Loss of the intrinsic plasmid-encoded eps genes in Lactococcus lactis subsp. cremoris FC grown at elevated temperature abolishes exopolysaccharide biosynthesis

Abstract

Strain FC of Lactococcus lactis subsp. cremoris is used to produce viscous yogurt because of its metabolite exopolysaccharide (EPS) and is typically grown at 25–30 °C. Herein, we isolated the EPS non-producing variant C4 by incubating strain FC at 37 °C and evaluated the genes involved in EPS biosynthesis. Southern blotting revealed that strain C4 lost the plasmid encoding epsX and epsL. Furthermore, specific PCR fragments for epsB, epsD, and orfY were not amplified. Therefore, strain FC cultured at 37 °C lost the plasmid harbouring the eps gene cluster, and EPS biosynthesis was thus abolished. Moreover, we analysed the physical properties of yogurts fermented with these strains. Yogurt fermented with strain FC was harder, stickier, and more cohesive than that fermented with strain C4. Furthermore, the volume of separated whey was less for strain FC. For the production of viscous yogurt, strain FC must be carefully maintained at its optimal growth temperature to prevent the loss of the eps-encoding plasmid.

Introduction

Lactic acid bacteria (LAB) have been used worldwide to improve the preservation, sensory characteristics, and nutritional value of dairy foods. Some strains of LAB are known to improve the texture and viscosity of dairy foods by producing exopolysaccharides (EPS) during fermentation (Ruas-Madiedo et al., 2002). Particularly, Scandinavian fermented-milk products, such as “långfil” in Sweden and “viili” in Finland, are made with specific starters of EPS-producing LAB (Duboc and Mollet, 2001), which are typically mixtures of traditional mesophilic strains belonging to Lactococcus lactis subsp. cremoris that confer a strong ropy character to the product (Kahala et al., 2008).

Some LAB possess a cluster of eps genes for EPS biosynthesis, which was first identified in the intrinsic plasmid pNZ4000 of L. lactis subsp. cremoris NIZO B40 (van Kranenburg et al., 2000). pNZ4000 carries not only the eps gene cluster, consisting of 14 coordinately transcribed genes (epsRXABCDEFGHIJKL), but also other genes necessary for mobilization along with an origin of transfer. The composition of the eps gene cluster varies widely between strains, except for the first six genes, epsRXABCD, and the last two genes, epsL and orfY, which are generally conserved (Dabour and LaPointe, 2005; Forde and Fitzgerald, 2003; Knoshaug et al., 2007; van Kranenburg et al., 2000).

Strain FC of L. lactis subsp. cremoris was originally isolated from a fermented-milk product made locally in the Caucasus region (Ishida et al., 2005) and is currently used as a starter for commercial yogurt production in Japan. Additionally, Streptococcus thermophilus and Lactobacillus bulgaricus are other LAB used in milk fermentations, and their optimal growth temperature is 35 to 42 °C and 43 to 46 °C, respectively. Of note, the optimal growth temperature of L. lactis subsp. cremoris is 25 to 30 °C, considerably lower than those of S. thermophilus and L. bulgaricus. In fact, the majority of L. lactis subsp. cremoris strains are unable to grow at temperatures > 37 °C. Fermented-milk products made with L. lactis subsp. cremoris FC have a characteristic viscous texture as a result of the EPS content. The plasmid nature of the EPS genes was suggested as the cause of the EPS expression instability at >30 °C or in the context of frequent batch inoculations of the starter culture (Cerning et al., 1992; Vedamuthu and Neville, 1986). The physical properties of yogurt produced by strain FC may change with subculturing, depending on the growth temperature; thus, it is essential to stabilize EPS production. However, the genetic element involved in EPS biosynthesis is not yet clear.

When plasmid-containing bacteria are used for commercial production, products often lose their desired properties via the spontaneous loss of intrinsic plasmids from the bacteria. Plasmids are typically lost through the action of plasmid-curing agents, unusual growth temperatures, and thymine starvation. For instance, elevated growth temperature (5–7 °C above the normal or optimal growth temperature) can be employed as a curing method (Trevors, 1986). Several studies reported that plasmids of L. lactis strains were lost under culture at 37 to 40 °C (Hayes et al., 1990; Trotter et al., 2002; van Kranenburg et al., 1997). van Kranenburg et al. reported that the plasmid encoding eps genes in L. lactis subsp. cremoris NIZO B40 was lost after culture at 40 °C overnight. Therefore, if eps genes are encoded by one of the intrinsic plasmids in L. lactis subsp. cremoris FC, the bacterium could lose its valuable EPS production potential. In this study, we investigated whether the culture of L. lactis subsp. cremoris FC at an elevated temperature would impact the production of EPS, and evaluated the responsible mechanism.

Materials and Methods

Isolation of EPS non-producing variant    The EPS-producing strain FC of L. lactis subsp. cremoris (from our collection), typically grown at 25 to 30 °C, was used in this study. Strain FC was grown in M17G broth (Difco Laboratories, Detroit, USA) at an elevated temperature (37 °C) for 72 h. Next, the bacterial culture was diluted, spread onto M17G agar plates, and allowed to grow at 25 °C for 48 h. Ninety colonies were randomly selected, inoculated into cow milk dispensed into 96-well plates, and incubated overnight at 25 °C. The ropiness of the fermented milk was confirmed using an inoculating loop after stirring, and the pH was measured. Then, we tested whether the obtained non-ropy colony could ferment yogurt to the same extent as the original FC strain. A 3% starter culture of the non-ropy colony was inoculated into cow milk, followed by incubation at 25 °C until the lactic acid concentration of the fermented milk reached 0.75%; the pH of the fermented milk was measured over time and the cell number was determined at the end of the fermentation using the plate count method with bromocresol purple agar (Nissui Pharmacy, Tokyo, Japan). A non-ropy colony exhibiting a nearly equivalent fermentation time and lactic acid production was named strain C4 and used for the following experiments. Capsular formation of the bacteria was microscopically observed after India ink staining (Hong and Marshall, 2001). Briefly, cultured cells were mixed with a drop of India ink and smeared on slides. After air-drying, stained cells were observed using a microscope (400 × magnification).

DNA extraction    L. lactis subsp. cremoris FC and C4 strains were grown in M17G broth for 15 h at 30 °C. Total DNA was extracted from the harvested cells by the phenol/chloroform method (Saito and Miura, 1963).

PCR specific for strain FC and eps genes    L. lactis subsp. cremoris FC and its variant C4 were subjected to PCR analysis using strain FC-specific primer pairs [Table 1(a)] designed with the randomly amplified polymorphic DNA (RAPD) technique (Maruo et al., 2006). The presence of eps genes was examined using the primer pairs newly designed based on the sequence of the pNZ4000 plasmid from L. lactis subsp. cremoris NIZO B40 (AF036485) [Table 1(b)]. The amplified DNA fragments were subjected to agarose gel electrophoresis. The gels were stained with ethidium bromide and the DNA fragments were visualized under a UV transilluminator.

Table 1. Sequences of PCR primers used in this study

Name	Sequence (5′–3′)
(a) Primers for strain FC
No. 125-F	TCGTGGTCACAAGCAGTAG
No. 125-R	GGAATGACGGTTTCAATCGTG
(b) Primers for eps genes
epsB-F	CGTACGATTCGTACGACCAT
epsB-R	TGACCAGTGACACTTGAAGC
epsD-F	TGATCCCCGTGTAACGAAGA
epsD-R	AAGAGAGGCGCTCCCCATAT
orfY-F	ATGAATCAAAAAAAGAGG
orfY-R	TTATTTTAGAGATTTTTCAA

(a) Primers for strain FC were reported by Maruo et al. (Maruo et al., 2006).

(b) Primers for eps genes were newly designed based on the sequence of pNZ4000 of L. lactis subsp. cremoris NIZO B40 (AF036485).

Southern blot analyses    Probes were PCR fragments amplified from DNA extracted from strain FC using the primer pairs listed in Table 2. The primer pairs were newly designed based on the sequence of the pNZ4000 plasmid from L. lactis subsp. cremoris NIZO B40 (AF036485). The bacterial DNA were electrophoresed on a 0.8% SeaKem GTG agarose gel (Lonza, Basel, Switzerland), and the DNA fragments were transferred onto an Amersham Hybond-N+ membrane (GE Healthcare, Little Chalfont, UK). Probe labelling and signal detection in Southern hybridization were carried out using the AlkPhos Direct Labelling and Detection System (GE Healthcare), according to the manufacturer's instructions.

Table 2. Primers for preparing Southern blot probes

Target gene	Name	Sequence (5′–3′)
dnaA	dnaA-south-F	GTAACCGAGCTGGCTAGGC
	dnaA-south-R	CACCAGGTTTATCAGCAACAGC
repB	repB-south-F	GTGGTCGAGCATAATAGCTTGATTAC
	repB-south-R	GCTCGTACTGGCTATAATTCATAGC
epsX	epsX-south-F	GTTATAATTCTAGGATAAATAATCTTTCAAAAGCTG
	epsX-south-R	CTAGCCCAGTAGTCTATATTGG
epsL	epsL-south-F	GTTTTGGGGGATATGCTACACG
	epsL-south-R	GGACTCCAGTCTTGAATCAACTTTCC

The primer pairs were newly designed based on the sequence of the pNZ4000 of L. lactis subsp. cremoris NIZO B40 (AF036485).

Measurement of EPS concentration in yogurt    Yogurt fermentation was initiated by inoculation with a 4% starter culture of L. lactis subsp. cremoris FC and its variant C4 in pasteurized cow milk, followed by incubation at 25 °C for 12 h. The pH of FC and C4 cultured yogurt was 4.25 and 4.30, respectively. The EPS content of yogurts was determined by an ethanol precipitation method (Cerning et al., 1994). After adding 10% (w/v) trichloroacetic acid, the precipitate containing bacterial cells was removed, and the resulting suspension was centrifuged at 21 900 × g for 10 min at 4 °C. EPS was precipitated from the supernatant with 1.5 volumes of chilled ethanol by centrifugation at 21 900 × g for 10 min at 4 °C. The EPS precipitate was washed with 60% ethanol and centrifuged at 21 900 × g for 10 min at 4 °C. The EPS was dissolved in water and the total sugar concentration was determined by the phenol-sulfuric method using glucose as a standard (Dubois et al., 1956).

Textural assessment of yogurt    Yogurt texture was assessed using the SUN Rheo Meter CR-200D (Sun Scientific Co., Ltd., Tokyo, Japan) equipped with a 2-kgf load cell. Yogurt samples were poured into acrylic containers (height, 10 mm; diameter, 34 mm) and analysed using an extrusion disk (diameter, 15 mm) operating at a constant speed of 1.0 mm/s to a depth of 5 mm in two consecutive cycles. Texture profile analysis was performed to evaluate hardness, stickiness, adhesiveness, and cohesiveness. Hardness (mN) was defined as the first maximum force necessary for sample compression. Stickiness (mN) was defined as the negative force to pull the probe from the sample after the initial compression. Adhesiveness (mN × mm) was defined as the negative force area for the initial compression, representing the work required to overcome the attractive forces between the food surface and the surface of other materials. Cohesiveness was assessed as the ratio of the area of work during the second compression divided by the area of work during the initial compression.

Measurement of syneresis of yogurt via centrifugation    The susceptibility of yogurt to syneresis was evaluated using the centrifugation method (Hong and Marshall, 2001). Forty millilitres of yogurt was placed in a centrifuge tube and centrifuged at 4 °C for 10 min at different values of RCF ranging 500–10 000 × g using a TOMY MX-305 (TOMY SEIKO Co., Ltd., Tokyo, Japan). The weight of the clear supernatant was determined and plotted against the RCF.

Statistical analyses    Experiments for the measurement of EPS content and syneresis were repeated 3 times in duplicate. Experiments of texture were repeated 3 times in triplicate. Significant differences between FC and C4 were tested by Student's t-test. p values less than 0.05 were considered significant.

Results

Strain FC of L. lactis subsp. cremoris was grown at an elevated temperature to form non-ropy colonies, abolishing EPS production    L. lactis subsp. cremoris FC is typically grown at 25 to 30 °C. In this experiment, we cultured strain FC at 37 °C for 72 h in broth, and then at 25 °C for 48 h on agar plates. Among ninety randomly selected colonies, twenty-five produced non-ropy fermented milk. The pH of milk fermented with strain FC was 4.12, while that fermented with non-ropy colonies was between 4.14 and 5.15. A non-ropy colony that gave rise to fermented milk with a pH equivalent to strain FC was selected and named C4. We made yogurt with strain C4 and compared the fermentation time with that of strain FC (Fig. 1). The lactic acid concentration of the yogurt fermented with strain FC was 0.75% after 9 h, while that fermented with strain C4 was 0.75% after 10 h. The number of bacteria in the yogurt fermented with strain FC was 6.1 × 10⁸ colony-forming units (cfu)/ml, compared to 3.0 × 10⁸ cfu/ml for strain C4. These results indicate that strain C4 produces fermented milk that is very similar to that produced with strain FC, except with respect to ropiness.

Fig. 1.

pH and lactic acid concentration of milk fermented with L. lactis subsp. cremoris FC and its non-ropy variant C4.

The 3% starter cultures of each strains were inoculated to cow milk, and incubated at 25 °C until the lactic acidity of the fermented milk reached 0.75%.

We used strain C4 as the non-ropy variant in the following experiments. We performed PCR with strain FC-specific primer pairs using the RAPD technique and detected the same specific amplification in strain C4 as in the original FC (Fig. 2), confirming that strain C4 was not a contaminant but rather a variant of strain FC. To further examine EPS production, we evaluated the morphological differences between strains FC and C4 using microscopy following India ink staining (Fig. 3) and directly measured the levels of EPS in yogurt fermented with each of the two strains (Fig. 4). India ink staining clearly revealed capsular formation in strain FC but not in strain C4 (Fig. 3). Additionally, nearly 30 mg/L EPS was contained in the yogurt fermented with strain FC, while no EPS was detected in the yogurt with strain C4 (Fig. 4). These results indicate that EPS productivity was completely abolished in strain C4.

Fig. 2.

PCR amplification using L. lactis subsp. cremoris FC strain-specific RAPD primers.

The size of the PCR product was 220 bp. Lane 1, 100 bp ladder; lane 2, L. lactis subsp. cremoris FC; lane 3, L. lactis subsp. cremoris C4.

Fig. 3.

Photomicrograph of L. lactis subsp. cremoris FC and its EPS non-producing variant C4.

(a) L. lactis subsp. cremoris FC and (b) its non-ropy variant C4 with India ink staining.

Fig. 4.

EPS content of yogurts fermented with L. lactis subsp. cremoris FC and its EPS non-producing variant C4.

Values are expressed as the mean ± SD. ***: Significant difference between strains by Student's t-test at p < 0.001.

Loss of intrinsic plasmid-encoded eps genes in the EPS non-producing variant of FC    Whole DNA was extracted from L. lactis subsp. cremoris FC and C4 and subjected to Southern blot analyses (Fig. 5). The two probes targeting dnaA and repB were used to distinguish the chromosome and intrinsic plasmids, respectively. A distinct single chromosome band was detected with the dnaA probe in both strains. In contrast, the repB probe detected numerous DNA species in strain FC and an altered pattern in strain C4. The results suggested that strain FC possessed several different intrinsic plasmids, some of which may have been lost in strain C4. The other probes specific for two of the most conserved eps genes, epsX and epsL, detected two DNA species only in strain FC but not in strain C4. The two DNA species exhibited bands of the same size as those that were missing in the hybridization pattern of strain C4 with the repB probe. Typically, a plasmid in a cell is a covalently closed circular DNA (cccDNA); however, it can be nicked and relaxed to form open circular DNA (ocDNA). Agarose gel electrophoresis shows two distinct bands for cccDNA and ocDNA; the latter is bulkier than the former and shows slower migration. Therefore, the two DNA species detected in Southern blot analysis may correspond to the two plasmid forms. The results suggest that both epsX and epsL are encoded by an intrinsic plasmid in strain FC, which was missing from strain C4.

Fig. 5.

Southern blot analysis of total DNA from strains FC and C4 of L. lactis subsp. cremoris.

Lane 1, L. lactis subsp. cremoris FC; lane 2, L. lactis subsp. cremoris C4. Black arrowhead shows the chromosomal bands hybridized with the dnaA probe, while white arrowheads show the plasmid hybridized with the repB probe in L. lactis subsp. cremoris FC. White arrow shows the bands hybridized with the epsX and epsL which is same size as those that were missing in the hybridization pattern of C4 with the repB.

PCR analyses were performed using specific primer pairs to amplify the other conserved eps genes including epsB, epsD, and orfY (Fig. 6). All three primer pairs amplified specific PCR products from strain FC, while no PCR product was amplified from strain C4. The results indicate that the three conserved eps genes are encoded by the plasmid missing from strain C4.

Fig. 6.

PCR amplification of eps genes in L. lactis subsp. cremoris FC and its EPS non-producing variant C4.

(a) Amplification of epsB; the size of PCR product is 1 175 bp. (b) Amplification of epsD; the size of PCR product is 155 bp. (c) Amplification of orfY, the size of PCR product is 900 bp. Lane 1, 100 bp ladder; lane 2, L. lactis subsp. cremoris FC; lane 3, L. lactis subsp. cremoris C4.

Effect of EPS production on the physical properties of yogurt    Table 3 shows the texture parameters of yogurts fermented with L. lactis subsp. cremoris FC and C4. The hardness, stickiness, and cohesiveness of yogurt fermented with strain FC was significantly higher than that fermented with strain C4. Figure 7 displays the susceptibility to syneresis of yogurts fermented with strain FC and strain C4. The volume of separated whey from yogurt fermented with strain FC was significantly less than that fermented with strain C4 at all RCF values. These results indicate that EPS produced by strain FC affects the physical properties of yogurt.

Table 3. Texture parameters of yogurts fermented with L. lactis subsp. cremoris FC and its EPS non-producing variant C4

Texture parameters	L. lactis subsp. cremoris FC	L. lactis subsp. cremoris C4
Hardness (mN)	145.1 ± 12.8	121.6 ± 8.8**
Stickiness (mN)	82.4 ± 13.2	45.1 ± 11.2**
Adhesiveness (mN × mm)	354.4 ± 148.9	148.9 ± 152.4
Cohesiveness	0.33 ± 0.15	0.10 ± 0.15*

Values are expressed as mean ± SD.

*, **  Significant difference from L. lactis subsp. cremoris FC by Student's t-test at p < 0.05 and p < 0.01, respectively.

Fig. 7.

Susceptibility to syneresis of yogurts fermented with L. lactis subsp. cremoris FC (●) and its EPS non-producing variant C4 (○)

Values are expressed as mean ± SD. Significant differences (p < 0.001) were detected between strains by Student's t-test at all centrifugal forces.

Discussion

After growing EPS-producing L. lactis subsp. cremoris FC at 37 °C, an EPS non-producing variant was isolated and designated as strain C4. The eps genes are frequently found in plasmids in L. lactis subsp. cremoris strains (Forde and Fitzgerald, 2003; Knoshaug et al., 2007; van Kranenburg et al., 2000; Vedamuthu and Neville, 1986), while in strain SMQ-461, these genes are contained within the chromosome (Dabour and LaPointe, 2005). In this study, Southern blot analyses revealed that both the epsX and epsL genes were located on an intrinsic plasmid in strain FC, which was lost in strain C4. Additionally, PCR analyses suggested that the other three conserved eps genes, epsB, epsD, and orfY, are encoded by the same plasmid. Thus, EPS biosynthesis in C4 was abolished as a result of the loss of the plasmid encoding eps genes.

In the natural environment, EPS is thought to protect microbial cells from desiccation, phagocytosis, phage attack, antibiotics or toxic compounds, predation by protozoans, and osmotic stress, as well as promote adhesion to solid surfaces and biofilm formation (De Vuyst and Degeest, 1999). Therefore, EPS biosynthesis may be advantageous for the survival and subculture of L. lactis subsp. cremoris strains. Additionally, because strain FC is used to manufacture ropy yogurt, its particular ropy trait may have been selected artificially. In our experiments (data not shown), non-ropy colonies hardly appeared in the yogurt made with starter cultures derived from single ropy colonies of the FC strain at the optimal growth temperature (20 to 30 °C). Then, non-ropy colonies hardly increased in subsequent batch cultures in milk at the optimal growth temperature; the frequency of non-ropy colonies was less than 10% in the culture after 20 repetitions. Interestingly, the C4 strain spontaneously lost the eps-encoding plasmid at 37 °C, indicating that the plasmid is unstable under certain conditions. Therefore, in order to stably produce viscous yogurt, further experiments are needed to elucidate the conditions that induce the loss of the eps-encoding plasmid in a future study.

The textural properties and syneresis of yogurt are important determinants of its acceptance among consumers (Jaworska et al., 2005; Lee and Lucey, 2010; Marshall and Rawson, 1999). In addition, EPS produced by the yogurt starter cultures improves sensory characteristics such as texture, ropiness, and creaminess (Behare et al., 2010). Strain FC is used as a starter to produce yogurt with a characteristic texture (attributed to EPS) that is acceptable to consumers. Moreover, we previously reported that yogurt fermented by strain FC has characteristic physical properties that facilitate bolus formation and deglutition, attributed to its high cohesiveness, and dysphagia patients are less likely to have problems swallowing yogurt fermented with strain FC than that fermented with L. bulgaricus and S. thermophilus (Gotoh et al., 2019). Additionally, a textural comparison of yogurts fermented with strains FC and C4 individually revealed that EPS produced by strain FC increased the hardness, stickiness, and cohesiveness of the yogurt (Table 3). Therefore, the ropiness of yogurt (due to EPS) produced with strain FC is important not only for acceptance by the average consumer, but also for use as a food for patients with dysphagia.

Acknowledgements    This study was supported by the Special Coordination Funds for Promoting Science and Technology, Creation of Innovation Centers for Advanced Interdisciplinary Research Areas (Innovative Bioproduction Kobe; iBioK) from the Ministry of Education, Culture, Sports, Science and Technology (MEXT) of Japan.

References

•  Behare,  P.,  Singh,  R.,  Tomar,  S.,  Nagpal,  R.,  Kumar,  M., and  Mohania,  D. (2010) Effect of exopolysaccharide-producing strains of Streptococcus thermophilus on technological attributes of fat-free lassi. J. Dairy Sci., 93, 2874-2879.
•  Cerning,  J.,  Bouillanne,  C.,  Landon,  M., and  Desmazeaud,  M. (1992) Isolation and characterization of exopolysaccharides from slime-forming mesophilic lactic acid bacteria. J. Dairy Sci., 75, 692-699.
•  Cerning,  J.,  Renard,  C.,  Thibault,  J.,  Bouillanne,  C.,  Landon,  M.,  Desmazeaud,  M., and  Topisirovic,  C. (1994) Carbon source requirements for exopolysaccharide production by Lactobacillus casei CG11 and partial structure analysis of the polymer. Appl. Environ. Microbiol., 60, 3914-3919.
•  Dabour,  N. and  LaPointe,  G. (2005) Identification and molecular characterization of the chromosomal exopolysaccharide biosynthesis gene cluster from Lactococcus lactis subsp. cremoris SMQ-461. Appl. Environ. Microbiol., 71, 7414-7425.
•  De Vuyst,  L. and  Degeest,  B. (1999) Heteropolysaccharides from lactic acid bacteria. FEMS Microbiol. Rev., 23, 153-177.
•  Duboc,  P. and  Mollet,  B. (2001) Applications of exopolysaccharides in the dairy industry. Int. Dairy J., 11, 759-768.
•  Dubois,  M.,  Gilles,  K. A.,  Hamilton,  J. K.,  Rebers,  P. t., and  Smith,  F. (1956) Colorimetric method for determination of sugars and related substances. Anal. Chem., 28, 350-356.
•  Forde,  A. and  Fitzgerald,  G. F. (2003) Molecular organization of exopolysaccharide (EPS) encoding genes on the lactococcal bacteriophage adsorption blocking plasmid, pCI658. Plasmid, 49, 130-142.
•  Gotoh,  Y.,  Sato,  Y.,  Toda,  T.,  Hatanaka,  Y., and  Suzuki,  T. (2019) Physical properties of milk fermented with Lactococcus lactis subsp. cremoris FC and its propriety for dysphagia patients. Kagaku to Kogyo (in Japanease), 93, 311-315.
•  Hayes,  F.,  Caplice,  E.,  McSweeney,  A.,  Fitzgerald,  G. F., and  Daly,  C. (1990) pAMβ1-Associated Mobilization of Proteinase Plasmids from Lactococcus lactis subsp. lactis UC317 and L. lactis subsp. cremoris UC205. Appl. Environ. Microbiol., 56, 195-201.
•  Hong,  S. H. and  Marshall,  R. T. (2001) Natural exopolysaccharides enhance survival of lactic acid bacteria in frozen dairy desserts. J. Dairy Sci., 84, 1367-1374.
•  Ishida,  T.,  Yokota,  A.,  Umezawa,  Y.,  Toda,  T., and  Yamada,  K. (2005) Identification and characterization of lactococcal and Acetobacter strains isolated from traditional Caucasusian fermented milk. J. Nutr. Sci. Vitaminol. (Tokyo), 51, 187-193.
•  Jaworska,  D.,  Waszkiewicz-Robak,  B.,  Kolanowski,  W., and  Swiderski,  F. (2005) Relative importance of texture properties in the sensory quality and acceptance of natural yoghurts. International Journal of Dairy Technology, 58, 39-46.
•  Kahala,  M.,  Mäki,  M.,  Lehtovaara,  A.,  Tapanainen,  J. M.,  Katiska,  R.,  Juuruskorpi,  M.,  Juhola,  J., and  Joutsjoki,  V. (2008) Characterization of starter lactic acid bacteria from the Finnish fermented milk product viili. J. Appl. Microbiol., 105, 1929-1938.
•  Knoshaug,  E. P.,  Ahlgren,  J. A., and  Trempy,  J. E. (2007) Exopolysaccharide expression in Lactococcus lactis subsp. cremoris Ropy352: evidence for novel gene organization. Appl. Environ. Microbiol., 73, 897-905.
•  Lee,  W., and  Lucey,  J. (2010) Formation and physical properties of yogurt. Asian-Australas J. Anim. Sci., 23, 1127-1136.
•  Marshall,  V. M. and  Rawson,  H. (1999) Effects of exopolysaccharide-producing strains of thermophilic lactic acid bacteria on the texture of stirred yoghurt. Int. J. Food Sci. Technol., 34, 137-143.
•  Maruo,  T.,  Sakamoto,  M.,  Toda,  T., and  Benno,  Y. (2006) Monitoring the cell number of Lactococcus lactis subsp. cremoris FC in human feces by real-time PCR with strain-specific primers designed using the RAPD technique. Int. J. Food Microbiol., 110, 69-76.
•  Ruas-Madiedo,  P.,  Hugenholtz,  J., and  Zoon,  P. (2002) An overview of the functionality of exopolysaccharides produced by lactic acid bacteria. Int. Dairy J., 12, 163-171.
•  Saito,  H. and  Miura,  K. (1963) Preparation of transforming deoxyribonucleic acid by phenol treatment. Biochim. Biophys. Acta, 72, 619-629.
•  Trevors,  J. (1986) Plasmid curing in bacteria. FEMS Microbiol. Rev., 1, 149-157.
•  Trotter,  M.,  Ross,  R.,  Fitzgerald,  G., and  Coffey,  A. (2002) Lactococcus lactis DPC5598, a plasmid-free derivative of a commercial starter, provides a valuable alternative host for culture improvement studies. J. Appl. Microbiol., 93, 134-143.
•  van Kranenburg,  R.,  Kleerebezem,  M., and  de Vos,  W. M. (2000) Nucleotide sequence analysis of the lactococcal EPS plasmid pNZ4000. Plasmid, 43, 130-136.
•  van Kranenburg,  R.,  Marugg,  J. D.,  Van Swam,  I. I.,  Willem,  N. J., and  De Vos,  W. M. (1997) Molecular characterization of the plasmid-encoded eps gene cluster essential for exopolysaccharide biosynthesis in Lactococcus lactis. Mol. Microbiol., 24, 387-397.
•  Vedamuthu,  E. R. and  Neville,  J. M. (1986) Involvement of a plasmid in production of ropiness (mucoidness) in milk cultures by Streptococcus cremoris MS. Appl. Environ. Microbiol., 51, 677-682.