2019 Volume 25 Issue 6 Pages 903-913
Increased foodborne outbreaks associated with low-moisture foods contaminated with Salmonella have raised the need for further insights into their possible causes and control measures. This study investigated the effects of sucrose-induced low water activity (aw) on heat resistance and global gene expression in Salmonella Typhimurium. Following heat treatment at 60 °C for 5 min, viable cell counts on TSA of the cells grown in TSB supplemented with 35% (w/v) sucrose for 24 h and resuspended in the same medium were 3-Log higher than those grown and resuspended in TSB without sucrose, and 1-Log higher than the cells grown in TSB and resuspended in TSB with 35% sucrose. Viability of the cells directly transferred from TSB to preheated TSB with sucrose was positively correlated with sucrose concentration. DNA microarray analysis identified sixteen up-regulated genes involved in cobalamin biosynthesis in the cells grown in the presence of 35% sucrose. Deletion of the pocR gene, which positively regulates cobalamin biosynthesis, resulted in suppression of the improvement in heat resistance of S. Typhimurium under sucrose-induced low aw, suggesting potential contribution of this gene in increasing heat resistance of S. Typhimurium.
Environments with low water activity (aw) have been known to inhibit the growth of pathogenic microbes by reducing the available free water (ICMSF, 1996). However, many low moisture foods (LMFs; e.g., chocolate, powdered milk, peanut butter and almonds) with aw below 0.85 (FAO/WHO, 2015i), have been implicated in the outbreak of foodborne diseases (Andino and Hanning, 2015; Nummer et al., 2012). Notably, many of these foods have a high sugar content (Beuchat et al., 2017).
Salmonella enterica is one of the leading causes of foodborne diseases worldwide. Although most cases of salmonellosis are caused by animal-derived food products, Salmonella species has been identified as the major causative agent of outbreaks associated with LMFs (Syamaladevi et al., 2016). Several studies have demonstrated that Salmonella shows prolonged survival and enhanced heat resistance in low aw environments (Acosta et al. 2017; Hiramatsu et al., 2005). Thermal inactivation kinetic values of Salmonella were determined in some major low-moisture products, but the intensity of the heat treatment may largely affect flavor and nutrition of these LMFs (Podolak et al., 2017). More importantly, such studies rarely gave attention to the occurrence of sublethally heat-injured cells, which are hardly detected by the plating method using selective media and have the potential to become functionally normal as intact cells in a favorable environment (Wu, 2008). Hence, to establish an effective control measure, it is crucial to understand the mechanism of increased heat resistance in a low aw environment in Salmonella.
Fletcher and Csonka (1998) claimed that aw is the most critical parameter for the induction of increased heat resistance of Salmonella, regardless of whether sugars or salts were used for reducing aw. However, recent evidence suggests that Salmonella represents varied levels of heat resistance in response to diverse humectants (Hiramatsu et al., 2005; Mattick et al., 2000a). For instance, sucrose can induce higher heat resistance than sodium chloride (NaCl) and glycerol (Peña-Meléndez et al., 2014). Moreover, Finn et al. (2015) found that Salmonella Typhimurium presented differential gene expression in response to low aw induced by NaCl, KCl and glycerol, indicating that different humectants enhance the heat resistance of S. Typhimurium through different mechanisms. Although considerable progress has been achieved in clarifying the effect of NaCl on heat resistance of Salmonella, the mechanisms of enhanced heat resistance by sugars remain largely unknown.
In this study, the effects of duration of exposure to low aw induced by sucrose, on the heat resistance of S. Typhimurium were investigated. A transcriptomic analysis of S. Typhimurium grown under sucrose-induced low aw were performed by DNA microarray. The effect of deletion of the pocR gene was also examined to elucidate the involvement of cobalamin biosynthesis in the increase in heat resistance of Salmonella.
Bacterial strain and preculture Salmonella enterica serovar Typhimurium NBRC 12529 was obtained from the Biological Resource Center, National Institute of Technology and Evaluation (NBRC, Chiba, Japan). This strain has been shown to generate injured cells after mild heat treatment (Hsu-Ming et al., 2012; Kobayashi et al., 2005), with enhanced heat resistance after cultivation in tryptic soy broth (TSB; Becton Dickinson, Franklin Lakes, NJ, USA) containing NaCl (Cui et al., 2019). Stock cultures of S. Typhimurium were inoculated in TSB (pH 7.3) and cultured overnight at 37 °C with shaking at 130 rpm. The preculture was used for subsequent experiments.
Heat treatment after long- and short-term exposure to low aw induced by sucrose The effects of the duration of exposure to low aw on heat resistance in Salmonella were investigated by cultivation and heat treatment in TSB (aw = 0.99) and TSB supplemented with 35% (w/v) sucrose (Nacalai Tesque, Kyoto, Japan, aw = 0.97). The pH of the broths was adjusted to 6.0 by adding 1 M hydrochloric acid and broths was autoclaving at 110 °C for 10 min. The aw of broths were measured using a PawKit water activity meter (Decagon Devices, Pullman, WA, USA).
Long-term exposure 1 Ten microliters of the preculture were used to inoculate 9 mL of TSB supplemented with 35% sucrose (designated as 35TSBS+), followed by incubation at 37 °C for 24 h. One milliliter of the culture was harvested by centrifugation (10000 × g for 5 min at 25 °C). The precipitates were resuspended in 5 mL fresh 35TSBS+ and further diluted in 5 mL fresh 35TSBS+ to attain a final cell density of ∼4 × 108 CFU/mL.
Long-term exposure 2 Ten microliters of the preculture were used to inoculate 9 mL of 35TSBS+ and incubated at 37 °C for 24 h. Cells harvested by centrifugation were resuspended in fresh TSB and further diluted in 5 mL fresh TSB.
Short-term exposure Ten microliters of the preculture were used to inoculate 9 mL of TSB and incubated at 37 °C for 24 h. Cells harvested by centrifugation were resuspended in fresh 35TSBS+ and further diluted in 5 mL fresh 35TSBS+.
Control Ten microliters of the preculture were used to inoculate 9 mL of TSB and incubated at 37 °C for 24 h. Cells harvested by centrifugation were resuspended in fresh TSB and further diluted in 5 mL fresh TSB.
Five milliliters of each cell suspension were incubated in a water bath at 25 °C for 10 min with shaking at 80 rpm. The suspensions were then heated in a water bath at 60 °C for 5 min with shaking at 130 rpm. Viable counts of the heated cells were determined after cooling in a water bath at 25 °C for 10 min.
Simultaneous treatment with heat and sucrose-induced low aw Ten microliters of the preculture of S. Typhimurium were inoculated in 9 mL of TSB and incubated at 37 °C for 24 h. The culture was used for subsequent experiments. To examine the effects of simultaneous treatment with heat and sucrose-induced low aw on cell viability of S. Typhimurium, TSB alone and TSB supplemented with 5% (aw = 0.99), 10% (aw = 0.99), 20% (aw = 0.98), 35% (aw = 0.97), 50% (aw = 0.96), 65% (aw = 0.95), and 80% (aw = 0.94) (w/v) sucrose were used for heat treatment. The pH of the broths was adjusted to 6.0 and broths were filter sterilized using a 0.22 µm membrane filter (Millex-GV, Millipore, Ireland).
TSB alone and TSB supplemented with different sucrose concentrations (72.5 µL) were dispensed into 0.2 mL PCR tubes (Nippon Genetics, Tokyo, Japan), and preheated at 56 °C in the thermal cycler Takara TP350 (Takara, Kusatsu, Japan). A final cell concentration of ∼4 × 108 CFU/mL was achieved by adding 2.5 µL of the culture to 72.5 µL of each preheated broth. The tubes were kept at 56 °C in the thermal cycler for 10 min. Immediately after the heat treatment, the cell suspensions were serially diluted with sterile phosphate buffered saline (PBS; 1.47 mM KH2PO4, 8.10 mM Na2HPO4, 2.68 mM KCl, 137 mM NaCl, pH 7.4) and kept at 25 °C to measure viable cell counts.
Measurement of viable cell counts Cell suspensions were serially diluted 10-folds with PBS and 10 µL of each diluted sample was spotted on tryptic soy agar (TSA; Becton Dickinson) and deoxycholate hydrogen sulfide-lactose (DHL) agar (Nissui, Tokyo, Japan) plates. These plates were incubated at 30 °C for 24 h and then at 37 °C for another 24 h before the colonies were counted. The viable cell count determined on TSA was defined as the sum of intact and injured cells, and the viable cell count on DHL agar was defined as intact cells only.
DNA microarray analysis The transcriptional changes in Salmonella were investigated after cultivation in a sucrose-induced low aw broth. The preculture of S. Typhimurium (110 µL) was added to 100 mL of TSB or 35TSBS+ to attain a final cell density of 1 × 108 CFU/mL (OD660 ≈ 0.127). The cultures were then diluted to 1 × 106 CFU/mL with the corresponding fresh broth. To obtain the cells in the late exponential growth phase (OD660 ≈ 0.127) for DNA microarray analysis, 160 mL of cultures diluted in TSB and 35TSBS+ were further incubated at 37 °C for about 3 h and 5 h, respectively. Total RNA was extracted using the hot phenol method followed in a previous study (Hsu-Ming et al., 2012). Concentration of the extracted total RNA was determined with a NanoDrop ND-1000 spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Extracted RNA was purified using the RNase-free DNase set (Qiagen, Hilden, Germany) and RNeasy Mini Kit (Qiagen), according to the manufacturer's protocol. Quality of the purified total RNA was verified on an Agilent 2100 Bioanalyzer (Agilent, Palo Alto, CA, USA). Each verified total RNA sample (50 ng) was treated with Low Input Quick Amp WT Labeling Kit (Agilent) for cRNA synthesis. The cRNAs labeled with Cyanine 3-CTP dye (Cy3) were then purified again, using the RNeasy mini kit (Qiagen). The yield and specific activity of each cRNA sample was determined to be ≥0.825 µg, and ≥15 pmol Cy3 per µg cRNA, respectively. Finally, 600 ng of purified labeled cRNAs were mixed with the Fragmentation Mix prepared using the Gene Expression Hybridization Kit (Agilent), in a final volume of 25 µL. Following incubation at 60 °C for 30 min in the block incubator (Astec, Fukuoka, Japan), fragmented cRNAs were mixed with 25 µL of 2× GEx hybridization buffer HI-RPM (Agilent) before performing hybridization.
The microarray probe used in this study was designed using eArray Web design tool (https://earray.chem.agilent. com/earray/) based on the genome sequence of Salmonella enterica serovar Typhimurium LT2 (GenBank: Accession number NC_003197.1). Hybridization was performed at 65 °C for 17 h at 10 rpm in the rotisserie of the microarray hybridization oven (Agilent). Slides were washed using the Gene Expression Wash Buffer 1 and 2 (Agilent) following the manufacturer's recommendations and protected from light before scanning. Agilent DNA Microarray Scanner was used for scanning the array to collect fluorescence data. The scanned images were analyzed with Agilent Feature Extraction software (v10.7.3.1, Agilent). Extracted data were sample-wise quantile normalized and further analyzed using the GeneSpring GX software (v13.0, Agilent Technologies). Fold changes of the amounts of transcripts in the cells cultured in 35TSBS+ were compared with those cultured in TSB. A fold change greater than 4 in transcription level was considered to be significant. Gene ontology (biological processes, molecular function, cellular component) enrichment analysis was performed on the genes with significant increase in transcription, using DAVID Functional Annotation Tool (v6.8, Huang et al., 2009) at a count threshold of 2, and with an EASE score (P value) of <0.1.
Real-time quantitative PCR The transcriptional level of pduA, pduH, cbiA, cbiF and pocR genes was determined by real-time quantitative PCR (qPCR) to confirm the changes in transcription of the genes by DNA microarray. Sample preparation and RNA extraction was performed by following the method described in microarray analysis. Primer sequences (Table 1) were designed using the Primer3 program (http://frodo.wi.mit.edu) based on the sequence of S. Typhimurium LT2 from KEGG2 (http://www.genome.jp/kegg/kegg2.html). Real-time qPCR was performed in the Mx3000P Real-time PCR System (Stratagene, La Jolla, CA, USA) using Thunderbird SYBR qPCR Mix (Toyobo, Osaka, Japan). The 16S rRNA was used as the internal control and the results were analyzed with MxPro QPCR software (v2.0).
| Primer Name | Sequence (5′ to 3′) |
|---|---|
| Primers used for qRT-PCR | |
| pduA-ORF-F | GCTTAACCGCAGCCATAGAG |
| pduA-ORF-R | TCATTGGCTAATTCCCTTCG |
| pduH-ORF-F | GCATTGAAGAGGAAGGCATC |
| pduH-ORF-R | GGCCTGACTGTCCTGATGAT |
| cbiA-ORF-F | TTGTGAATCGCGTCACTAGC |
| cbiA-ORF-R | GGGCTAAAACGCACAATGTT |
| cbiF-ORF-F | TGATCCACGCTGTGTATGGT |
| cbiF-ORF-R | CGCCATCAGCTCGATAATCT |
| pocR-ORF-F | GCAATCGGAGGCAAATAAAA |
| pocR-ORF-R | TCTGGCGCTAACCATTCTCT |
| Primers used for construction of pocR deletion mutant | |
| pocR-ORF-F | GCAATCGGAGGCAAATAAAA |
| pocR-ORF-R | TCTGGCGCTAACCATTCTCT |
| pocR-up-F | CGCCTTTGCTTATTGGGATA |
| pocR-up-R-M13 | CTGGCCGTCGTTTTACAACGTCGTGCGTGAAAGCAGATCACGAAA |
| pocR-down-F-M13 | CATGGTCATAGCTGTTTCCTGTGTGTGCCGTACAGCCATAACGTA |
| pocR-down-R | CACTTCCCACCGAAGTTGTT |
| pocR-v-F | CAGGACACGAACTTTGCTCA |
| pocR-v-R | GGGCTAAAACGCACAATGTT |
| KmR-M13F | CACGACGTTGTAAAACGACGGCCAGTCATGAACAATAAAACTGTCTGCTT |
| KmR-M13R | ACACAGGAAACAGCTATGACCATGCTCTGCCAGTGTTACAACCAA |
| KmR-ORF-F | ATTCAACGGGAAACGTCTTG |
| KmR-ORF-R | GCCTGAGCGAGACGAAATAC |
| Combinations of primer pairs for verification of pocR deletion mutant | |
| forward | reverse | Theoretical PCR product size (bp) | |
|---|---|---|---|
| wild type strain | ΔpocR mutant strain | ||
| pocR-ORF-F | pocR-ORF-R | 223 | - |
| KmR-ORF-F | KmR-ORF-R | - | 683 |
| pocR-up-F | pocR-ORF-R | 1232 | - |
| pocR-up-F | KmR-ORF-R | - | 1164 |
| pocR-ORF-F | pocR-down-R | 902 | - |
| KmR-ORF-F | pocR-down-R | - | 1093 |
| pocR-v-F | pocR-down-R | 1792 | - |
| pocR-v-F | KmR-ORF-R | - | 1724 |
| pocR-ORF-F | pocR-v-R | 1833 | - |
| KmR-ORF-F | pocR-v-R | - | 2024 |
| pocR-up-F | pocR-down-R | 1911 | 1574 |
Construction of pocR deletion mutant strain and evaluation of its heat resistance pocR regulates the expression of the pdu-cbi gene cluster (Roth et al., 1996). Therefore, pocR was inactivated in order to examine the relationship between heat resistance and the genes involved in cobalamin biosynthesis and 1,2-propanediol metabolism. A pocR deletion mutant S. Typhimurium strain was constructed using a PCR-based method, according to the previous report (Cui et al., 2018; Honjoh et al., 2009). The primers used are listed in Table 1. Heat resistance of constructed ΔpocR mutant strain in the presence of sucrose was compared with that of the wild type strain. To evaluate the heat resistance of this strain, overnight cultures (10 µL) of the wild type S. Typhimurium and ΔpocR::Kmr strain were inoculated and cultured in 9 mL of 35TSBS+ at 37 °C for 24 h. The cultures were resuspended in 5 mL of 35TSBS+ to a final OD660 of ∼0.127. The cell suspensions were kept at 25 °C for 10 min, and heated in a water bath at 60 °C for 5 min followed by incubation at 25 °C for 10 min. After the heat treatment, the cell suspensions were further incubated at 37 °C for 6 h with shaking at 130 rpm. Cell viability was determined on TSA and DHL agar before and after heat treatment, and after further incubation for 1, 2, 3, 4, 5 and 6 h.
Statistical analysis Viable cell counts were determined for three separate experiments and analyzed in Microsoft Excel 2010 (Microsoft, Seattle, WA, USA). Significance of differences between the viable counts on TSA and DHL agar were determined by Student's t-test. Multiple comparisons of viable cell counts on TSA or DHL agar between differently treated sample groups were performed using the Tukey-Kramer's multiple comparison post hoc test followed by the one-way ANOVA by Statcel 3 (Yanai, 2011), which is an add-in application in Microsoft Excel.
Effects of exposure to sucrose-induced low aw on cell viability of S. Typhimurium after heat treatment There was no significant difference between cell viability on TSA and DHL agar before heat treatment in S. Typhimurium in different broths (data not shown), indicating the absence of sublethally injured cells in the presence of sucrose before heat treatment. After heat treatment at 60 °C for 5 min, as shown in Fig. 1, viable cell counts on TSA for cells resuspended in 35TSBS+ following cultivation in 35TSBS+ for 24 h were 3-Log higher than those resuspended in TSB after cultivation in TSB, and 1-Log higher than the cells resuspended in 35TSBS+ after cultivation in TSB, and those resuspended in TSB after cultivation in 35TSBS+. On the other hand, viable cell count on DHL agar of the cells resuspended in TSB after cultivation in TSB was more than 2-Log lower than those of the cells of the other test groups. These results indicate that both long-term and short-term exposure to low aw induced by sucrose could enhance the heat resistance of S. Typhimurium cells although long-term exposure appears to have a stronger effect.
Effects of exposure to sucrose-induced low aw on cell viability of S.. Typhimurium after heat treatment
Control: S. Typhimurium were cultured in TSB at 37 °C for 24 h and resuspended in TSB;
Long-term exposure 1: S. Typhimurium were cultured in TSB supplemented with 35% (w/v) sucrose (35TSBS+) at 37 °C for 24 h and resuspended in 35TSBS+;
Short-term exposure: S. Typhimurium were cultured in TSB at 37 °C for 24 h and resuspended in 35TSBS+;
Long-term exposure2: S. Typhimurium were cultured in 35TSBS+ at 37 °C for 24 h and resuspended in TSB.
Final cell concentration of each suspension was adjusted to ∼4 × 108 CFU/mL. Five milliliters of the cell suspensions were incubated in a water bath at 25 °C for 10 min before heat treatment at 60 °C for 5 min in test tubes. Viable cell counts were determined by plating on TSA (■) and DHL agar (
). Results are shown in mean ± standard deviation obtained from three separate experiments. Different letters indicate significant differences between viable cell counts on TSA (A, B, C), DHL agar (a, b, c) (P < 0.01). *, P < 0.05; **, P < 0.01
Effects of simultaneous treatment with heat and sucrose-induced low aw on cell viability of S. Typhimurium The effects of simultaneous treatment with heat and sucrose-induced low aw on cell viability of S. Typhimurium were also examined. As shown in Fig. 2, after heat treatment at 56 °C for 10 min, the viable cell counts on TSA were significantly higher in the cells heated in media with more than 5% sucrose, compared to those in media without sucrose. Further, viable cell counts on TSA of the cells incubated in the broth with less than 35% sucrose were positively correlated with sucrose concentration. Meanwhile, viable cell counts on DHL agar of the cells incubated in the broth with 65% and 80% sucrose were significantly higher than those with or with less than 50% sucrose. These results suggested that simultaneous treatment with heat and sucrose-induced low aw also increased the heat resistance of S. Tpyhimurium.
Effects of simultaneous treatment with heat and sucrose-induced low aw on cell viability of S. Typhimurium
S. Typhimurium cultured in TSB were resuspended at final cell concentration of ∼4 × 108 CFU/mL in TSB or TSB supplemented with 5%, 10%, 20%, 35%, 50%, 65%, 80% (w/v) sucrose which had been preheated at 56 °C. Suspensions were incubated at 56 °C for 10 min, in 0.2 mL PCR tubes. After incubation, viable cell counts were determined by plating on TSA (■) and DHL agar (
). Mean ± standard deviation was obtained from three separate experiments. Different letters above bars indicate significant differences between viable counts on TSA (X, Y, Z) or DHL agar (x, y) (P < 0.01). Asterisk indicates P < 0.05 (*), P < 0.01 (**) compared with corresponding viable cell count on TSA.
Overview of gene expression after cultivation in the media with 35% sucrose Gene transcription was investigated by DNA microarray analysis on S. Typhimurium, in late exponential growth phase in TSB containing 35% sucrose. Overall, 207 genes were up-regulated, and 79 genes were down-regulated, as compared to cells cultured in normal TSB. Gene-annotation enrichment analysis was performed to identify the genes increasing heat resistance. From up-regulated genes, 24 terms containing 73 genes were enriched (Table 2). The increased transcription of these genes was considered to be induced by the cultivation in the presence of 35% sucrose, and they appeared to be potentially involved in improving heat resistance. Among all up-regulated genes, 13 genes were classified into gene ontology term GO:0009236 which showed the lowest P value and represented cobalamin biosynthesis. These genes, together with three functionally highly correlated genes involved in propanediol catabolic process and involved in interactions with cobalamin, were selected to further investigate their role in improving heat resistance.
| Term | Description (counts of involved genes) |
Genes with increased transcription (log2-fold change) |
P-value* | |||
|---|---|---|---|---|---|---|
| Biological processes | ||||||
| GO:0009236 | cobalamin biosynthetic process (13) | cbiD (4.35), cbiE (3.41), cbiF (3.36), cbiA (3.3), cbiT (3.19), cbiB (3.11), cbiG (2.92), cbiL (2.90), cbiH (2.89), cbiM (2.66), cbiC (2.54), cbiJ (2.5), cbiQ (2.08) | 2.44E-10 | |||
| GO:0008643 | carbohydrate transport (4) | malF (3.85), melB (2.83), malM (3.70), uhpT (2.06) | 0.0115 | |||
| GO:0071705 | nitrogen compound transport (3) | caiT (2.58), yehY (2.58), yehW (2.06), | 0.0186 | |||
| GO:0006567 | threonine catabolic process (3) | yfiD (3.65), tdcB (3.56), pflB (2.37), | 0.0186 | |||
| GO:0006974 | cellular response to DNA damage stimulus (3) | yciF (6.14), yciE (5.93), iraD (3.58) | 0.0271 | |||
| GO:0051144 | propanediol catabolic process (3) | pduC (3.87), pduD (3.04), pduE (2.94) | 0.0271 | |||
| GO:0019547 | arginine catabolic process to ornithine (2) | yjiY (3.31), cstA (2.11) | 0.0887 | |||
| GO:0006208 | pyrimidine nucleobase catabolic process (2) | STM2186 (3.04), yeiA (2.65) | 0.0887 | |||
| GO:0070689 | L-threonine catabolic process to propionate (2) | tdcD (4.27), tdcB (3.56) | 0.0887 | |||
| Molecular function | ||||||
| GO:0016491 | oxidoreductase activity (15) | idnO (5.50), idnD (4.96), STM1497 (4.34), dmsC (4.19), dmsB (4.14), asrB (4.14), STM2186 (3.04), STM4306 (3. 04), STM2529 (3.03), STM0699 (2.49), phsB (2.48), yjjW (2.48), ybdR (2.39), phsA (2.36) yghA (2.22), | 7.35E-05 | |||
| GO:0051539 | 4 iron, 4 sulfur cluster binding (14) | asrA (4.38), dmsA (4.19), asrC (3.81), STM1499 (3.77), STM1786 (3.17), frdB (2.80), yeiA (2.65), tdcG (2.51), STM2530 (2.49), yjjW (2.48), phsB (2.48), fdhF (2.45), phsA (2.36), STM1498 (2.33) | 9.80E-05 | |||
| GO:0009389 | dimethyl sulfoxide reductase activity (4) | dmsA (4.19), STM1499 (3.77), STM2530 (2.49), STM1498 (2. 33), | 4.10E-04 | |||
| GO:0009055 | electron carrier activity (12) | dmsA (4.19), STM1499 (3.77), STM0360 (3.65), STM0361 (3. 28), STM1788 (3. 17) STM1792 (2. 82), frdB (2.80), phsC (2.74), STM2530 (2.49), fdhF (2.45), phsA (2.36), STM1498 (2.33), | 5.43E-04 | |||
| GO:0030151 | molybdenum ion binding (6) | dmsA (4.19), STM1499 (3.77), STM2530 (2.49), fdhF (2.45), phsA (2.36), STM1498 (2.33), | 0.0020 | |||
| GO:0050215 | propanediol dehydratase activity (3) | pduC (3.87), pduD (3.04), pduE (2.94) | 0.0066 | |||
| GO:0016151 | nickel cation binding (4) | STM1787 (3. 67), hybF (2.34), hypA (2.09), hypB (2.03) | 0.0072 | |||
| GO:0052591 | sn-glycerol-3-phosphate:ubiquinone-8 oxidoreductase activity (3) | glpB (2.95), glpC (2.80), glpA (2.46) | 0.0298 | |||
| GO:0019646 | aerobic electron transport chain (3) | glpB (2.95), glpC (2.80), glpA (2.46) | 0.0369 | |||
| GO:0016682 | oxidoreductase activity, acting on diphenols and related substances as donors, oxygen as acceptor (3) | STM0360 (3.65), STM0361 (3.28), STM1792 (2.82) | 0.0405 | |||
| GO:0031419 | cobalamin binding (3) | pduC (3.87), pduD (3.04), pduE (2.94) | 0.0405 | |||
| GO:0031669 | cellular response to nutrient levels (2) | STM0360 (3.65), STM0361 (3.28), STM1792 (2.82) | 0.0887 | |||
| GO:0003954 | NADH dehydrogenase activity (2) | STM4467 (2.24), STM4465 (2.21) | 0.0931 | |||
| GO:0004159 | dihydrouracil dehydrogenase (NAD+) activity (2) | STM2186 (3. 04), yeiA (2.65) | 0.0931 | |||
| Cellular component | ||||||
| GO:0070069 | cytochrome complex (3) | STM0360 (3.65), STM0361 (3.28), STM1792 (2.82) | 0.0242 | |||
Gene expression of Salmonella Typhimurium cells cultured in TSB supplemented with 35% sucrose (wt/vol) until late logarithmic growth phase was compared to which cultured in TSB. Genes with increased transcription (log2-fold change ≥2) was applied to GO term enrichment analysis by using DAVID Functional Annotation Tool.
Confirmation of changes in transcription by real-time qPCR The difference in transcription of the pdu-cbi gene cluster between the cells cultured in the presence and absence of 35% sucrose was confirmed by examining the transcriptional level of pduA, pduH, cbiA, cbiF and pocR genes by real-time qPCR (Table 3). The results showed that the transcriptional levels of pocR, pduA, pduH, cbiA, cbiF genes were significantly higher in the cells cultured in 35TSBS+ than those in TSB alone.
| Gene | log2-fold change | |
|---|---|---|
| Microarray | qPCR | |
| pduA | 4.26 | 5.27 |
| pduH | 3.60 | 2.08 |
| cbiA | 3.30 | 4.63 |
| cbiF | 3.36 | 1.38 |
| pocR | 1.53 | 5.43 |
Data from DNA microarray or real-time qPCR analyses are mean values from two separate experiments.
Changes in culturability of pocR deletion mutant after heat treatment in the presence of sucrose The S. Typhimurium ΔpocR::Kmr deletion construct was confirmed by PCR along with confirmation of its growth in TSB containing 50 µg/mL kanamycin. The detected PCR products are listed in Table 1. The results confirmed that the kanamycin-resistance gene was successfully inserted and the pocR gene was inactivated. Significant decrease in the transcriptional level of pduA, pduH, cbiA, cbiF genes was confirmed by real-time qPCR in the ΔpocR mutant even after cultivation in 35TSBS+ (data not shown). The changes in culturability of the ΔpocR mutant after heat treatment in the presence of sucrose are shown in Fig. 3. Viable cell counts of the ΔpocR mutant on TSA after heat treatment were lower by 1-Log at all time points, compared to the wild type strain (P < 0.05). In addition, viable cell counts on DHL agar, which represent the number of intact cells, showed no significant difference between the ΔpocR mutant and wild type S. Typhimurium strains. As a result, the ratio of the injured cells in the sum of intact and injured cells of ΔpocR mutant was lower than that of the wild type strain. These results indicate that deletion of the pocR gene suppressed increase in the heat resistance of S. Typhimurium under low aw induced by 35% sucrose.
Changes in cell viability of S. Typhimurium wild type and ΔpocR mutant strain heat-treated and incubated in the presence of 35% sucrose
S. Typhimurium wild type (■) and ΔpocR (●) strain were cultured in TSB supplemented with 35% (w/v) sucrose (35TSBS+), heated at 60 °C for 5 min and incubated at 37 °C in 35TSBS+. Viable cell counts were determined by plating on TSA (—) and DHL agar (…‥). Mean ± standard deviation was obtained from three separate experiments. *, P < 0.05; **, P < 0.01
Many low moisture foods such as chocolate and peanut butter, which are implicated in the outbreak of foodborne diseases, contain high concentration of sucrose. While the addition of salt in a growth medium induces both ionic and osmotic stress, sucrose induces only osmotic stress. Moreover, sucrose generally cannot be fermented by Salmonella, and has only a small rate of translocation through its outer membrane (Schmid et al., 1988). These reasons make sucrose an adequate humectant for investigating the mechanism of improving heat resistance in Salmonella in a low aw medium. There is a consensus that sucrose induces higher heat resistance in Salmonella than other solutes like fructose, NaCl, and glycerol, which can be used to lower water activity (Goepfert et al., 1970; Mattick et al., 2000b). However, limited research has been devoted to the elucidation of the mechanism of how sucrose-induced lowering of water activity can improve heat resistance in Salmonella species. This study was aimed at investigating these unknown mechanisms.
The objective of our research stemmed from the question raised by Peña-Meléndez et al. (2014) regarding whether heat resistance of Salmonella in low aw is caused by osmotic shock or develops gradually through adaptation to the low moisture conditions. In the current study, heat resistance increased dramatically in S. Typhimurium cells cultured in 35TSBS+ for 24 h, as compared with those cultured in TSB (Fig. 1). Meanwhile, the cells heated for 10 min after resuspension in 35TSBS+ also showed enhanced heat resistance, although the improvement was lower than the cells cultured for 24 h (Fig. 1).
Exposure of bacterial cells to low aw induce environmental stress response of the cells in two steps, through initial rapid changes in osmotic pressure, followed by response to the continuous low aw allowing exponential growth in the environment (Maserati, 2017). It has been well established that osmotic response generally involves accumulation of intracellular compatible solutes such as proline, trehalose and glycine betaine (Finn et al., 2013), which stabilize ribosomal subunits (Pleitner et al., 2012) and thus contribute to heat resistance. Additionally, within 4 min of exposure to low aw, transcription of the S. Typhimurium genes correlated with the accumulation of compatible solutes increased (Balaji et al., 2005), which would explain the increased heat resistance of S. Typhimurium cultured in TSB and resuspended in 35TSBS+ prior to heat treatment (Fig. 1). However, we found that resuspension of the cells in media with sucrose-induced low aw increased the viability of Salmonella after heat treatment (Fig. 2). This fact has been largely ignored in correlative research and can present obstacles for inhibiting the acquisition of heat resistance in pathogenic bacteria under low aw condition. The mechanism for which is not well understood, but it seems that sucrose somehow provided cytoprotective effect here. In fact, it has been suggested that high sucrose concentration induces almost instantaneous dehydration of the protoplasm of S. Typhimurium (Gibson, 1973). Moreover, Corry (1976) has claimed that increased heat resistance of Salmonella can be correlated with the degree of plasmolysis or cell shrinkage. In addition, S. Typhimurium increased its heat resistance in the presence of sucrose at a high concentration of 65% or more, and not only injured cells that could be recovered but also intact cells were detected after the heat treatment (Fig. 2), suggesting potential safety risk in foods with high sucrose content. On the other hand, the Salmonella cells cultured in 35TSBS+ for 24 h and resuspended in TSB also exhibited higher heat resistance than those cultured in and resuspended in TSB (Fig. 1), the reason for which is unclear. The increase in heat resistance of S. Typhimurium after cultivation under low aw seemed to be related to the changes in gene expression induced by low aw.
DNA microarray analysis was performed to elucidate global gene expression of the cells grown in 35TSBS+ until late logarithmic growth phase. Compared to the cells grown in TSB, the transcription of some genes involved in osmotic response, such as ompW, which encodes a minor porin and involved in osmoregulation (Gil et al., 2007), proWXV, which encode parts of a ATP-binding cassette type transport system for glycine betaine and proline (Frossard et al., 2012), increased significantly in S. Typhimurium during growing in 35TSBS+ (log2-fold change: ompW, 5.07; proW, 2.92; proX, 2.80; proV, 2.40) (data not shown). However, other typical genes involved in osmotic response, such as kdP, proP and proU (Finn et al., 2013), did not show significant difference. Nevertheless, the results suggest that some osmotic responses of the cells were induced by sucrose even within the late logarithmic growth phase, and these responses seems to contribute to the improvement of heat resistance. On the other hand, it is well-known that the σS regulon contributes to the general stress response, including heat stress. Recent research reported that rpoS was involved in survival of bacterial cells under low moisture conditions (Pratt et al., 2016). In S. Typhimurium, rpoS further demonstrated involvement in cross-protection against high temperatures through desiccation (Zhao and Xiuping, 2017). However, transcription of rpoS and other genes involved in heat shock response, such as clpP, dnaK and grpE, showed no significant difference between cells grown in TSB and 35TSBS+ (data not shown). It can thus be concluded that the improvement in heat resistance of S. Typhimurium in the presence of sucrose was not due to the induced expression of rpoS and heat shock genes, which is in agreement with the previous study by Gunasekera et al. (2008) on the response of Escherichia coli K-12 to 0.3 M NaCl.
To identify genes potentially contributing to the improvement of heat resistance, DAVID gene ontology (GO) enrichment analysis was performed and the genes involved in cobalamin biosynthesis were analyzed. The functions of these genes have been well studied. Jeter et al. (1984) discovered that S. Typhimurium synthesizes cobalamin de novo during anaerobic growth. Later studies have demonstrated that S. Typhimurium utilizes 1,2-propanediol (1,2-PD), which is a major product of the anaerobic degradation of rhamnose and fucose (Obradors et al., 1988), and is the sole carbon and energy source in aerobic conditions supplied with exogenous cobalamin (Jeter, 1990). Price-Carter et al. (2001) reported that 1,2-PD can be utilized even under anaerobic conditions in the presence of tetrathionate. However, there remains a “B12 paradox” in which, despite ∼1% of the S. Typhimurium genome being involved in B12 synthesis, a mutant strain defective in only cobalamin synthesis shows no aerobic or anaerobic growth phenotype in the laboratory (Roth et al., 1996). Further investigation of the functions of the genes involved in cobalamin biosynthesis and 1,2-PD metabolism is required to resolve the paradox. The relationship between heat resistance and the contributions of cobalamin biosynthesis and 1,2-PD metabolism have not yet been studied. Since numerous studies have shown that pocR regulates the entire pdu-cbi gene cluster (Klumpp and Fuchs, 2007; Mellin and Cossart, 2015; Srikumar and Fuchs, 2011), a pocR deletion mutant was constructed to examine its contribution to heat resistance. Even in the presence of sucrose, deletion of pocR resulted in the decrease in heat resistance of S. Typhimurium grown in 35TSBS+ (Fig. 3). Although a detailed study is required to understand how PocR affects the heat resistance of S. Typhimurium, it appears that some changes induced by PocR were important for improvement of heat resistance in S. Typhimurium after cultivation under low aw induced by sucrose. Interestingly, the transcriptional levels of genes involved in 1,2-PD utilization were also found to be highly increased in S. Typhimurium after exposure to glycerol for 6 h, but not to NaCl and KCl (Finn et al., 2015). It seems that nonionic solutes were able to trigger the expression of these genes.
It must be noted that the other genes listed in Table 2 might also play important roles in the development of heat resistance of S. Typhimurium grown in the presence of 35% sucrose. Further investigation should be conducted to clarify the detailed functions of these genes.
In conclusion, this study demonstrated that exposure of S. Typhimurium to media containing sucrose resulted in the improvement in heat resistance. S. Typhimurium highly improved heat resistance after long-term exposure to low aw induced by sucrose compared to that after short-term exposure. Improvement in heat resistance of S. Typhimurium was also achieved in the cells, immediately after suspending them in the broth with low aw. DNA microarray analysis showed increase in the transcriptional level of pdu/cbi genes in the presence of 35% sucrose. The decrease in the heat resistance of the pocR deletion mutant suggested its importance in improving heat resistance of S. Typhimurium. Our results provide further insights into the mechanism of increased heat resistance in Salmonella under low aw conditions induced by sucrose.
Acknowledgements This work was supported by a grant of the research project for improving food safety and animal health (Ministry of Agriculture, Forestry and Fisheries, Japan; 2013–2017 FY).
