations. The strains generated in this study are listed in Table 1. RB medium (3% rice bran, 1% polypeptone, 0.5% KH₂PO₄, 0.5% KCl, 0.1% NaNO₃, and 0.05% MgSO₄^·7H₂O) was used for liquid cultivation of A. oryzae. Skim milk agar medium (1% skim milk, 1% glucose, 0.15% KH₂PO₄, 0.05% KCl, .05% MgSO₄^·7H₂O, 0.125% Triton X-100 and 1.5% agar) was used for detection of protease activity. SP agar medium (2% soluble starch, 1% polypeptone, 0.5% KH₂PO₄, 0.5% KCl, 0.1% NaNO₃, and 0.05% MgSO₄^·7H₂O) was used for detection of α-amylase activity. Czapek-Dox (CD) minimal medium plates containing 0.1% 5-fluoroorotic acid (5-FOA), 0.15% uridine and 0.07% uracil were used for the positive selection of pyrG-deficient strains. Protoplast transformation of A. oryzae was carried out according to a previously described method (Kitamoto et al., 1995).

Table 1. Strains used in this study

Name	Parental strain	Genotype	Reference
KBN616		Industrial shoyu koji mold	Kitamoto et al., 1993
P4	KBN616	pyrG	Mahmud et al., 2013
PDI1	P4	pyrG Δalp::pyrG	This study
PDE1	PDI1	pyrG alp	This study
PDI2	PDE1	pyrG alp ΔnpII::pyrG	This study
PDE2	PDI2	pyrG alp npII	This study
PDI3	PDE2	pyrG alp npII ΔpepE::pyrG	This study
PDE3	PDI3	pyrG alp npII pepE	This study
PDI4	PDE3	pyrG alp npII pepE ΔnpI::pyrG	This study
PDE4	PDI4	pyrG alp npII pepE npI	This study
PDI5	PDE4	pyrG alp npII pepE npI ΔpepA::pyrG	This study
PDE5	PDI5	pyrG alp npII pepE npI pepA	This study
KO1	PDE5	pyrG alp npII pepE npI pepA ΔtaaG3::pyrG	This study
KO2	KO1	pyrG alp npII pepE npI pepA taaG3	This study
KO3	KO2	pyrG alp npII pepE npI pepA taaG3 ΔtaaG1::pyrG	This study
KO4	KO3	pyrG alp npII pepE npI pepA taaG3 taaG1	This study

DNA techniques and PCR methods    Standard DNA techniques were used in this study (Sambrook and Russell, 2001). Genomic DNA of A. oryzae was prepared according to a previously described method (Kitamoto et al., 1993). PCR amplification was carried out with a GeneAmp9700 thermal cycler (Applied Biosystems, Foster City, CA, USA). PfuUltra II Fusion HS DNA polymerase (Stratagene, La Jolla, CA, USA) and TaKaRa Ex Taq DNA polymerase (Takara Bio, Otsu, Shiga) were used for PCR. Oligonucleotide primers used in this study are shown in Table 2. Essential cloning steps were confirmed by sequencing on a model 4000LS DNA sequencer (LI-COR, Lincoln, NE, USA).

Table 2. Oligonucleotide primers used in this study

Name	Sequence (5′ to 3′)	Direction
Primers for protease and amylase gene deletion
alp gene
delalp1	CAGGATCCTGATACCATCAGAAGACC	Forward
delalp2	TACTCTGTACATGGACGAGGGATGCATGTGGTATT	Reverse
delalp3	GGTTACGAGTCGCGAGGCAAAGATTCAGGAGCATACC	Forward
delalp4	TTGGATCCGAAGACGTCAACGACCTTGCCA	Reverse
delalp5	GCATCCCTCGTCCATGTACAGAGTATACTTATGTT	Forward
delalp6	AATCTTTGCCTCGCGACTCGTAACCGAGGAAAAG	Reverse
npII gene
delnpII1	CTGCATGCGAGAAGGACTTGGAGAGCTAC	Forward
delnpII2	TGAGGAGGATATTCCTTCTGGTCTGATGGCCTTCA	Reverse
delnpII3	TTATATAGAATCGCGAGGTCAAGCTGCCCAGATTG	Forward
delnpII4	GGGCATGCTTACCATTGGCATACAAGGC	Reverse
delnpII5	CAGACCAGAAGGAATATCCTCCTCAAAATACTCC	Forward
delnpII6	CAGCTTGACCTCGCGATTCTATATAACGGTGCGTATGG	Reverse
delnpII7	TGGATGATGAACAGGCGGAACAGAC	Reverse
pepE gene
delpepE1	TTGGATCCTGCTCTGCTGCGTCCAG	Forward
delpepE2	CAGTCAGATCTACGGCCCTTTTACAATACCGCCA	Reverse
delpepE3	GATATGGCATGTCGCGAGCAATTTGTGAGTAGACC	Forward
delpepE4	CAGGATCCACAGTACACTGGCTTGACTTAC	Reverse
delpepE5	GTAAAAGGGCCGTAGATCTGACTGTTCAGCAAGCA	Forward
delpepE6	CAAATTGCTCGCGACATGCCATATCTGACTACT	Reverse
delpepE8	CGAGCAATGTTAAGGTCATTATGGC	Forward
npI gene
delnpI1	TGGTCGACTCTAGTGTTTCCTATCCT	Forward
delnpI2	AGTAGCACAACACTCCGTGAAGAGTATGCCAATAA	Reverse
delnpI3	CTGGAAAAGTTCGCGACTGAGTCTTCGAGTGATGTTT	Forward
delnpI4	TGGTCGACGTGTTGGCAGTGTAGAAAAGCTG	Reverse
delnpI5	ACTCTTCACGGAGTGTTGTGCTACTTACATCGCTG	Forward
delnpI6	GAAGACTCAGTCGCGAACTTTTCCAGCAATATGAGA	Reverse
delnpI7	GGAGCATTTGCGGAGTTATATTGGG	Forward
pepA gene
delpepA1	ATGCATGCTAAGTGGAGAGCGACCCA	Forward
delpepA2	GTCTTTGTTTCGGAAATGGTCATTGCTTGTTTAGG	Reverse
delpepA3	GTAGTTGTGGTCGCGAGCCCAATGACATTGAGTAC	Forward
delpepA4	GAGCATGCTCTGAATACCGCCAACGCAA	Reverse
delpepA5	CAATGACCATTTCCGAAACAAAGACATACAAGGAG	Forward
delpepA6	CATTGGGCTCGCGACCACAACTACTATGACCCGAATGC	Reverse
delpepA7	CCATTAGGGACTTTCCTGTCAGTCC	Forward
taaG3 gene
deltaaG31	GCAAGCTTAGCGCCTAAAACGCCTTAT	Forward
deltaaG32	CAGTAACGACTCCAAGCATGGCATCCCTTGCTAG	Reverse
deltaaG33	TCCGAGCGGATCGACGACTCGCGACTTGTAATAC	Forward
deltaaG34	GTAAGCTTCCATGACGTTCTGGTAGGGACAAG	Reverse
deltaaG35	CATGCCATGCTTGGAGTCGTTACTGCTGTCATCCC	Forward
deltaaG36	GTCGCGAGTCGTCGATCCGCTCGGAGTAATGAAAAG	Reverse
deltaaG37	GCGAATATGGCGGCAAATACACTAG	Reverse
taaG1 gene
deltaaG31	GCAAGCTTAGCGCCTAAAACGCCTTAT	Forward
deltaaG12	CAAAAGACCATACATCGCATCGACAAGGGACATA	Reverse
deltaaG13	TTCAGTCACAGGCCTTGTAATACTGCGGATCGGGTGTG	Forward
deltaaG34	GTAAGCTTCCATGACGTTCTGGTAGGGACAAG	Reverse
deltaaG15	TGTCGATGCGATGTATGGTCTTTTTGTTCTATAG	Forward
deltaaG16	GCAGTATTACAAGGCCTGTGACTGAAGCCATCCCTGA	Reverse
deltaaG17	CTGAGGTCATGCCACACTCATTTCC	Reverse
Primers for pyrG amplification
pyrGN2	CAAGGCCTGCTGGAATTGACATTATTATGG	Forward
pyrGC2	AAAGGCCTGATCAATACCGTACGGGAGATT	Reverse

Construction of protease gene deletion plasmids    An alp gene deletion plasmid, pDelAlp-2, was constructed as follows. Both 1.0-kb 5′- and 3′-flanking regions of the alp gene were amplified from A. oryzae genomic DNA with the primer pairs delalp1/delalp2 and delalp5/delalp6. A 1.0-kb part of the coding region of the alp gene was amplified from A. oryzae genomic DNA with the primer pair delalp3/delalp4. The three PCR-products were mixed and used as a template in a fusion PCR that was carried out using the primer pair delalp1/delalp6. The fusion PCR product was subcloned into the SmaI site of pUC18, thereby generating pDelAlp-1. A 1.8-kb StuI digested pyrG gene fragment, amplified from A. oryzae genomic DNA with the primer pair pyrGN2/pyrGC2, was inserted into the NruI site of pDelAlp-1 to yield pDelAlp-2. Using the primers listed in Table 2, the other four protease gene deletion plasmids, pDelNpII-2 to pDelPepA-2, were constructed using the same procedure as for the alp gene deletion plasmid, pDelAlp-2. The protease genes targeted in this study are listed in Table 3.

Table 3. Deleted genes of A. oryzae assessed in this study

Gene	Gene ID	Genbank accession number
alp	AO090003001036	AP007155 / S79617
npII	AO090010000493	AP007175/S53810
pepE	AO090003000693	AP007155 / AB074195
npI	AO090011000036	AP007171/AF099904
pepA	AO090120000474	AP007166/ D13894
taaG3	AO090023000944	AP007157
taaG1	Not annotated	AP007155/M33218

Construction of taa gene deletion plasmids    A taaG3 gene deletion plasmid, pDelTaaG3-2, was constructed as follows. Both 1.0-kb 5′- and 3′-flanking regions of the taaG3 gene were amplified from A. oryzae genomic DNA with the primer pairs deltaaG31/deltaaG32 and deltaaG35/deltaaG36. A 1.0-kb part of the coding region of the taaG3 gene was amplified from A. oryzae genomic DNA with the primer pair deltaaG33/deltaaG34. The three PCR-products were mixed and used as a template in a fusion PCR that was carried out using the primer pair deltaaG31/deltaaG34. The fusion PCR product was subcloned into the SmaI site of pUC18, thereby generating pDelTaaG3-1. A 1.8-kb StuI digested pyrG gene fragment, amplified as described above, was inserted into the NruI site of pDelTaaG3-1 to yield pDelTaaG3-2. Using the primers listed in Table 2, the taaG1 gene deletion plasmid, pDelTaaG1-2, was constructed by the same procedure as for the taaG3 gene deletion plasmid, pDelTaaG3-2, except for the use of StuI instead of NruI. The taa genes targeted in this study are listed in Table 3.

Southern blot analysis    Genomic DNA was isolated from the A. oryzae strains as described previously (Kitamoto et al., 1993). DNA was fractionated by electrophoresis on a 0.7% agarose gel and transferred to a Hybond-N⁺ membrane (GE Healthcare, Buckinghamshire, UK). Labeling of the probes and detection of the signals in Southern hybridization were carried out using the AlkPhos Direct Labelling and Detection System with CDP-Star (GE Healthcare). Hybridization was carried out at 55°C in the hybridization buffer, and the membrane was washed twice with the primary wash buffer at 55°C for 10 min and twice with the secondary wash buffer at room temperature for 5 min, according to the manufacturer's instructions.

Enzyme assay    Approximately 5 × 10⁵ conidia were inoculated into 100 mL of RB medium supplemented with 0.15% uridine and 0.07% uracil and then cultured at 30°C for 4 days. Total extracellular protease activity in the culture supernatant of A. oryzae strains was measured according to the method described in “Shoyu Shiken-Ho”, with slight modifications (Nihon Shoyu Kenkyusho, 1985). Notably, the reaction mixture was incubated at pH7.0 for 60 min at 37°C instead of at pH7.0 for 10 min at 30°C.

The α-amylase activity of the culture supernatant was measured using an α-amylase assay kit (Kikkoman, Noda, Chiba).

Results and Discussion

Construction of an A. oryzae quintuple protease gene deletant    Genome sequencing of A. oryzae RIB40 revealed the existence of 134 protease genes, consisting of 69 exopeptidases and 65 endopeptidases (Machida et al., 2005). Of these, alkaline, neutral and acidic proteases contribute significantly to the digestion of soybean protein during soy sauce brewing (Nakadai et al., 1973a, Nakadai et al., 1973b, Nakadai et al., 1973c, Nakadai and Nasuno, 1977).

Alp is the major alkaline protease secreted by A. oryzae. Firstly, the alp gene was deleted since the loss of alp gene function can be easily detected using the skim milk plate assay. pDelAlp-2, a plasmid carrying an alp deletion cassette, was used to construct the alp deletion mutant of A. oryzae P4 (Fig. 1A). A. oryzae P4 was transformed using a PCR-amplified fragment (primer pair, delalp1/delalp4; template, pDelAlp-2). Of the 99 transformants screened, 21 formed a smaller clear zone than A. oryzae KBN616 (parent strain of A. oryzae P4) on the skim milk agar plate after 48 h (Fig. 1B). Of these strains, A. oryzae PDI1 was used for further experiments. Southern blot analysis of genomic DNA from A. oryzae PDI1 and P4 digested with XhoI and BamHI revealed that A. oryzae PDI1 contained the predicted 8.9-kb fragment while A. oryzae P4 contained the 6.3-kb fragment (Fig. 1C). These results indicated that the PCR-amplified alp deletion cassette was integrated into the alp locus in A. oryzae PDI1. Integration of the alp deletion cassette into the alp locus causes duplication of the 1.0-kb 3′-flanking region of the alp gene on both sides of the pyrG and alp genes as a direct repeat. Homologous recombination between these identical sequences results in deletion of both of the pyrG and alp genes with 5-FOA treatment. To delete the pyrG and alp genes, A. oryzae PDI1 conidia (approximately 1 × 10⁵) were spread on 5-FOA-, uridine- and uracil-containing CD plates, and 5-FOA-resistant colonies were selected after 5 days of cultivation at 30°C. 5-FOA-resistant colonies were obtained at a frequency of approximately 1 × 10⁻³. Southern blot analysis of genomic DNA from A. oryzae PDE1, a 5-FOA-resistant strain, and PDI1 digested with XhoI and BamHI revealed that A. oryzae PDE1 contained the predicted 4.7-kb fragment while A. oryzae PDI1 contained the 8.9- kb fragment (Fig. 1C). These results indicated that the alp gene was excised from A. oryzae P4.

Fig. 1.

Construction scheme and confirmation of the alp deletant.

A. Scheme of the alp deletion. PCR-amplified DNA fragments from an alp deletion plasmid, pDelAlp-2, were transformed to A. oryzae P4 and 5-FOA resistant transformants were selected. An alp deletion mutant, A. oryzae PDE1, was obtained. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the alp gene, respectively. The open and black arrows indicate the pyrG and alp genes, respectively. The direction of the arrow indicates the orientation of the pyrG and alp genes. B. Skim milk agar plate assay for detection of protease activity. A. oryzae P4 and transformants were grown on skim milk agar medium at 30°C for 48 hours and the formation of zones of clearance around colonies was assessed. The zone was made clearer by flooding the plates with a solution of 5% trichloroacetic acid. C. Southern blot analysis of genomic DNA isolated from A. oryzae P4, PDI1 and PDE1. Genomic DNA (about 5 µg) was digested with XhoI and BamHI, and processed for Southern blot hybridization. Hybridization was performed using the AlkPhos Direct system with the 1.0-kb PCR fragment amplified with the primers delalp5/delalp6 used as a probe.

Secondly, pDelNpII-2, a plasmid carrying a npII deletion cassette, was used to construct the npII deletion mutant of A. oryzae PDE1 (Fig. 2A). A. oryzae PDE1 was transformed using a PCR-amplified fragment (primer pair, delnpII1/delnpII4; template, pDelNpII-2). The loss of NpII activity is not easily detected using the skim milk agar plate assay because NpII has low activity on milk casein (Sekine, 1973). Therefore, transformants were examined by detection of a DNA fragment that was PCR-amplified from the transformants using the primer pair delnpII1/delnpII7. For 3 out of the 57 transformants examined, a 6.3-kb fragment was detected, while a 3.7-kb fragment was detected from A. oryzae PDE1 (Fig. 2A). Of these strains, A. oryzae PDI2 was used for further experiments. Southern blot analysis of genomic DNA from A. oryzae PDI2 and PDE1 digested with SphI revealed that A. oryzae PDI2 contained the predicted 9.7-kb fragment while A. oryzae PDE1 contained the 7.1-kb fragment (Fig. 2A). These results indicated that the PCR-amplified npII deletion cassette was integrated into the npII locus in A. oryzae PDE1. Deletion of both the pyrG and npII genes from A. oryzae PDI2 was performed using the same procedure as for the pyrG and alp genes from A. oryzae PDI1. Southern blot analysis of genomic DNA from A. oryzae PDE2, a 5-FOA-resistant strain, and PDI2 digested with SphI revealed that A. oryzae PDE2 contained the predicted 5.5-kb fragment while A. oryzae PDI2 contained the 9.7-kb fragment (Fig. 2A). These results indicated that the npII gene was excised from A. oryzae PDE1.

Fig. 2.

Southern blot analysis of the multiple protease gene deletant.

A. Deletion of the npII gene. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the npII gene, respectively. The open and black arrows indicate the pyrG and npII genes, respectively. The direction of the arrow indicates the orientation of the pyrG and npII genes. Small arrows indicate the position of the oligonucleotide primers delnpII1 and delnpII7. Genomic DNA was digested with SphI. The 1.0-kb PCR fragment amplified with the primers delnpII5/delnpII6 was used as a probe. B. Deletion of the pepE gene. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the pepE gene, respectively. The open and black arrows indicate the pyrG and pepE genes, respectively. The direction of the arrow indicates the orientation of the pyrG and pepE genes. Small arrows indicate the position of the oligonucleotide primers delpepE8 and delpepE6. Genomic DNA was digested with SmaI. The 1.0-kb PCR fragment amplified with the primers delpepE5/delpepE6 was used as a probe. C. Deletion of the npI gene. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the npI gene, respectively. The open and black arrows indicate the pyrG and npI genes, respectively. The direction of the arrow indicates the orientation of the pyrG and npI genes. Small arrows indicate the position of the oligonucleotide primers delnpI7 and delnpI6. Genomic DNA was digested with SacI. The 1.0-kb PCR fragment amplified with the primers delnpI5/delnpI6 was used as a probe. D. Deletion of the pepA gene. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the pepA gene, respectively. The open and black arrows indicate the pyrG and pepA genes, respectively. The direction of the arrow indicates the orientation of the pyrG and pepA genes. Small arrows indicate the position of the oligonucleotide primers delpepA7 and delpepA6. Genomic DNA was digested with SalI. The 1.0-kb PCR fragment amplified with the primers delpepA5/delpepA6 was used as a probe.

Thirdly, pDelPepE-2, a plasmid carrying a pepE deletion cassette, was used to construct the pepE deletion mutant of A. oryzae PDE2 (Fig. 2B). A. oryzae PDE2 was transformed using a PCR-amplified fragment (primer pair, delpepE1/delpepE4; template, pDelPepE-2). The loss of PepE activity could not be detected using the skim milk agar plate assay because PepE is an intracellular acid protease (van den Hombergh et al., 1997). Therefore, transformants were examined by detection of a DNA fragment that was PCR-amplified from the transformants using the primer pair delpepE8/delpepE6. For 5 out of the 100 transformants examined, a 2.1-kb fragment was detected, while a 4.4-kb fragment was detected from A. oryzae PDE2 (Fig. 2B). Of these strains, A. oryzae PDI3 was used for further experiments. Southern blot analysis of genomic DNA from A. oryzae PDI3 and PDE2 digested with SmaI revealed that A. oryzae PDI3 contained the predicted 9.3-kb fragment while A. oryzae PDE2 contained the 6.9-kb fragment (Fig. 2B). These results indicated that the PCR-amplified pepE deletion cassette was integrated into the pepE locus in A. oryzae PDE2. Deletion of both of the pyrG and pepE genes from A. oryzae PDI3 was performed using the same procedure as described above. Southern blot analysis of genomic DNA from A. oryzae PDE3, a 5-FOA-resistant strain, and PDI3 digested with SmaI revealed that A. oryzae PDE3 contained the predicted 4.6-kb fragment while A. oryzae PDI3 contained the 9.3-kb fragment (Fig. 2B). These results indicated that the pepE gene was excised from A. oryzae PDE2.

Fourthly, pDelNpI-2, a plasmid carrying a npI deletion cassette, was used to construct the npI deletion mutant of A. oryzae PDE3 (Fig. 2C). A. oryzae PDE3 was transformed using a PCR-amplified fragment (primer pair, delnpI1/delnpI4; template, pDelNpI-2). Disruption of three protease genes, alp, pepE and npII, caused significantly decreased protease activity in A. oryzae PDE3. Therefore, transformants were examined by detection of a DNA fragment that was PCR-amplified from the transformants using the primer pair delnpI7/delnpI6. For 12 out of the 99 transformants examined, a 2.1-kb fragment was detected, while a 5.1-kb fragment was detected from A. oryzae PDE3 (Fig. 2C). Of these strains, A. oryzae PDI4 was used for further experiments. Southern blot analysis of genomic DNA from A. oryzae PDI4 and PDE3 digested with SacI revealed that A. oryzae PDI4 contained the predicted 8.0-kb fragment while A. oryzae PDE3 contained the 5.6-kb fragment (Fig. 2C). These results indicated that the PCR-amplified npI deletion cassette was integrated into the npI locus in A. oryzae PDE3. Deletion of both the pyrG and npI genes from A. oryzae PDI4 was performed using the same procedure as described above. Southern blot analysis of genomic DNA from A. oryzae PDE4, a 5-FOA-resistant strain, and PDI4 digested with SacI revealed that A. oryzae PDE4 contained the predicted 2.6-kb fragment while A. oryzae PDI4 contained the 8.0-kb fragment (Fig. 2C). These results indicated that the npI gene was excised from A. oryzae PDE3.

Finally, pDelPepA-2, a plasmid carrying a pepA deletion cassette, was used to construct the pepA deletion mutant of A. oryzae PDE4 (Fig. 2D). A. oryzae PDE4 was transformed using a PCR-amplified fragment (primer pair, delpepA1/delpepA4; template, pDelPepA-2). Transformants were examined by detection of a DNA fragment that was PCR-amplified from the transformants using the primer pair delpepA7/delpepA6. For 5 out of the 100 transformants examined, a 2.1-kb fragment was detected, while a 4.4-kb fragment was detected from A. oryzae PDE4 (Fig. 2D). Of these strains, A. oryzae PDI5 was used for further experiments. Southern blot analysis of genomic DNA from A. oryzae PDI5 and PDE4 digested with SalI revealed that A. oryzae PDI5 contained the predicted 8.1-kb fragment while A. oryzae PDE4 contained the 6.0-kb fragment (Fig. 2D). These results indicated that the PCR-amplified pepA deletion cassette was integrated into the pepA locus in A. oryzae PDE4. Deletion of both the pyrG and pepA genes was performed using the same procedure as described above. Southern blot analysis of genomic DNA from A. oryzae PDE5, a 5-FOA-resistant strain, and PDI5 digested with SalI revealed that A. oryzae PDE5 contained the predicted 3.6-kb fragment while A. oryzae PDI5 contained the 8.1-kb fragment (Fig. 2D). These results indicated that the pepA gene was excised from A. oryzae PDE4.

As a result, a quintuple protease gene (alp, npII, pepE, npI, pepA) deletant designated as A. oryzae PDE5 was successfully generated.

Construction of an A. oryzae quintuple protease and double amylase gene deletant    A. oryzae KBN616, the parent strain of A. oryzae P4, contains two amylase genes, taaG1 and taaG3 (Kitamoto et al., 2006). taaG3 gene expression is approximately 4-fold higher than that of the taaG1 gene due to the substitution of the CCAAT sequence to CCAAA in the taaG1 gene promoter (Nemoto et al., 2012, Yoshino-Yasuda et al., 2013). The taaG3 gene was deleted first since the loss of taaG3 gene function can be detected easily using the starch plate assay. pDelTaaG3-2, a plasmid carrying a taaG3 deletion cassette, was used to construct the taaG3 deletion mutant of A. oryzae PDE5 (Fig. 3A). A. oryzae PDE5 was transformed using a PCR-amplified fragment (primer pair, deltaaG31/deltaaG34; template, pDelTaaG3-2). Of the 99 transformants screened, 13 transformants formed a smaller clear zone than A. oryzae PDE5 on the starch agar plate with KI-I₂ staining after 48 h (Fig. 3B), while the remainder formed similarly sized clear zones. Appropriate restriction enzyme sites for Southern blot analysis could not be found in the surrounding region of the taaG3 gene. Therefore, integration of the taaG3 deletion cassette into the taaG3 locus was detected by PCR using the primer pair deltaaG31/deltaaG37. For these 13 transformants, a 6.8-kb fragment was detected, while a 4.2-kb fragment was detected from A. oryzae PDE5 (Fig. 3A). Of these strains, A. oryzae KO1 was used for further experiments. Deletion of both the pyrG and taaG3 genes from A. oryzae KO1 was performed using the same procedure as described above and was detected by PCR using the primer pair deltaaG31/deltaaG37. A 6.8-kb fragment was amplified from the genomic DNA of A. oryzae KO1, whereas a 2.0-kb fragment was amplified from the genomic DNA of a 5-FOA-resistant strain, A. oryzae KO2 (Fig. 3A). These results indicated that the taaG3 gene was successfully excised from A. oryzae KO1.

Fig. 3.

Construction scheme and confirmation of the taa deletant.

A. Deletion of the taaG3 gene. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the taaG3 gene, respectively. The open and black arrows indicate the pyrG and taaG3 genes, respectively. The direction of the arrow indicates the orientation of the pyrG and taaG3 genes. Small arrows indicate the position of the oligonucleotide primers deltaaG31 and deltaaG37. Agarose gel electrophoresis of amplified DNA fragments in the taaG3 gene region of the taaG3 disruption and deletion strains using the primer pair deltaaG31/deltaaG37. B. Starch agar plate assay for detection of amylase activity. The parent strain and transformants were grown on the starch agar medium at 30°C for 48 hours. Then, they were examined for halo formation around the colony by flooding the plates with a solution of KI-I₂. C. Deletion of the taaG1 gene. Dark and light gray boxes indicate the 5′- and 3′-flanking regions of the taaG1 gene, respectively. The open and black arrows indicate the pyrG and taaG1 genes, respectively. The direction of the arrow indicates the orientation of the pyrG and taaG1 genes. Small arrows indicate the position of the oligonucleotide primers deltaaG31 and deltaaG17. Agarose gel electrophoresis of amplified DNA fragments in the taaG1 gene region of the taaG1 disruption and deletion strains using the primer pair deltaaG31/deltaaG17.

Next, pDelTaaG1-2, a plasmid carrying a taaG1 deletion cassette, was used to construct the taaG1 deletion mutant of A. oryzae KO2 (Fig. 3C). A. oryzae KO2 was transformed using a PCR-amplified fragment (primer pair, deltaaG31/deltaaG34; template, pDelTaaG1-2). Of the 100 transformants screened, 28 transformants did not form a clear zone on the starch agar plate with KI-I₂ staining after 48 h (Fig. 3B), while the remainder did. Integration of the taaG1 deletion cassette into the taaG1 locus was detected by PCR using the primer pair deltaaG31/deltaaG17. For these 28 transformants, a 6.8-kb fragment was detected, while a 4.2-kb fragment was detected from A. oryzae KO2 (Fig. 3C). Of these strains, A. oryzae KO3 was used for further experiments. Deletion of both of the pyrG and taaG1 genes from A. oryzae KO3 was performed using the same procedure as described above and was detected by PCR using the primer pair deltaaG31/deltaaG17. A 6.8-kb fragment was amplified from the genomic DNA of A. oryzae KO3, whereas a 2.0-kb fragment was amplified from the genomic DNA of the 5-FOA-resistant strain, A. oryzae KO4 (Fig. 3C). These results indicated that the taaG1 gene was excised from A. oryzae KO2.

As a result, a quintuple protease (alp, npII, pepE, npI, pepA) and double amylase (taaG3, taaG1) gene deletant designated as A. oryzae KO4 was successfully generated. This is the first report on the combined deletion of protease and amylase genes in a filamentous fungus.

Effect of quintuple protease and double amylase gene deletion on protease and amylase activities    To assess the effect of quintuple protease and double amylase gene deletion on protease and amylase activities, A. oryzae P4, PDE1, PDE2, PDE3, PDE4, PDE5, KO2 and KO4 were cultivated for 4 days at 30°C in RB medium supplemented with 0.15% uridine and 0.07% uracil. Total protease activity was reduced to 6.0% compared to A. oryzae P4 with alp gene deletion (Fig. 4). For further deletion of the npII and pepE genes, no significant changes in total protease activity were observed due to the low activity on milk casein or the intracellular acid protease, whereas additional deletion of the npI and pepA genes reduced the activity to approximately 1.0% of the level of A. oryzae P4 (Fig. 4). In the case of A. oryzae RIB40, disruption of the alp gene and ten protease genes including alp gene showed approximately 35% and 50% lower activity as compared to that of the control strain, respectively (Jin et al., 2007, Yoon et al., 2011), results which differ from our data. Alp is a major proteolytic enzyme secreted by the shoyu koji mold, A. oryzae, and is thought to be vital in producing the palatable taste of soy sauce via hydrolysis of raw materials. A. oryzae KBN616, from which A. oryzae P4 was derived, is an industrial shoyu koji mold. Therefore, A. oryzae P4 secretes large amounts of Alp in the culture medium as described above. As a result, extracellular total protease activity is presumed to be severely reduced in A. oryzae PDE1 due to the alp deletion.

Fig. 4.

Effect of multiple gene deletion on the production of extracellular protease and α-amylase.

The A. oryzae strains were cultivated as described in the Materials and Methods. Total protease (gray box, left y-axis) and α-amylase (white box, right y-axis) activities were measured in the culture supernatant of each strain. The activity of two independent experiments is presented as the average ± standard deviation.

Amylase activity was reduced to approximately 20% compared to A. oryzae P4 with taaG3 gene deletion (Fig. 4), which was in accordance with the previously described results (Nemoto et al., 2012, Yoshino-Yasuda et al., 2013). Additional deletion of the taaG1 gene completely eliminated all detectable α-amylase activity.

The culture supernatants of the protease and amylase gene deletants were subjected to SDS-PAGE analysis (Fig. 5). Deletion of the alp gene resulted in the disappearance of the 34-kDa Alp protein, and deletion of the other protease genes had little effect on the secreted protein profiles. Furthermore, the intensities of the TAA band was lower in the taaG3 gene deletant and no band was observed in the double deletant, which is in good agreement with the α-amylase activity data.

Fig. 5.

SDS-polyacrylamide gel electrophoresis of culture supernatants for the multiple gene deletants.

A. oryzae strains were cultivated as described in the Materials and Methods. Culture supernatants (9 µL) were subjected to SDS-PAGE on a 12.5% gel and stained with Coomassie Brilliant Blue. Arrowheads indicate bands of TAA and Alp.

In this study, we constructed an A. oryzae quintuple protease gene (alp, npII, pepE, npI, pepA) and double amylase gene (taaG3, taaG1) deletant. The significant reduction of extracellular protease activity and suppression of TAA secretion in A. oryzae should result in the efficient production and purification of heterologous proteins. To evaluate the effects of the resultant multiple deletions, we are currently working to produce heterologous proteins using A. oryzae KO4.

Acknowledgments    We thank M. Hoshida and K. Ohtani for their technical assistance. This study was partially supported by a grant from the Naito Science & Engineering Foundation.

References

•  Chaya,  E.,  Suzuki,  T.,  Karita,  S.,  Hanya,  A.,  Yoshino-Yasuda,  S., and  Kitamoto,  N. (2014). Sequence analysis and heterologous expression of the wool cuticle-degrading enzyme encoding genes in Fusarium oxysporum 26-1. J. Biosci. Bioeng., 117, 711-714.
•  Gouka,  R. J.,  Punt,  P. J., and  van den Hondel,  C. A. M. J. J. (1997). Efficient production of secreted proteins by Aspergillus: progress, limitations and prospects. Appl. Microbiol. Biotechnol., 47, 1-11.
•  Hirashima,  K.,  Iwaki,  T.,  Takegawa,  K.,  Giga-Hama,  Y., and  Tohda,  H. (2006). A simple and effective chromosome modification method for large-scale deletion of genome sequences and identification of essential genes in fission yeast. Nucl. Acids Res., 34, e11.
•  Jin,  F. J.,  Watanabe,  T.,  Juvvadi,  P. R.,  Maruyama,  J.,  Arioka,  M., and  Kitamoto,  K. (2007). Double disruption of the proteinase genes, tppA and pepE, increases the production level of human lysozyme by Aspergillus oryzae. Appl. Microbiol. Biotechnol., 76, 1059-1068.
•  Kitamoto,  N.,  Kimura,  T.,  Kito,  Y.,  Ohmiya,  K., and  Tsukagoshi,  N. (1993). Structural features of a polygalacturonase gene cloned from Aspergillus oryzae KBN616. FEMS Microb. Lett., 111, 37-42.
•  Kitamoto,  N.,  Kimura,  T.,  Kito,  Y.,  Ohmiya,  K., and  Tsukagoshi,  N. (1995). The nitrate reductase gene from a shoyu koji mold, Aspergillus oryzae KBN616. Biosci. Biotechnol. Biochem., 59, 1795-1797.
•  Kitamoto,  N.,  Go,  M.,  Shibayama,  T.,  Kimura,  T.,  Kito,  Y.,  Ohmiya,  K., and  Tsukagoshi,  N. (1996). Molecular cloning, purification and characterization of two endo-1,4-β-glucanases from Aspergillus oryzae KBN616. Appl. Microbiol. Biotechnol., 46, 538-544.
•  Kitamoto,  N.,  Matsui,  J.,  Kawai,  Y.,  Kato,  A.,  Yoshino,  S.,  Ohmiya,  K., and  Tsukagoshi,  N. (1998a). Utilization of the TEF1 α-gene (TEF1) promoter for expression of polygalacturonase genes, pgaA and pgaB, in Aspergillus oryzae. Appl. Microbiol. Biotechnol., 50, 85-92.
•  Kitamoto,  N.,  Yoshino,  S.,  Ito,  M.,  Kimura,  T.,  Ohmiya,  K., and  Tsukagoshi,  N. (1998b). Repression of the expression of genes encoding xylanolytic enzymes in Aspergillus oryzae by introduction of multiple copies of the xynF1 promoter. Appl. Microbiol. Biotechnol., 50, 558-563.
•  Kitamoto,  N.,  Okada,  H.,  Yoshino,  S.,  Ohmiya,  K., and  Tsukagoshi,  N. (1999a). Pectin methylesterase gene (pmeA) from Aspergillus oryzae KBN616: its sequence analysis, overexpression, and characterization of the gene product. Biosci. Biotechnol. Biochem., 63, 120-124.
•  Kitamoto,  N.,  Yoshino,  S.,  Ohmiya,  K., and  Tsukagoshi,  N. (1999b). Sequence analysis, overexpression, and antisense inhibition of a β-xylosidase gene, xylA, from Aspergillus oryzae KBN616. Appl. Environ. Microbiol., 65, 20-24.
•  Kitamoto,  N.,  Yasuda-Yoshino,  S.,  Ohmiya,  K., and  Tsukagoshi,  N. (2001a). A second pectin lyase gene (pel2) from Aspergillus oryzae KBN616: its sequence analysis and overexpression, and characterization of the gene products. J. Biosci. Bioeng., 91, 378-381.
•  Kitamoto,  N.,  Yoshino,  S.,  Ohmiya,  K., and  Tsukagoshi,  N. (2001b). Sequence analysis and overexpression of a pectin lyase gene (pel1) from Aspergillus oryzae KBN616. Biosci. Biotechnol. Biochem., 65, 209-212.
•  Kitamoto,  N.,  Yasuda-Yoshino,  S.,  Hatamoto,  O., and  Masuda,  T. (2006). Disruption of the gene encoding a transcriptional activator for amylolytic genes, AmyR, of Aspergillus oryzae. J. Jpn. Soy Sauce Res. Inst., 32, 83-87 (in Japanese).
•  Machida,  M.,  Asai,  K.,  Sano,  M.,  Tanaka,  T.,  Kumagai,  T.,  Terai,  G.,  Kusumoto,  K.,  Arima,  T.,  Akita,  O.,  Kashiwagi,  Y.,  Abe,  K.,  Gomi,  K.,  Horiuchi,  H.,  Kitamoto,  K.,  Kobayashi,  T.,  Takeuchi,  M.,  Denning,  D. W.,  Galagan,  J. E.,  Nierman,  W. C.,  Yu,  J.,  Archer,  D. B.,  Bennett,  J. W.,  Bhatnagar,  D.,  Cleveland,  T. E.,  Fedorova,  N. D.,  Gotoh,  O.,  Horikawa,  H.,  Hosoyama,  A.,  Ichinomiya,  M.,  Igarashi,  R.,  Iwashita,  K.,  Juvvadi,  P. R.,  Kato,  M.,  Kato,  Y.,  Kin,  T.,  Kokubun,  A.,  Maeda,  H.,  Maeyama,  N.,  Maruyama,  J.,  Nagasaki,  H.,  Nakajima,  T.,  Oda,  K.,  Okada,  K.,  Paulsen,  I.,  Sakamoto,  K.,  Sawano,  T.,  Takahashi,  M.,  Takase,  K.,  Terabayashi,  Y.,  Wortman,  J. R.,  Yamada,  O.,  Yamagata,  Y.,  Anazawa,  H.,  Hata,  Y.,  Koide,  Y.,  Komori,  T.,  Koyama,  Y.,  Minetoki,  T.,  Suharnan,  S.,  Tanaka,  A.,  Isono,  K.,  Kuhara,  S.,  Ogasawara,  N., and  Kikuchi,  H. (2005). Genome sequencing and analysis of Aspergillus oryzae. Nature, 438, 1157-1161.
•  Mahmud,  A.,  Hattori,  K.,  Hongwen,  C.,  Kitamoto,  N.,  Suzuki,  T.,  Nakamura,  K., and  Takamizawa,  K. (2013). NAD⁺-dependent xylitol dehydrogenase (xdhA) and L-arabitol-4-dehydrogenase (ladA) deletion mutants of Aspergillus oryzae for improved xylitol production. Biotechnol. Lett., 35, 769-777.
•  Maruyama,  J. and  Kitamoto,  K. (2008). Multiple gene disruptions by marker recycling with highly efficient gene-targeting background (ΔligD) in Aspergillus oryzae. Biotechnol. Lett., 30, 1811-1817.
•  Nakadai,  T.,  Nasuno,  S., and  Iguchi,  N. (1973a). Purification and properties of alkaline protease from Aspergillus oryzae. Agric. Biol. Chem., 37, 2685-2694.
•  Nakadai,  T.,  Nasuno,  S., and  Iguchi,  N. (1973b). Purification and properties of neutral protease I from Aspergillus oryzae. Agric. Biol. Chem., 37, 2695-2701.
•  Nakadai,  T.,  Nasuno,  S., and  Iguchi,  N. (1973c). Purification and properties of neutral protease II from Aspergillus oryzae. Agric. Biol. Chem., 37, 2703-2708.
•  Nakadai,  T. and  Nasuno,  S. (1977). The action of acid proteinase from Aspergillus oryzae on soybean proteins. Agric. Biol. Chem., 41, 409-410.
•  Nemoto,  T.,  Maruyama,  J., and  Kitamoto,  K. (2009). Improvement of heterologous protein production in Aspergillus oryzae by RNA interference with α-amylase genes. Biosci. Biotechnol. Biochem., 73, 2370-2373.
•  Nemoto,  T.,  Maruyama,  J., and  Kitamoto,  K. (2012). Contribution ratios of amyA, amyB, amyC genes to high-level α-amylase expression in Aspergillus oryzae. Biosci. Biotechnol. Biochem., 76, 1477-1483.
• Nihon Shoyu Kenkyusho (1985). “Shoyu Shiken-Ho” ed. by Nihon Shoyu Kenkyusho, Tokyo, pp. 286-289 (in Japanese).
•  Sambrook,  J. and  Russell,  D. W. (2001). Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
•  Sekine,  H. (1973). Neutral proteinase II of Aspergillus sojae: an enzyme specifically active on protamine and histone. Agric. Biol. Chem., 37, 1765-1767.
•  te Biesebeke,  R.,  van Biezen,  N.,  de Vos,  W. M.,  van den Hondel,  C. A., and  Punt,  P. J. (2005). Different control mechanisms regulate glucoamylase and protease gene transcription in Aspergillus oryzae in solid-state and submerged fermentation. Appl. Microbiol. Biotechnol., 67, 75-82.
•  van den Hombergh,  J. P.,  Sollewijn Gelpke,  M. D.,  van de Vondervoort,  P. J.,  Buxton,  F. P., and  Visser,  J. (1997). Disruption of three acid proteases in Aspergillus niger-effects on protease spectrum, intracellular proteolysis, and degradation of target proteins. Eur. J. Biochem., 247, 605-613.
•  Yoon,  J.,  Kimura,  S.,  Maruyama,  J., and  Kitamoto,  K. (2009). Construction of quintuple protease gene disruptant for heterologous protein production in Aspergillus oryzae. Appl. Microbiol. Biotechnol., 82, 891-701.
•  Yoon,  J.,  Maruyama,  J., and  Kitamoto,  K. (2011). Disruption of ten protease genes in the filamentous fungus Aspergillus oryzae highly improve production of heterologous proteins. Appl. Microbiol. Biotechnol., 89, 747-759.
•  Yoshino-Yasuda,  S.,  Kato,  M., and  Kitamoto,  N. (2011). Sequence analysis and heterologous expression of polygalacturonase gene (AspecA) from a shoyu koji mold, Aspergillus sojae KBN1340. Food Sci. Technol. Res., 17, 579-584.
•  Yoshino-Yasuda,  S.,  Kato,  M., and  Kitamoto,  N. (2012). Sequence analysis and heterologous expression of rhamnogalacturonan lyase A gene (AsrglA) from a shoyu koji mold, Aspergillus sojae KBN1340. Food Sci. Technol. Res., 18, 901-909.
•  Yoshino-Yasuda,  S.,  Fujino,  E.,  Matsui,  J.,  Kato,  M., and  Kitamoto,  N. (2013). Molecular analysis of an α-amylase gene, AstaaG1, from a shoyu koji mold, Aspergillus sojae KBN1340. Food Sci. Technol. Res. 19, 255-261.