2018 Volume 24 Issue 5 Pages 803-810
Accidental and/or incidental adulterations of foods by porcine ingredients are common in the globalized food processing industry. Food mislabelling and fraudulent substitutions of non-porcine ingredients with porcine ones are objectionable to those who abstain from porcine derived products due to habitual (e.g., vegans and vegetarians), medical (e.g., porcine allergies), legal (fraudulent labelling), economic (e.g., substitution of expensive meat with cheaper pork meat) and cultural or religious grounds (e.g., Islamic and Jewish dietary restrictions). Thus, a strong demand exists for a fast and sensitive method for quantitative sensing of porcine DNA in food. In this study, we are reporting the development of probe-free real-time PCR assay with new primer sets targeting the cytochrome b gene for the fast and sensitive detection of porcine DNA in real food samples. Standard curve was developed with six ten-fold dilutions of the DNA standard and the assay successfully detected up to 0.00001 ng/µL of porcine DNA and as low as 0.001% porcine adulteration in raw pork-chicken binary mixture. The standard curve indicated a linear regression of R2 value of 0.990 and an efficiency of 92.5%. The Ct value range for the detected pork DNA from the 35 food samples tested was 16.03–28.76. We confirmed the assay's specificity to porcine DNA against nine non-porcine animal species and 6 vegetables species.
Food need to conform to a variety of criteria in order to address the differences in consumers' tastes, health conditions, legal regimes and cultural orientations including religious obligations (Tieman and Hassan, 2015; Fang and Zhang, 2016; Fischer, 2016; Lubis et al., 2016). Since the EU meat-scandal in 2008, fraudulent adulterations of food products have become a grave concern. Instances of adulteration may be intentional, like substituting expensive meat with cheaper pork meat for economic gain; or unintentional, including cross-contamination during co-processing or mislabelling at the processing plants. Pork adulteration in food labelled as pork-free is one of the big concerns for people of certain beliefs and cultures (Tieman and Hassan, 2015; Lubis et al., 2016).
There are existing and emerging regulatory frameworks to address the issues which necessitate the food manufacturers to maintain transparency in food labelling to ensure the traceability of ingredients (Fortin, 2016). In reality, mislabelling is still a major concern especially for meat products which are susceptible to adulterations due to co-processing of meats of different species at the same processing facilities (Ballin, 2010). Despite descriptive labelling, past cases of fraud by dishonest manufacturers stirred inevitable doubts. For example, porcine DNA has been detected in a food product labelled as pork-free (Demirhan et al., 2012). Evidently, the situation arrested the demand for analytical methods to detect such adulteration and accordingly methods to detect and quantify the presence of porcine meat in meat products have been developed. Nevertheless, developing a more reliable meat species detection protocol is crucial to help food industries maintaining compliance with legal, ethical, and medical concerns so that the consumers may avoid food which are unsuitable for them.
Immunological (Asensio et al., 2008), protein- and DNA-based electrophoretic, and chromatographic (Toorop et al., 1997) techniques have been employed in species identification. However, protein-based methods have limited applicability for species detection in cooked, baked, or heat-treated food products due to protein denaturation at high temperature (Cai et al., 2012; Nakyinsige et al., 2012). In contrast, due to the relative stability of DNA under heat and pressure treatments (Soares et al., 2013; Karabasanavar et al., 2014) – it is widely used in polymerase chain reaction (PCR) for fast, specific, and sensitive detection of meat species (Cammà and Domenico, 2012; Soares et al., 2013; Fang and Zhang, 2016). Quantitative real-time PCR (qPCR) is widely used as a powerful platform for simultaneous amplification and quantification of nucleic acids (Mao et al., 2007). Unlike end-point PCR, qPCR advantageously monitor the amplification after each PCR cycle by detecting the changes in the fluorescence intensity from the fluorescent molecules. A cheaper alternative to the widely use fluorogenic probe in most qPCR analysis is to use DNA-binding dye as the second fluorogenic agent to detect qPCR fluorescence (Soares et al., 2013). DNA-binding dye increases fluorescence significantly, either by intercalating into the double-stranded DNA or by binding to the minor grooves of the double-stranded DNA.
Dye-based qPCR assays have been reported in many studies to detect animal DNA in meat mixtures. Fajardo et al. (2008) used SYBR Green I dye to detect and quantify different species of deer DNAs. Soares et al. (2013) detected and quantified porcine and poultry DNA by using the same type of DNA-binding dye. Detection of animal meat species such as porcine (Amaral et al., 2017), equine (Meira et al., 2017) and hare (Santos et al., 2012) by using EvaGreen dye qPCR were previously reported.
An example of a commonly used DNA-intercalating dye is SYBR Green I DNA-binding dye that enhances fluorescence by more than 10,000-fold upon binding to the minor grove of the double-stranded DNA (Dragan et al., 2012). However, SYBR Green I dye may inhibit PCR at high concentrations by causing mis-priming (Karsai et al., 2002). In contrast, at low concentrations, SYBR Green I dye may compromise the strength of fluorescence signal that renders DNA melting curve data unreliable (Varga and James, 2006). Also, SYBR Green I dye tends to bind to long, G-C rich PCR products which make it unsuitable for multiplexed PCR analysis (Giglio et al., 2003). Nevertheless, SYBR Green I dye has been popular in qPCR analysis for animal species identification due to its commercial availability (Fajardo et al., 2008; Soares et al., 2013).
On the other hand, EvaGreen dye is a third generation DNA-binding dye developed by Biotium Inc (Hayward, CA, USA) which is an alternative to SYBR Green I dye (Meira et al., 2017). The maximum absorption and emission wavelengths of the pure EvaGreen dye are 495 nm and 525 nm, respectively which are shifted to 500 nm and 530 nm in the presence of DNA (Mao et al., 2007). Unlike SYBR Green I, EvaGreen was developed with enhanced fluorescence to offer greater signals, enhanced sensitivity and improved stability without impairing PCR reactions even at higher concentrations (Wang et al., 2006). Real-time PCR with EvaGreen dye has also been used to detect porcine (Amaral et al., 2017), equine (Meira et al., 2017) and hare (Santos et al., 2012) meats.
For this research, EvaGreen DNA-binding dye was used in the qPCR assay to detect and quantify porcine DNA in food samples since EvaGreen is relatively cheaper and can be used at higher concentrations without compromising the signals and sensitivity (Wang et al., 2006). This study utilized a novel primer sequences to detect the cytochrome b gene in porcine species.
2.1 Materials
2.1.1 Food samples A total of 35 samples consisting of 7 raw and 28 processed foods from both local and international suppliers were purchased from local supermarkets. 5 of the raw samples were artificially contaminated binary mixtures of raw porcine and raw chicken meats with varying weight percentages (10% to 0.001%) of porcine meat. Commercial porcine genomic DNA (Zyagen) was used as the positive porcine DNA control and eight ten-fold serial dilutions of this DNA were prepared for determining the assay's sensitivity.
Genomic DNA of a variety of non-porcine animal species and raw vegetable ingredients commonly found in processed foods was included as a test for the assay's specificity. Those samples were bovine, buffalo, chicken, duck, goat, horse, ostrich, sheep, turkey, wild boar, yellow onion, garlic, green chilli, black pepper, soybean and potato.
2.2 DNA extraction DNA was extracted from approximately 200 mg of each of the homogenised food samples and the non-porcine animal species samples according to the user manual of the NucleoSpin® Food kit (Macherey-Nagel GmbH & Co. KG, Düren, Germany). Briefly, the homogenised sample was incubated with Proteinase K and lysis buffer for 30 minutes at 65 °C followed by centrifugation to remove the cell debris. The supernatant was loaded into a spin column after mixing with binding buffer and ethanol. The column was washed three times with wash buffers after the DNA solution was bound to the column and finally, the purified DNA was eluted from the column by elution buffer.
The extraction of vegetable's DNA from approximately 200 mg of each homogenised vegetable samples according to the instruction manual of DNeasy® mericon ® Food kit (QIAGEN, Hilden, Germany) with few modifications in incubation and centrifugation time. In brief, Proteinase K and food lysis buffer were added to the homogenised sample and incubated for 3 hours at 60 °C. Cell debris was separated by centrifugation and the clear supernatant was added to a chloroform solution follow by another centrifugation. Then, the upper aqueous phase was pipetted out, mixed with binding buffer and loaded into a spin column. The column was washed once with wash buffers followed by a series of centrifugation to discard the flow through. Subsequently, elution buffer is loaded into the spin column in order to obtain the purified DNA.
The concentration and purity of the extracted and purified DNA were measured by spectrophotometric method by using NanoPhotometer™ P-Class (Implen, Munchen, Germany). The DNA concentration was read as the absorbance peak at 260 nm while its purity was determined from the optical density of A260/A280 ratio. The extracted DNA was stored at −20 °C until real-time PCR assay.
2.3 Primers design The species-specific primers and probes were designed to target a fragment of porcine mitochondrial cytochrome b gene (accession number AM492586.1). Its sequence was retrieved from NCBI database (http://www.ncbi.nlm.nih.gov). The primers (Table 1) were designed by using PrimerQuest Tool, at IDT (Integrated DNA Technologies, IDT PTE, Singapore) website (http://www.idtdna.com/Primerquest/Home/Index). The designed primers match the region of 468 bp to 570 bp of the porcine mitochondrial genome where this sequence is part of the cytochrome b gene. The specificity of the designed primers and probe were analysed in silico by using the BLAST tool of NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi) to prevent non-specific binding of the primers to DNA of species other than porcine by ensuring that the sequences were specific only to porcine and not to any other species. Other than matching the porcine cytochrome b gene sequence, these primers were chosen based on its 100% alignment with the mitochondrial genome sequence of varieties of porcine (Sus scrofa) species upon in-silico specificity check with BLAST. IDT supplied the primers.
| Designation | Sequence (5′ − 3′) |
|---|---|
| Forward Primer | CGGAACAGACCTCGTAGAATG |
| Reverse Primer | GGTAATGATGAATGGCAGGATAAAG |
2.4 Real-Time PCR assay The qPCR reaction volume was 20 µL, with 19 µL qPCR reagents mixture and 1 µL DNA template. The qPCR reagents mixture contained 1× PCR buffer II, 0.2 µM dNTP mix, 0.15 µM of each of the forward and the reverse primers, 1× EvaGreen dye, 0.1× ROX as the passive reference, 0.625 U AmpliTaq DNA polymerase, and 2.5 mM MgCl2. All qPCR assays were run with a known positive control - the commercial porcine genomic DNA as template and nuclease-free water as a known no-template control (NTC). The qPCR assay was performed in the 7500 Fast Real-Time PCR System (ABI) with the fast thermal cycling profile at 95 °C for 20 seconds followed by 40 cycles at 95 °C for 3 seconds and 60 °C for 30 seconds. A melt curve analysis was done on the positive DNA (10 ng/µL Pork DNA). The 7500 Software version 2.3 was used for data collection and processing.
2.5 Specificity efficiency, and sensitivity test The specificity of the dye-based qPCR assay using porcine-specific primers was tested against genomic DNAs from 9 non-porcine species (bovine, buffalo, chicken, duck, goat, horse, ostrich, sheep, turkey) 1 porcine species (wild boar) and 6 vegetables species (onion, garlic, chilli, black pepper, soybean and potato). Sensitivity of the assay was measured by eight ten-fold serial dilutions of porcine genomic DNA ranging from 10 to 0.00001 ng/µL. The standard curve was generated by plotting the Ct values against the log of the DNA concentrations.
2.6 Real food samples analysis The dye-based qPCR assay was used to detect porcine DNA in all 35 food samples comprised of pork meat, pork-free meat, and binary mixtures pork-chicken raw meat.
3.1 Development of assay and analysis of extracted DNA In this research, an EvaGreen dye-based qPCR was developed using previously unreported primers for porcine DNA detection for food sample analyses. EvaGreen dye was chosen to improve assay's sensitivity as it does not inhibit PCR reaction even at high concentrations (Wang et al., 2006). The concentration range of the DNA extracted from 35 food samples was 10 to 664 to ng/µL while the purity ranged from 1.42 to 2.02. Some food samples showed low DNA concentrations. Overall, the DNA purity was high, indicating the high quality of the purified DNA (Ali et al., 2015). This has also ascertained the acceptability of the commercial DNA extraction kit used to extract DNA from sample meat products and the raw meat mixtures used in this research.
3.2 Specificity The specificity of primer pairs (Table 1) used for this EvaGreen dye assay for specific amplification of porcine DNA was confirmed by testing the assay against DNA from 9 non-porcine, 1 porcine animal species and 6 vegetable species (Table 2). Absence of amplifications for any of the vegetable species and the non-porcine species (Supplementary 1) except for wild boar (Table 2) indicated that the primers' target sequence also occur in wild boar's cytochrome b gene. This indicated versatility of the designed primers as wild boar meat can also be used as an alternative to porcine meat. Therefore, the assay developed was highly specific to porcine species. The melting temperatures (Tm) of the wide range concentrations of porcine DNA were determined through the melting curve analysis after the amplification cycles and were found to be at 83.08 °C (Figure 1-A). The specificity of the assay was further confirmed with gel electrophoresis that showed high specificity of the primers to the target DNA, producing only single positive band for porcine (positive control) and wild boar, and none for the fifteen non-target species analysed (Supplementary 1).
| Species DNAa | Mean Ct valueb | SDc | Number of positive replicates |
|---|---|---|---|
| Porcine | 15.11 | 2.1E-2 | 3/3 |
| Bovine | ndd | nd | 0/3 |
| Buffalo | nd | nd | 0/3 |
| Chicken | nd | nd | 0/3 |
| Duck | nd | nd | 0/3 |
| Goat | nd | nd | 0/3 |
| Horse | nd | nd | 0/3 |
| Ostrich | nd | nd | 0/3 |
| Sheep | nd | nd | 0/3 |
| Turkey | nd | nd | 0/3 |
| Wild Boar | 16.98 | 2.3E-2 | 3/3 |
Gel electrophoresis result of the specificity analysis. (1) NTC; (2) 50-bp DNA Ladder; (3) Positive control (porcine); (4) Wild boar; (5) Bovine; (6) Buffalo; (7) Chicken; (8) Duck; (9) Goat; (10) Horse; (11) Ostrich; (12) Sheep; (13) Turkey; (14) Onion; (15) Garlic; (16) Chili; (17) Black pepper; (18) Soybean; (19) Potato.
Standard curve of Table 1 EvaGreen assay (A) Melting curve analysis and (B) The amplification plot constructed from 10-fold dilution of known concentrations of porcine DNA. The melting curve showed the Tm of detectable Porcine DNA was 83.08 °C while no peak was detected on the NTC. The amplification plot showed the highest concentration of diluted porcine DNA templates (10 ng/µL) was amplified at earlier cycle as compare to lower concentrations which were amplified at later cycles.
3.3 Sensitivity The sensitivity of the assay was determined by testing eight ten-fold serially diluted porcine DNA templates viz., 10, 1, 0.1, 0.01, 0.001, 0.0001, 0.00001, and 0.000001 ng/µL (Figure 1B). Amplifications were observed for all DNA template concentrations except for the lowest one. Therefore, the lowest detectable porcine DNA concentration was 0.00001 ng/µL (Figure 1B). The limit of detection (LOD) of the assay was comparable to that obtained in other EvaGreen dye-based study (Amaral et al., 2017) while it was lower than that obtained by using SYBR Green I dye (Soares et al., 2013). This EvaGreen dye-based qPCR assay showed better sensitivity compared to the other probe-based qPCR studies (Cai et al., 2012; Cammà and Domenico, 2012; Yusop et al., 2012; Iwobi et al., 2015; Kim et al., 2016).
3.4 Efficiency The first six concentrations (10 to 0.0001 ng/µL) that showed positive amplifications (Figure 1B) were used to construct the standard curve that plotted Ct value against the logarithm of DNA concentrations (Figure 2). The standard curve showed very good linear regression (R2= 0.990) with a slope of −3.517. The efficiency of the assay was 92.5% as calculated from the slope of the standard curve by using the formula E (%) = (10−1/slope − 1) × 100 (Cammà and Domenico, 2012; Druml et al., 2015) which indicated the robustness and precision of the newly developed assay (Bustin et al., 2009). Accordingly, we attested the dynamic quantification range for this qPCR assay was between 10 ng/µL and 0.0001 ng/µL.
Standard curve of porcine DNA. The Ct values were plotted against Log of six ten-folds DNA dilutions (10, 1, 0.1, 0.01, 0.001, 0.0001 ng/µL). The R2 value obtained was 0.990 and the efficiency was noted to be 92.5%. Standard curve constructed from mean values of Ct values of replicate assays (n = 3).
3.5 Validity and applicability The applicability of this new dye-based qPCR assay was validated by applying it to detect porcine DNA in 35 food samples. Figure 3 shows the amplification curves of porcine DNA from one of the pork food sample compared to the 10 ng/µL porcine DNA (positive control). This illustrates the capability of the assay in amplifying food sample containing porcine DNA. The assay successfully detected porcine DNA in 15 out of the 35 samples tested (Table 3), where all 15 of the positive samples contained porcine or boar DNA. This indicates the validity of this dye-based qPCR assay in successfully detecting the pork DNA in the food samples.
Amplification plot of Porcine DNA from pork food sample (Ct = 16.667) compared to the positive control (Ct = 11.804). Porcine DNA of 10 ng/µL acted as the positive control of the reaction and was amplified at earlier cycle. This was due to the high concentration of porcine DNA in the positive control as compare to that in the food sample tested
| Sample no. | Sample typea | Mean Ct valueb | SDc | Number of positive replicates | Presence of porcine DNAd |
|---|---|---|---|---|---|
| 1 | Chopped pork and ham | 16.62 | 4.4E-2 | 3/3 | + |
| 2 | Spiced pork cubes | 16.14 | 7.2E-2 | 3/3 | + |
| 3 | Cocktail skinless sausages | 17.07 | 1.0E-1 | 3/3 | + |
| 4 | Pork luncheon meat | 16.27 | 2.9E-2 | 3/3 | + |
| 5 | Pork mince with bean paste | 16.45 | 3.8E-2 | 3/3 | + |
| 6 | Pork luncheon meat with black pepper | 18.05 | 7.1E-2 | 3/3 | + |
| 7 | Pork and bamboo shoot | 23.10 | 3.4E-1 | 3/3 | + |
| 8 | Sliced ham | 21.74 | 6.0E-2 | 3/3 | + |
| 9 | Pork short sausages | 17.48 | 7.8E-3 | 3/3 | + |
| 10 | Boar meat | 16.03 | 6.5E-2 | 3/3 | + |
| 11 | Marshmallow | nde | nd | 0/3 | − |
| 12 | Marshmallow | nd | nd | 0/3 | − |
| 13 | Marshmallow | nd | nd | 0/3 | − |
| 14 | Beef meat loaf | nd | nd | 0/3 | − |
| 15 | Corned beef | nd | nd | 0/3 | − |
| 16 | Chicken frankfurters | nd | nd | 0/3 | − |
| 17 | Chicken luncheon meat | nd | nd | 0/3 | − |
| 18 | Corned beef | nd | nd | 0/3 | − |
| 19 | Chicken luncheon meat | nd | nd | 0/3 | − |
| 20 | Mutton luncheon with chicken | nd | nd | 0/3 | − |
| 21 | Corned beef | nd | nd | 0/3 | − |
| 22 | Beef loaf | nd | nd | 0/3 | − |
| 23 | Corned mutton | nd | nd | 0/3 | − |
| 24 | Chicken luncheon meat | nd | nd | 0/3 | − |
| 25 | Beef curry | nd | nd | 0/3 | − |
| 26 | Chicken luncheon meat | nd | nd | 0/3 | − |
| 27 | Corned ostrich | nd | nd | 0/3 | − |
| 28 | Lamb curry with potatoes | nd | nd | 0/3 | − |
| 29 | Duck meat | nd | nd | 0/3 | − |
| 30 | Beef luncheon meat | nd | nd | 0/3 | − |
| 31 | Pork-beef raw meat mixture (10% pork, w/w) | 19.73 | 1.6E-2 | 3/3 | + |
| 32 | Pork-beef raw meat mixture (1% pork, w/w) | 23.34 | 4.2E-2 | 3/3 | + |
| 33 | Pork-beef raw meat mixture (0.1% pork, w/w) | 27.11 | 1.6E-1 | 3/3 | + |
| 34 | Pork-beef raw meat mixture (0.01% pork, w/w) | 28.30 | 5.6E-2 | 3/3 | + |
| 35 | Pork-beef raw meat mixture (0.001% pork, w/w) | 28.76 | 7.9E-2 | 3/3 | + |
The standard curve was developed for the determination of the efficiency of the assay and was used to quantify porcine mitochondrial DNA from five pork-chicken raw meat binary mixtures which were among the 15 samples tested positive for porcine DNA. The Ct values of the pork-chicken binary mixtures ranged from 19.73 to 28.76. Notably, the Ct value decreased as the concentration of porcine DNA increased (Table 4). Based on this result, we claimed that detection of as low as 0.001% (w/w) pork in pork-chicken binary mixture by the proposed assay.
| Binary mixture (w/w)a | Mean Ct valueb | SDc | Number of positive replicates |
|---|---|---|---|
| 0.001% pork in pork-chicken | 28.76 | 7.9E-2 | 3/3 |
| 0.01% pork in pork-chicken | 28.30 | 5.6E-2 | 3/3 |
| 0.1% pork in pork-chicken | 27.11 | 1.6E-1 | 3/3 |
| 1% pork in pork-chicken | 23.34 | 4.2E-2 | 3/3 |
| 10% pork in pork-chicken | 19.73 | 1.6E-2 | 3/3 |
The detection of porcine DNA was achievable under 40 minutes when run with the 7500 Fast Real-Time PCR System (ABI). Nevertheless, 10 ng/µL porcine DNA was readily detected at 11.86th cycle which meant that its presence could be detected much earlier.
The newly developed dye-based qPCR assay in this study showed several merits over other published dye-based qPCR assays. It showed higher sensitivity compared to other probe-based qPCR studies (Ali et al., 2012; Cai et al., 2012; Cammà and Domenico, 2012; Demirhan et al., 2012; Yusop et al., 2012; Iwobi et al., 2015; Kim et al., 2016), in dye-based qPCR study (Soares et al., 2013), and the end-point PCR studies (Amaral et al., 2014; Karabasanavar et al., 2014; Kim et al., 2016). Therefore, this assay is faster and a relatively sensitive alternative. It can also detect porcine adulteration in foods containing varieties of meat species.
Due to the health, cultural and religious importance of unadulterated food, for example the gravity of adulteration and mislabelling in halal foods, a fast and easy method of detection is needed. The real-time PCR can be used to detect and quantify porcine DNA in raw and highly processed food samples. In this study, we reported a novel dye-based qPCR assay for rapid and sensitive detection of porcine DNA in both raw and processed samples. This assay detected as low as 0.00001 ng/µL porcine DNA and 0.001% (w/w) porcine adulteration in raw meat. It successfully detected 10 ng/µL porcine DNA less than 40 minutes. Therefore, the assay presented itself as a fast and reliable dye-based qPCR assay for porcine DNA detection and quantification.
Acknowledgements Minhaz Uddin Ahmed would like to acknowledge the financial support for the project provided by Brunei Research Council (Grant# BRC-10) from the Economic and Planning Development, Prime Minister's Office of Negara Brunei Darussalam.
Funding: Not applicable.
Conflict of Interest: Authors declare no conflict of interest.
Ethical Approval: This article does not contain any studies with human participants or animals performed by any of the authors.
Informed Consent: Not applicable.
