2020 年 26 巻 6 号 p. 875-881
Endothelial cells are important for the maintenance of endothelial function. Nitric oxide (NO), synthesized by endothelial NO synthase (eNOS), is produced and secreted from these cells and is involved in various physiological functions such as regulation of vascular relaxation, platelet aggregation, inflammation, and oxidation. Camellia japonica seed cake extract contains saponins, which are amphiphilic triterpenes that activate eNOS in endothelial cells. Therefore, we investigated whether defatted C. japonica seed cake extract (CJE) activates eNOS and increases NO production in bovine aortic endothelial cells. CJE increased NO production, eNOS mRNA expression, and eNOS activity in a concentration-dependent manner. CJE-stimulated NO production was reduced by eNOS and phosphoinositide 3-kinase inhibitors, but not by 5'-adenosine monophosphate-activated protein kinase inhibitor. Furthermore, we confirmed that camelliasaponin B was, at least partly, involved in CJE-stimulated NO production. These findings suggest that CJE may help to prevent and treat vascular endothelium-dependent diseases by expanding blood vessels.
Endothelial cells play a key role in the maintenance of endothelial function (Rajendran et al., 2013). Nitric oxide (NO), synthesized by endothelial NO synthase (eNOS), is produced and secreted from these cells and is involved in various physiological functions, such as regulation of vascular relaxation, platelet aggregation, inflammation, and oxidation (Zhao et al., 2015). Previously, eNOS knockout in mice has been reported to cause vascular endothelial dysfunction (Kawashima and Yokoyama, 2004). Moreover, endothelial dysfunction is known to be an early marker for atherosclerosis (Davignon and Ganz, 2004). Interestingly, obesity, diabetes, and hypertension reduce the vascular endothelial function (Petrie et al., 2018), involved in blood flow regulation. Moreover, NO supplementation is shown to increase peripheral temperature and blood flow in individuals with cold sensitivity and Raynaud's phenomenon (Petrie et al., 2018; Shepherd et al., 2019). Therefore, activation of eNOS is crucial for the prevention and treatment of these diseases or disease symptoms.
Camellia japonica L. is a shrub that grows naturally in Japan and Korea (Chung et al., 2003). Oil extracted from these seeds has been used in food, cosmetics, and medicines, with several studies reporting seed oil having anti-inflammatory and antiviral effects (Kim et al., 2012; Akihisa et al., 1997). C. japonica seed cake is mostly discarded as industrial waste. However, seed cake has been reported to exhibit physiological effects such as antiatherogenic activity and inhibition of alcohol absorption (Lee et al., 2016; Yoshikawa et al., 1994). Our previous study has also shown that C. japonica seed cake extract (CJE) has anti-obesity effects in mice, attributable to saponins present in the cake (Ochiai et al., 2018). C. japonica seed cake contains various saponins, such as camelliasaponin and camoreoside (Rho et al., 2019). Saponins are amphiphilic triterpenes and activate eNOS in endothelial cells (Zhao et al., 2016; Wang et al., 2017). Besides, ginsenosides are ginseng saponins and are known to increase NO synthesis in vascular endothelial cells while suppressing hypertension in mice (Pan et al., 2012), and astragaloside IV, an Astragalus membranaceus saponin, has been shown to activate eNOS activity and exhibit vasodilatory function (Lin et al., 2018). Thus, saponins activate eNOS and promote NO synthesis in vascular endothelial cells; however, to date, using CJE with saponins to activate eNOS and promote NO synthesis has not been investigated.
Therefore, in the present study, we aimed to investigate whether defatted CJE activates eNOS and increases NO production in bovine aortic endothelial cells (BAECs), and evaluated the underlying molecular mechanisms. Moreover, we assessed the involvement of saponins in CJE-stimulated NO production.
Chemicals NG-Nitro-L-arginine methyl ester, monohydrochloride (L-NAME) was purchased from Cayman Chemical (Ann Arbor, MI, USA). Compound C and LY-294002 were obtained from FUJIFILM Wako Pure Chemical Corporation (Osaka, Japan). The PathScan Phospho-eNOS (Ser1177) Sandwich ELISA Kit was purchased from Cell Signaling Technology (Beverly, MA, USA).
Materials CJE was prepared by BHN Co, Ltd. (Tokyo, Japan). Briefly, oil was extracted from 100 g C. japonica seed cakes. The defatted cakes were added to 300 mL of hot water at 80–90 °C and extracted for 60 min. Then, the extracts were filtered and spray-dried. The resulting powder (16.4 g) contained ≥ 3% camelliasaponin B2 and 1% camelliasaponin C2, as determined by high-performance liquid chromatography (HPLC)-electrospray ionization-time-of-flight-mass spectrometry. Camelliasaponin B2 (> 86% purity) and camelliasaponin C2 (> 88% purity) were isolated and purified from CJE using reversed-phase HPLC and later verified by nuclear magnetic resonance. These structures are shown in Figure 1.
The chemical structures of camelliasaponin B2 and camelliasaponin C2.
Cell culture and NO production BAECs were obtained from Cell Applications Inc. (San Diego, CA, USA). We used BAECs between four and seven passages in the present study. BAECs were cultured with Dulbecco's Modified Eagle Medium (DMEM, D6046, Sigma-Aldrich, St. Louis, MO, USA) supplemented with 10% fetal bovine serum at 37 °C in humidified atmosphere containing 5% CO2. The cells were seeded in 12-well plates at a density of 1 × 105 cells/well and incubated for 2 d. Then, the medium was replaced with serum-free, no phenol red DMEM (D2902, Sigma-Aldrich) supplemented with sodium bicarbonate and with or without CJE. CJE were dissolved in dimethyl sulfoxide (DMSO) and added to the DMEM. The final concentration of DMSO in the DMEM was up to 0.1%. After 6 h, the medium was collected and centrifuged at 1 000 × g for 15 min at 25 °C. The NO concentration in the supernatant was analyzed using an NO2/NO3 Assay Kit-FX (Dojindo Laboratories, Kumamoto, Japan). To test the inhibition, inhibitor (1 mM L-NAME, 10 µM Compound C, or 50 µM LY-294002) was administered 30 min before CJE supplementation.
Cell viability assay BAECs were seeded in 96-well plates at a density of 1 × 104 cells/well and incubated for 1 d. Then, the medium was replaced with serum-free DMEM with or without CJE. After 6 h, 100 µg of thiazolyl blue tetrazolium bromide (Sigma-Aldrich) was added and incubated at 37 °C for 1 h. Then, the medium was removed and replaced with DMSO. The plate was shaken and the absorbance was measured at 590 nm.
Gene and protein expression of eNOS The medium of cultured BAECs was replaced with serum-free, no phenol red DMEM with or without CJE. After 6 h, the cells were collected using RNAiso Plus (Takara Bio, Shiga, Japan) or Lysis buffer (Cell Signaling Technology) for mRNA and protein expression analysis, respectively. For eNOS mRNA expression, total RNA was extracted from the cells, and cDNA was synthesized using PrimeScript RT Master Mix (Takara Bio). The mRNA expression of eNOS was quantified using real-time qPCR with TB Green Premix Ex Taq II (Takara Bio) and the CFX96 Real-Time PCR Detection System (BIO-RAD, Tokyo, Japan). The forward and reverse primers for eNOS were CCAGCTCAA GACTGGAGACC and TCAATGTCATGCAGCCTCTC, respectively, and those for β-actin (housekeeping gene) were CCTTGATGTCACGGACGATT and CCAGATCATGTTC GAGACCT, respectively. For phospho-eNOS (p-eNOS) protein expression analysis, protein level of the lysate was measured using the TaKaRa Bradford Protein Assay Kit (Takara Bio). Then, 20 µg of protein extract was administered and measured using the PathScan Phospho-eNOS (Ser1177) Sandwich ELISA Kit, according to the manufacturer's instructions.
Statistical analysis All data are expressed as the mean ± standard deviation. All statistical analyses were performed using BellCurve for Excel version 3.20 software (Social Survey Research Information, Tokyo, Japan). For the concentration-dependence test, data were measured by one-way ANOVA and the post-hoc Tukey-Kramer test, and p < 0.05 was significant. For CJE and inhibitor tests, all data were analyzed using two-way ANOVA. If the interaction effect of two components was significant, the Tukey-Kramer test was performed.
CJE stimulates NO production and eNOS activity in BAECs CJE treatment stimulated NO production in a concentration-dependent manner (Fig. 2A), and showed a significant increase in BAECs treated with 75 µg/mL and 100 µg/mL CJE when compared with the DMSO control. We also confirmed that CJE did not affect cell viability up to 100 µg/mL (100 µg/mL: 105.5 ± 3.5% of control, n = 8).
Effect of CJE on (A) NO production, (B) eNOS mRNA expression, and (C) p-eNOS (Ser1177) protein levels in endothelial cells. Values are expressed as the fold change of the control levels (= 1.0). Data are expressed as mean ± SD (n = 4–8). Values without a common letter (a, b, c, and d) are significantly different at p < 0.05.
CJE increased the expression of eNOS mRNA and activated p-eNOS (Ser1177) protein in a concentration-dependent manner (Fig. 2B and 2C). By contrast, CJE-stimulated NO production was significantly inhibited by eNOS inhibitor (L-NAME) in BAECs (Fig. 3A).
CJE induces NO production via phosphoinositide 3-kinases (PI3K)/Akt pathway in BAECs To investigate whether CJE activates 5′-adenosine monophosphate-activated protein kinase (AMPK) or PI3K/Akt pathways, we used Compound C and LY-294002, respectively. Pre-treatment of BAECs with Compound C did not significantly inhibit CJE-induced NO production (Fig. 3B). By contrast, pre-treatment of BAECs with LY-294002 significantly reduced CJE-stimulated NO production and p-eNOS protein expression (Fig. 3C and 3D).
Effect of (A) eNOS, (B) AMPK, or (C) PI3K inhibitor on CJE-stimulated NO production and (D) PI3K inhibitor on p-eNOS (Ser1177) protein in endothelial cells. Values are expressed as the fold change of the control levels (= 1.0). Data are expressed as mean ± SD (n = 6). Values without a common letter (a and b) are significantly different at p < 0.05.
Camelliasaponin B2 is involved in CJE-stimulated NO production in BAECs We confirmed that CJE contained at least 3% camelliasaponin B2 and 1% camelliasaponin C2 (data not shown). Therefore, we investigated whether camelliasaponin B2 or camelliasaponin C2 are involved in CJE-stimulated NO production. Figure 4 show that camelliasaponin B2 induced NO production in a concentration-dependent manner. By contrast, camelliasaponin C2 did not increase NO production (data not shown).
Effect of camelliasaponin B2 on NO production in endothelial cells. Values are expressed as the fold change of the control levels (= 1.0). Data are expressed as mean ± SD (n = 4–6). Values without a common letter (a, b, and c) are significantly different at p < 0.05.
NO secreted from endothelial cells plays a key role in the maintenance of endothelial function (Vanhoutte, 1997). Endothelial dysfunction causes various diseases, including arteriosclerosis and diabetes (Petrie et al., 2018). Increased NO production from endothelial cells increases blood flow and prevents hypertension (Allerton et al., 2018). Therefore, in the present study we investigated whether CJE increases NO production. Our results demonstrated that CJE promoted NO production in endothelial cells. Moreover, eNOS activation was involved in CJE-stimulated NO production. These data may suggest that CJE increases blood flow and helps to prevent and treat diseases such as arteriosclerosis and hypertension. However, we did not investigate the effect of orally administered CJE on NO production and vascular endothelial function in animals and humans. Therefore, future studies are needed to examine the effects of orally administered CJE on human blood flow and arteriosclerosis.
Several saponins have been reported to increase NO production in endothelial cells (Zhao et al., 2016; Wang et al., 2017; Pan et al., 2012; Lin et al., 2018). Wang et al. (2017) reported that Panax notoginseng saponin promotes NO production through AMPK activation. Codonopsis lanceolata saponin has also been reported to stimulate NO release via PI3K/Akt pathway (Lee et al., 2019). To investigate whether CJE activates the AMPK or PI3K/Akt pathways, we used Compound C and LY-294002, respectively. We found that the PI3K/Akt pathway was involved in CJE-induced NO production. It has been reported that lancemaside A or astragaloside IV, which is an oleanane-type triterpene, increases NO production via the PI3K/Akt pathway in endothelial cells (Lee et al., 2019, Lin et al., 2018). C. japonica seeds have been reported to contain oleanane-type saponins (Yoshikawa et al., 1994), such as camelliasaponins, and here we confirmed that CJE contains camelliasaponins. Further, Park et al. (2015) reported that 70% ethanol extract of Camellia fruits has vasorelaxant effects via the PI3K/Akt pathway. These findings suggest that the camelliasaponins contained in CJE increase NO production via the PI3K/Akt pathway.
Some authors have found that receptors expressed on endothelial cells, such as estrogen, androgen, and vascular endothelial growth factor receptor 2, activate PI3K/Akt pathway (Hohmann et al., 2016; Koizumi et al., 2010; Lin and Sessa., 2006). For example, the ginseng saponin Rb1-induced NO production is abolished by inhibiting the androgen receptor (Yu et al., 2007). Besides, a study showed the ginseng saponin Rg1 binds to the glucocorticoid receptor and promotes NO production via activation of the PI3K/Akt pathway (Leung et al., 2006). In addition, astragaloside IV was reported to bind to the glucocorticoid receptor with low affinity (Zhang et al., 2020). Glucocorticoid receptor may be involved in CJE-induced NO production because both camelliasaponins and astragaloside IV are oleanane-type triterpenes. Thus, it is necessary to examine glucocorticoid receptor for its involvement in CJE-induced NO production in future studies.
C. japonica seeds contain several saponins such as camelliasaponin and camoreoside (Rho et al., 2019). Yoshikawa et al. (1994) reported that C. japonica L. seeds contain six acylated polyhydroxyolean-12-ene triterpene oligoglycosides: camelliasaponin A1, A2, B1, B2, C1, and C2. Here, we found that CJE contained at least 3% camelliasaponin B2 and 1% camelliasaponin C2. Therefore, we investigated whether camelliasaponin B2 and camelliasaponin C2 increase NO production in BAECs. Interestingly, only camelliasaponin B2 induced NO production. The molecular formulae of camelliasaponin B2 and C2 are C58H90O26 and C58H92O26, respectively, and they differ only by their side chains. Moreover, polyphenol and tocopherol have different effects on eNOS depending on their structure (Martínez-Fernández et al., 2015; Muid et al., 2016). It is necessary to examine whether different side chains in camelliasaponin B2 affect NO production. Moreover, this study only analyzed two saponins. Thus, the involvement of other four saponins in the CJE-stimulated NO production needs to be examined. On the other hand, we have shown that camelliasaponin B2 promotes NO production in vascular endothelial cells, but it remains unclear how camelliasaponin B2 are absorbed and metabolized in the body. Further studies on the pharmacokinetics of camelliasaponin B2 are needed.
In the present study, we demonstrated that defatted CJE significantly stimulates NO production via activation of the PI3K/Akt pathway in BAECs (Fig. 5). Moreover, camelliasaponin B2 might be, at least partly, involved in the increased NO production. These findings suggest that defatted CJE may help to prevent and treat vascular endothelium-dependent diseases by expanding blood vessels.
Possible mechanism for NO production by Camellia japonica seed extract in endothelial cells. Camellia japonica seed extract activates PI3K/Akt pathway in BAECs. The activation induces p-eNOS (Ser1177) and stimulates NO production. These effects were blocked by PI3K inhibitor (50 µM LY-294002) or eNOS inhibitor (1 mM L-NAME).
The authors declare that they have no conflict of interest.
Acknowledgements We would like to thank Editage (www.editage.com) for English language editing.
5′-adenosine monophosphate-activated protein kinase
BAECbovine aortic endothelial cell
CJECamellia japonica seed cake extract
DMEMDulbecco's Modified Eagle Medium
DMSOdimethyl sulfoxide
eNOSendothelial nitric oxide synthase
L-NAMENG-Nitro-L-arginine methyl ester, monohydrochlorid
NOnitric oxide
p-eNOSphospho-endothelial nitric oxide synthase
PI3Kphosphoinositide 3-kinase
