Development of Polymerase Chain Reaction and Multiplex Polymerase Chain Reaction for Simple Identification of Thermoanaerobic Spore-forming Bacteria

Abstract

Thermoanaerobic spore-forming bacteria such as Thermoanaerobacter, Moorella, Thermoanaerobacterium, and Caldanaerobius produce spores with extremely high heat resistance. They are known to spoil various sealed, sterile drinks; in particular, low-acid drinks distributed at high temperatures, such as canned coffee containing milk. These bacteria are difficult to culture and identify on the basis of traditional biochemical characteristics. We developed novel primers for single and multiplex PCR methods for simple identification of these bacteria at the genus level. Bacteria were correctly identified approximately 2 h after DNA extraction among 86 strains of 35 species of Gram-positive and -negative bacteria including various spore-forming bacilli. Furthermore, new Loop-Mediated Isothermal Amplification (LAMP) primers were designed to develop a specific detection method for Thermoanaerobacter mathranii and Thermoanaerobacter thermocopriae, highly problematic microbes in the food industry due to their extremely high resistance to heat and various antibacterial agents. Our LAMP method using the novel primers was able to easily detect these microbes. Our present methods effectively improve upon the complicated procedures employed in the quality control of raw materials and products in the food industry.

Introduction

It is extremely difficult to control microbes in low-acid soft drinks and food stored or sold at high temperatures, such as coffee or tea containing milk. A variety of control methods are required to remedy this situation. Bacteria responsible for spoilage of these foods are thermophilic anaerobes that form spores with extremely high heat resistance, such as Moorella, Thermoanaerobacter, Thermoanaerobacterium, and Caldanaerobius (Ashton et al., 1981; Yamamoto et al., 1991). Generally, these microbes are isolated from hot springs or soils (Larsen et al., 1997) and are non-pathogenic. In foods, however, many of these microbes exist in powdered raw materials manufactured by spray-dry processing or high-temperature extraction or reduction processing (Akutsu et al., 2008; Pollach et al., 2002; Sakurai et al., 2000). Bacteria contaminate sealed products through the raw materials and are able to survive under typical sterile conditions because of their high heat resistance (Tanaka et al., 1998; Enda et al., 1989; Byrer et al. 2000). As a result, they survive in the product, continuing to grow during storage in vending machines exposed to high temperatures. The microbes produce acid and gas in sealed foods such as canned coffee. Hence, various countermeasures have been applied to prevent bacterial spoilage of soft drinks, for example, prevention of contamination by inspection of materials, control of microbes during processing, and supplementation with food additives with bacteriostatic activity (Enda et al., 1992). The number of spoilage cases caused by these microbes has decreased; however, they continue to occur occasionally in various low-acid drinks and foods (Carlier et al., 2006; Prevost et al., 2010; Andre et al., 2013) distributed at high temperatures. Therefore, the rapid and accurate detection and identification of thermoanaerobic spore-forming bacteria in products and raw materials is essential to prevent food spoilage. In particular, a method for the rapid detection of Thermoanaerobacter mathranii or Thermoanaerobacter thermocopriae is vital for quality control because these species have high resistance to heat and bacteriostatic agents. In the present study, we developed polymerase chain reaction (PCR) and multiplex PCR methods for the rapid identification of thermoanaerobic spore-forming bacteria using primers designed to distinguish closely related microbes such as Thermoanaerobacter, Thermoanaerobacterium, Moorella, and Caldanaerobius. We also designed primers for the Loop-Mediated Isothermal Amplification (LAMP) method to identify T. mathranii and T. thermocopriae, which are the most important spoilage microbes of soft drinks.

Materials and Methods

Strains and culture Genus Bacillus, Paenibacillus, Caldanaerobius, Moorella, Thermoanaerobacter, and Thermoanaerobacterium used in this study were provided by Deutsche Sammlung von Mikroorganismen und Zellkulturen (DSMZ), Japan Collection of Microorganisms (JCM), Institute of Fermentation, Osaka (IFO), NITE Biological Resource Center (NBRC), Belgian Coordinated Collection of Microorganisms (BCCM), and the Japan Canners Association (JCA) (Table 3). These bacterial strains were detected or isolated from low-acid drinks or canned foods distributed under high temperatures. Other bacterial strains were isolated from various low-acid drinks or their raw materials and were identified by 16S rDNA gene analysis. The bacteria were inoculated to modified TGC (mTGC) medium (Nissui Pharmaceuticals, Tokyo, Japan) or mTGC medium with 2.0% agar, and incubated for 3–7 days at their respective optimal temperatures: 60°C for Thermoanaerobacterium, Thermoanaerobacter and Caldanaerobius, and 55°C for Moorella. AneroPack - Kenki (Mitsubishi Gas Chemical, Tokyo, Japan) was used for anaerobic culture. Other bacteria were incubated at 37°C.

Table 3. List of strains and specifity of PCR and LAMP methods using novel primers for various bacteria.

			Primer sets
Species	Bacterial strain	Source	MooF2/MooR2	CpszF1/CpszR2	TbmotherF/TbrR2	TbmcomF/TbrR2	Multiplex	LAMP Tbr1 set
Moorella thermoacetica	DSM 521	DSMZ
	JCA 5802, 5805, 5806, 5807, 5808, 5809, 5803, 5810	JCA	+	−	−	-	+	-
	NBS 003, 075, 076, 077, 078	Asahi soft drinks
Moorella thermoautotrophica	DSM 1974	DSMZ	+	-	-	-	+	-
Thermoanaerobacter thermohydrosulfuricus	ATCC 35045	ATCC	-	-	-	+	+	-
Thermoanaerobacter mathranii	DSM 11426	DSMZ
	JCA 5910, 5913, 5915	JCA
	NBS 017, 018, 019, 020, 021, 022, 023, 024, 025, 026, 030, 031, 032, 035, 036, 037, 038, 039, 041, 045, 046, 081, 082	Asahi soft drinks	-	-	-	+	+	+
Thermoanaerobacter thermocopriae	JCM 7501, ATCC 33223	JCM	-	-	-	+	+	+
Thermoanaerobacter italicus	DSM 9252	DSMZ	-	-	-	+	+	-
Thermoanaerobacter sulfurophilus	DSM 11584	DSMZ	-	-	-	+	+	-
Thermoanaerobacter brockii subsp. lactiethylicus	DSM 9801	DSMZ	-	-	-	+	+	-
Thermoanaerobacterium thermosaccharolyticum	ATCC 7956	ATCC	-	-	+	+	+	-
	JCA 5604, 5617, 5623, 5625, 5626, 5631	JCA
Thermoanaerobacterium thermosulfurigenes	DSM 2229	DSMZ	-	-	+	+	+	-
Thermoanaerobacterium spp.	JCA 5923, 5633, 5640, 5643	JCA	-	-	+	+	+	-
Caldanaerobius zeae	DSM 13642	DSMZ	-	+	-	-	+	-
Caldanaerobius polysaccharolyticum	DSM 13641	DSMZ	-	+	-	-	+	-
	JCA 5920, 5930	JCA
Geobacillus stearothermophilus	JCM 2501 (T.S.)	JCM	-	-	-	-	-	-
Bacillus cereus	JCM 2152(T.S.)	JCM	-	-	-	-	-	-
Bacillus circulans	JCM 2504(T.S.)	JCM	-	-	-	-	-	-
Bacillus licheniformis	IFO 12200(T.S)	IFO	-	-	-	-	-	-
Bacillus pumilus	IFO 12092(T.S.)	IFO	-	-	-	-	-	-
Bacillus sphaericus	JCM 2502(T.S.)	JCM	-	-	-	-	-	-
Bacillus thuringensis	ATCC 10792(T.S)	ATCC	-	-	-	-	-	-
Bacillus subtilis	JCM 1465(T.S.)	JCM	-	-	-	-	-	-
Bacillus megaterium	JCM 2506(T.S.)	JCM	-	-	-	-	-	-
Bacillus coagulans	JCM 2257(T.S.)	JCM	-	-	-	-	-	-
Bacillus fumarioli	LMG 18418	BCCM	-	-	-	-	-	-
Brevibacillus agri	NBRC 15538(T.S.)	NBRC	-	-	-	-	-	-
Brevibacillus brevis	NBRC 15304(T.S.)	NBRC	-	-	-	-	-	-
Brevibacillius formosus	NBRC 15716(T.S.)	NBRC	-	-	-	-	-	-
Brevibacillus laterosporus	NBRC 15654(T.S.)	NBRC	-	-	-	-	-	-
Panibacillus polymyxa	JCM 2507(T.S.)	JCM	-	-	-	-	-	-
Paenibacillus. macerans	JCM 2500(T.S.)	JCM	-	-	-	-	-	-
Clostridium bifermentans	JCM 1390(T.S)	JCM	-	-	-	-	-	-
Clostridium butyricum	JCM 1391(T.S.)	JCM	-	-	-	-	-	-
Clostridium pasteurianum	JCA 5511	JCA	-	-	-	-	-	-
Enterobacter cloacae	JCM 1232	JCM	-	-	-	-	-	-
Escherichia coli	ABS 078	Asahi soft drinks	-	-	-	-	-	-

DSMZ:Deutsche Sammlung von Mikroorganismen und Zellkulturen, JCMJapan Collection of Microorganisims, NBRC:NITE Biologiacl Resource Center, BCCM:Belgian Coordinated Collection of Microorganisms, JCA:Japan Canners Association, IFO: Institute of Fermentation, Osaka

DNA preparation method    Bacterial cells grown on mTGC medium or mTGC agar were harvested by centrifugation at 14,000 rpm for 1 min, followed by washing twice with water. A 100-µL aliquot of Prepman Ultra Reagent (Life Technologies, Carlsbad, CA, USA) was added to the washed pellet and resuspended thoroughly by pipetting. The suspension was heated at 100°C for 10 min and then cooled to room temperature. After centrifugation at 14,000 rpm for 1 min, 50 µL of the supernatant was recovered and diluted three-fold with sterile water; the resulting solution was used as the DNA solution.

Primer design    16S rDNA sequence data were used for designing primers to specifically detect thermoanaerobic bacteria, since DNA sequence data for this gene is abundant. The 16S rDNA sequences of each bacterial strain were compared.

Species-specific PCR    Illustra RTG (Ready-to-Go) PCR Beads (GE Healthcare 27-9559-01; Piscataway, NJ, USA) were used for the PCR. Template DNA (1 µL), 10 pmol forward primer, 10 pmol reverse primer and RTG PCR Beads were mixed in a reaction tube and water was added for a final volume of 25 µL. The PCR conditions were as follows: 95°C for 2 min, 30 cycles of 95°C for 30 s; 62°C for 30 s; and 72°C for 30 s, and 72°C for 2 min as a final extension. A C1000 Touch Thermal Cycler (BIORAD, Hercules, CA, USA) or iCycler (BIORAD) were used for the PCR. PCR products were confirmed by 2% agarose gel electrophoresis using SEA KEM GTG AGAROSE (FMC Bio Products, Philadelphia, PA, USA) and stained with ethidium bromide.

Determination of PCR detection limits    Template DNA was prepared from 0.1 pg/µL to 10 ng/µL from Moorella thermoacetica DSM521, T. mathranii DSM11426, and Caldanaerobius polysaccharolyticum DSM13641. PCR was performed with primers MooF2 and MooR2 for M. thermoacetica, TbmcomF and TbrR2 for T. mathranii, CpszF1 and CpszR2 for C. polysaccharolyticum and the PCR products were detected according to the method described above.

Multiplex PCR    Multiplex PCR was used to simplify the test method distinguishing thermoanaerobic bacteria. As shown below, six types of primers were added to the reaction mixture, and multiplex PCR was performed. Illustra RTG PCR Beads were used; the reaction mixture contained 1 µL template DNA solution and each primer (10 pmol each of CpszF1, CpszR2, TbmotherF, TbrR2, MooF2, and MooR2) and sterile water was added up to 25 µL. PCR was performed under the same conditions as used for strain-specific PCR: 95°C for 2 min, 30 cycles of 95°C for 30 s; 62°C for 30 s; and 72°C for 30 s, and 72°C for 2 min as a final extension. A C1000 Touch thermal cycler or iCycler were used for PCR. The amplicons were confirmed by 2% agarose gel electrophoresis using SEA KEM GTG AGAROSE (FMC Bio products) and stained with ethidium bromide.

LAMP method    Online primer design support software PrimerExplorer (i) was used to design LAMP primers specific to T. mathranii based on their 16S rDNA sequences. A Loopamp DNA Amplification Kit (Eiken Chemical Co., Tokyo, Japan) was used for the LAMP method experiment. The reaction mixture contained 2 µL of template DNA solution and T. mathranii specific Tbr1 LAMP primer set (40 pmol each of Tbr1FIP and Tbr1BIP, 5 pmol each of Tbr1F3 and Tbr1B3), 1 µL Bst DNA polymerase, and 12.5 µL 2x Reaction mixture; sterile water was added to a final volume of 25 µL. The Lamp reaction was conducted at 60°C for 90 min using the iCycler (BIORAD). The amplicons were confirmed by turbidity or Fluorescent Detection Reagent (Eiken Chemical Co.).

Determination of LAMP method detection limit T. mathranii    DSM11426 was cultured with mTGC broth at 60°C for 2 days. The cultured broth was serially diluted from 10⁰ cfu/mL to 10⁵ cfu/mL. One mL of each cultured broth was harvested by centrifugation at 14,000 rpm for 1 min, followed by washing twice with water. A 10-µL aliquot of Prepman Ultra Reagent was added to the washed pellet and resuspended thoroughly by pipetting. The suspension was heated at 100°C for 10 min and then cooled to room temperature. After centrifugation at 14,000 rpm for 1 min, 5 µL of the supernatant was recovered, and 2 µL of the solution was used as the DNA template. The LAMP assay was performed with the Tbr1 primer set and the detection limit was determined.

Detection and simple identification of Thermoanaerobic bacteria in raw materials    In order to test whether the genomic assays were useful for investigation of the raw materials of canned coffee drinks, we used 10 g of each raw material. For determination of bacterial counts, 10-g samples were diluted in 50 mL water and heated at 100°C for 10 min. The sample solution was mixed with 200 mL of 5/4 fold mTGC medium including 2% agar. The entire mixture was poured into petri dishes and then incubated anaerobically for 5 days at 60°C. Detected colonies were identified by 16S rDNA sequences. For PCR and LAMP assays, 50 mL of the heat treated sample solution was mix with 200 mL of 5/4 fold mTGC broth and then incubated at 60°C for 5 days. Aliquots (1 µL) of the cultured media were used as the templates.

Results

Primer design    The primers CpszF1 and CpszR2, specific to C. polysaccharolyticum and Caldanaerobius zeae, as well as the primers specific to Moorella, MooF2 and MooR2, were designed based on their 16S rDNA sequence data. TbmcomF and TbrR2 primers specific to both Thermoanaerobacter and Thermoanaerobacterium were designed. TbmotherF was designed as a primer to detect Thermoanaerobacterium. Primers specific to Thermoanaerobacter could not be designed based on their 16S rDNA sequences (Table 1). To design specific primers, all 16S rDNA sequences of the genera Bacillus, Clostridium, and Geobacillus in the databases were referenced.

Table 1. Primers for the identification of thermophilic anaerobic spore-forming bacteria

Primer	Sequence
CpszF1	CACGTGAGCAACCTGCCTTT
CpszR2	AGTCCCAGTGTGGCCGTA
TbmcomF	GATAACACCTCGAAAGGGGT
TbrR2	TAGTTAGCCGGGGCTTTCGT
MooF2	ATGCAAGTCGAGCGGTCTTT
MooR2	CCGGGGCTTCCTCCTCA
Tbmother	GCGTGGACAATCTACCCTGT

Specificity of PCR primers    To detect Moorella, MooF2 and MooR2 primers were used. PCR products of approximately 470 bp were amplified with template DNAs from M. thermoacetica and Moorella thermoautotrophica (Fig. 1, A, lanes 6 and 7). No PCR products were amplified with DNAs from other anaerobic spore-forming bacteria of the genera Thermoanaerobacter, Thermoanaerobacterium, and Caldanaerobius.

Fig. 1.

PCR products amplified with each primer and the genomic DNA prepared from thermoanaerobic bacteria. MooF2/MooR2 (A), CpszF1/CpszR2 (B), TbmcomF/ TbrR2 (C), TbmotherF/ TbrR2 (D). Lanes: M, 100 bp DNA ladder; 1, T. mathranii NBS-041; 2, T. mathranii DSM11426; 3, T. thermohydrosulfuricus ATCC 35045; 4, C. polysaccharolyticum DSM13641; 5, T. thermosaccharolyticum ATCC 7956; 6, M. thermoacetica DSM521; 7, M. thermoautotrophica DSM1794; 8, G. stearothermophilus JCM2501

For Caldanaerobius, CpszF1 and CpszR2 were used to amplify the approximately 210 bp PCR product. The PCR product was amplified with template DNA from C. polysaccharolyticum among the bacteria tested. (Fig. 1, B, lane 4). To detect Thermoanaerobacterium and Thermoanaerobacter, TbmcomF and TbrR2 primers were used to amplify the approximately 352 bp PCR products. Amplicons were generated with DNAs from T. mathranii, Thermoanaerobacter thermohydrosulfuricus, and Thermoanaerobacterium thermosaccharolyticum. No PCR products were observed for the other microbes (Fig. 1, C, lanes 1 – 3, and 5). To detect Thermoanaerobacterium, Tbmother and TbrR2 primers were designed. An approximately 375 bp PCR product was amplified using the primer set with the template DNA from T. thermosaccharolyticum. No PCR products were amplified with DNA from the other microbes (Fig. 1, D, lane 5). Table 3 shows the specificity test results of all the primer sets on bacterial strains used in this study. No PCR products were amplified with DNAs from any of the Bacillus and Clostridium strains examined in this study. No PCR products were observed for Geobacillus stearothermophilus, a strain detected frequently with other thermophilic anaerobes from low-acid soft drinks and food stored or sold at high temperatures. The results suggested that each of the primer sets was specific to the target thermoanaerobic spore-forming bacteria.

Detection limit    PCR was performed with each primer set with 0.1 pg, 1 pg, 10 pg, 100 pg, 1 ng, and 10 ng of DNA from each bacteria. The detection limit of the PCR assay was 1 pg/µL template DNA from each bacteria (Fig. 2).

Fig. 2.

PCR detection limit using each primer set. Lanes: M, 100 bp DNA ladder, 1–6: M. thermoacetica DSM521 DNA with MooF2/MooR2 primers; Lane 7–12, T. mathranii DSM11426 DNA with TbmcomF/TbrR2 primers; Lanes 13–18, C. polysaccharolyticum DSM13641 DNA with CpszF1/CpszR2 primers; (Lanes 1, 7 and 13, 0.1 pg; Lane 2, 8 and 14, 1 pg; Lanes 3, 9 and 15, 10 pg; Lanes 4, 10 and 16, 100 pg; Lane 5, 11 and 17, 1 ng; Lane 6, 12 and 18, 10 ng/µL)

Multiplex PCR    Although we have constructed a single PCR method specific to each of the genera, four different PCRs were required to distinguish thermoanaerobic spore-forming bacteria using the current method. Multiplex PCR was used to simplify the test method to distinguish the thermoanaerobic bacteria. Therefore, multiplex PCR was developed by mixing six types of primers in one PCR mixture. PCR products of 474 bp, 352 bp, 352 bp, and 210 bp were amplified with template DNAs respectively from the genera Moorella, Thermoanaerobacter, Thermoanaerobacterium, and Caldanaerobius (Fig. 3). Table 3 shows the specificity test results of multiplex PCR for bacterial strains used in this study. No PCR products were amplified with DNAs from any of the Bacillus and Clostridium strains examined in this study.

Fig. 3.

Amplicons produced by multiplex PCR using a mixture of all the primer sets. Multiplex PCR was performed in the presence of all the primer sets (MooF2/MooR2, CpszF1/CpszR2 and TbmotherF/TbrR2) in a single tube, including each of the DNA templates prepared from the thermoanaerobes. Lanes: M, 100 bp DNA ladder; 1, M. thermoacetica DSM521; 2, M. thermoautotrophica DSM1794; 3, T. thermohydrosulfuricus ATCC 35045; 4, T. mathranii DSM11426; 5, T. thermocopriae JCM7501; 6, T. italicus DSM9252; 7, T. sulfurophilus DSM11584; 8, T. brockii subsp. lactiethylicus DSM9801; 9, T. thermosaccharolyticum ATCC 7956; 10, T. thermosulfurigenes DSM2229; 11, C. polysaccharolyticum DSM13641; 12, C. zeae DSM13642

Specificity of the LAMP method for T. mathranii    For specific detection of T. mathranii, 4 primers for the LAMP method were designed and tested under the various conditions (Table 2). All 27 strains of T. mathranii were positive using the LAMP method. Among 86 strains, which included 35 species of spore-forming bacteria, only 2 strains of T. thermocopriae were positive, except the T. mathranii strains (Table 3).

Table 2. LAMP primers for the specific detection of T. mathranii

Primer	Sequence
Tbr1B3	GCGGGCCCATCCTTAAGC
Tbr1BIP	GTAATACTGGATAAGCTCCTTATCCTTTCCTCCCTATAGGATG
Tbr1F3	GGAGAGTTTGATCCTGGCTC
Tbr1FIP	GCCACCCAACTACGTTTGAGTAGGACGAACGCTGGCG

Detection limit of Lamp assay    LAMP assay was performed with the Tbr1 LAMP primer set with template DNA from 10¹ to 10⁵ cells. The detection limit of the LAMP assay was 10² cfu/mL (Fig. 4, tube No. 2).

Fig. 4.

Detection limit of LAMP assay for T. mathranii DSM11426, confirmed by turbidity (A) or fluorescence (B). 1, 10¹ cfu/mL; 2, 10² cfu/mL; 3, 10³ cfu/mL; 4, 10³ cfu/mL; 5, 10⁴ cfu/mL

Detection and simple identification of Thermoanaerobic bacteria in raw materials    Thermophilic anaerobic bacterial spores in 12 samples of sugar and 5 samples of milk powder were counted and identified. Thermoanaerobacter tencongensis, T. mathranii, and T. thermosaccharolyticum were detected in three samples. These bacteria were detected by PCR and LAMP assays (Table 4). No correlation was observed between colony counts and genomic assays.

Table 4. Anaerobic spore enumeration and genomic assays of raw materials of canned coffee.

Product	No	Anaerobic spore count (CFU/10g)	Isolation and Identification	PCR method	LAMP
Sugar	1	6	Thermoanaerobacter tencongensis	Thermoanaerobacterium or/and Thermoanaerobacter	-
	2	0	-	-	-
	3	7	G. stearothermophilus	-	-
	4	1	G. kaustophilus	-	-
	5	2	Bacillus smithii	-	-
	6	0		-	-
	7	0		-	-
	8	41	T. thermosaccharolitycum	Thermoanaerobacterium or/and Thermoanaerobacter	-
	9	238	T. thermosaccharolitycum, T. mathranii	Thermoanaerobacterium or/and Thermoanaerobacter	+
	10	151	G. kaustophilus	-	-
	11	2	G. stearothermophilus	-	-
	12	2	B. coagulans	-	-
Milk powder	1	460	G. kaustophilus	-	-
	2	660	G. kaustophilus	-	-
	3	185	G. stearothermophilus	-	-
	4	365	G. stearothermophilus	-	-
	5	430	G. kaustophilus	-	-

Discussion

Thermoanaerobic spore-forming bacteria are frequently detected in spoiled processed foods. These microbes have species-specific characteristics. The D values at 121°C of spores of M. thermoacetica and M. thermoautotrophica, highly heat-resistant bacteria, are reported to be approximately 5–80 min or more depending on the strain. T. mathranii and T. thermocopriae are some of the most important spoilage bacteria of low-acid soft drinks because of their resistance to bacteriostatic emulsifiers. They are difficult to culture systematically because their optimal culture conditions, such as culture temperature, aeration condition and auxotrophy, differ greatly. Furthermore, these bacteria perish easily after reaching maximal growth, making it difficult to perform characteristic tests or passage and to obtain detailed information for characterization. Thus, on-site identification of these thermoanaerobic bacteria cannot be performed easily.

16S rDNA gene sequence analysis is often used to identify these bacterial strains. However, the analysis cannot be performed easily at food companies during material storage or process management because expensive machinery and complicated procedures are required. Here, we developed a simple method to distinguish thermoanaerobic bacteria with very similar characteristics such as Moorella, Thermoanaerobacter, Thermoanaerobacterium, and Caldanaerobius. Although studies on the specific detection of these species have been reported previously (Yamamoto et al., 2001; Prevost et al., 2010), these methods were not sufficiently rapid or simple for use in soft drink manufacturing.

Our methods are superior to conventional methods for the identification of thermoanaerobic bacterial strains that are typically difficult to distinguish. Indeed, they can be identified relatively easily with inexpensive machinery approximately 2 h after DNA extraction; in contrast to the use of advanced techniques such as DNA sequencing. We also successfully developed a simple test system based on the LAMP method for detecting T. mathranii and T. thermocopriae, which are thought to have the highest resistance to heat and emulsifiers. Our method requires no equipment except for a water bath.

For the practical application of our methods to detect and identify problematic thermoanaerobic spore-forming bacteria during the quality control of raw materials and products, further detailed studies using field isolates of thermoanaerobes are required. Our present methods effectively improved the complicated procedures currently used in the quality control of raw materials and products.

References

•  Akutsu,  Y.,  Li,  Y.Y.,  Kubota,  K., and  Harada,  H. (2008). Analysis of microbial community structures in thermophilic hydrogen fermentation of starch. Seibutsu Kogakkaishi, 86, 157-163.
•  André,  S.,  Zuber,  F., and  Remize,  F. (2013). Thermophilic spore-forming bacteria isolated from spoiled canned food and their heat resistance. Results of a French ten-year survey. Int. J. Food Microbiol., 165, 134-143.
•  Ashton,  D.J. (1981). Thermophilic organisms involved in food spoilage: Thermophilic anaerobes not producing hydrogen sulfide. J. Food Prot., 44, 146-148.
•  Byrer,  D.E.,  Rainey,  F.A., and  Wiegel,  J. (2000). Novel strains of Moorella thermoacetica form unusually heat-resistant spores. Arch. Microbiol., 174, 334-339.
•  Carlier,  J.P. and  Bedora-Faure,  M. (2006). Phenotypic and genotypic characterization of some Moorella sp. strains isolated from canned foods. Syst. Appl. Microbiol., 29, 581-588.
•  Enda,  A.,  Ikegami,  Y.,  Nakao,  M., and  Murayama,  S. (1989). Characteristics of thermophilic gas-producing strict anaerobes isolated from carrageenan. Kanzume Jiho, 68, 677-683.
•  Enda,  A.,  Ikegami,  Y.,  Kasetani,  M., and  Koike,  S. (1992). Antibacterial activity of emulsifier on Clostridium thermohydrosulfuricum. Kenkyu Hokokusho-Toyo Shokuhin Kogyo Tanki Daigaku, Toyo Shokuhin Kenkyusho, 19, 167-173.
•  Larsen,  L.,  Nielsen,  P., and  Ahring,  B.K. (1997). Thermoanaerobacter mathranii sp. nov., an ethanol-producing, extremely thermophilic anaerobic bacterium from a hot spring in Iceland. Arch. Microbiol., 168, 114-119.
•  Pollach,  G.,  Hein,  W.,  Leitner,  A., and  Z.llner,  P. (2002). Detection and control of strictly anaerobic, spore-forming bacteria in sugarbeet tower extractors. Zuckerindustrie (Berlin, Ger.), 127, 530-537.
•  Prevost,  S.,  Andre,  S., and  Remize,  A.F. (2010). PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage. Curr. Microbiol., 61, 525-533.
•  Sakurai,  H.,  Nagura,  T.,  Tamura.  M., and  Suzuki,  Y. (2000). Properties of thermophilic anaerobes from the process of beet sugar production. Seito Gijutsu Kenkyu Kaishi, 47, 21-27.
•  Tanaka,  M.,  Matsuoka,  M., and  Koukata,  T. (1988). Source of spoilage bacteria of low-acid canned beverages. Kanzume Jiho, 67, 1278-1294.
•  Tanaka,  M.,  Matsuoka,  M., and  Koukata,  T. (1988). Spoilage bacteria of low-acid canned beverages. Kanzume Jiho 67, 1161-1167.
•  Yamamoto,  K.,  Nagamiine,  S.,  Kamiya,  T.,  Murakami,  R., and  Ichijo,  G. (1991). Phenotypic characterization for the differentiation between Clostridium thermoaceticum and Clostridium thermoautotrophicum cased by flat sour spoilage. Ibaraki-ken Eisei Kenkyusho Nenpo, 29, 38-44.
•  Yamamoto.  K,  Murakami.  R., and  Takamura,  Y. (2001). Differentiation of thermophilic anaerobic gram-positive bacteria by random amplified polymorphic DNA analysis. Microbes Environ., 16, 91-99.
• http://primerexplorer.jp