Notes
Real-time PCR-based identification methods for Megaselia scalaris (Loew) (Diptera: Phoridae) targeting mitochondrial DNA
2022 Volume 28 Issue 2 Pages 119-122
Details
2022 Volume 28 Issue 2 Pages 119-122
The scuttle fly, Megaselia scalaris (Loew, 1866) (Diptera: Phoridae), is an insect of the family Dermatidae that often poses problems as a foreign substance contaminating foods. In this study, we developed a rapid identification method for this contaminant using mitochondrial DNA based on a molecular biology technique. From the entire region of mitochondrial DNA information, a region suitable for real-time polymerase chain reaction (PCR) was chosen, and two primers and a probe specific to M. scalaris were designed. A specificity test was performed with 16 species of pests that could be contaminants in food, and the developed real-time PCR method was confirmed to show a positive result only for M. scalaris. In addition, the limit of detection of this analysis method using a 10-µL PCR solution was 1 pg of total DNA, which revealed that the method was highly sensitive.
Megaselia scalaris (Loew) (Diptera: Phoridae) is an insect that has flying properties and is attracted to a wide range of organic spoilage, such as milk (Robinson, 1971), mushrooms (Lau et al., 2017), fruits, ham, and green tea (Tsuji, 2005; Wilton, 1961). As such, M. scalaris occupies a position with other small flies as a scavenger in the biological pyramid. It is also used in the field of forensic medicine as a marker for determining the interval from the time of death to the discovery of a corpse (Reibe and Madea, 2010). In addition, since M. scalaris shows a preference for an exceptionally broad spectrum of decaying organic materials for its food, it has been shown to be a useful indicator of unsatisfactory hygiene measures in food handling (Santini, 1998).
On the other hand, M. scalaris is a troublesome insect associated with food contamination, an issue that often gets attention in the news media. M. scalaris is ubiquitous throughout the manufacturing/storage/distribution process, and it is easily attracted to and often present in foods. Finding M.scalaris in food not only causes discomfort in consumers,but is also evidence of poor quality control, undermining the corporate image of the producer of the food. While the safety risk of insect-contaminated food is not high in and of itself, consumers generally feel that it is unacceptable to produce food in an unsanitary environment that would allow such insects to thrive. Therefore, food companies need methods of identifying contaminants in order to clarify the cause of the contamination, explain the contamination to the consumers, and ensure the quality of their products.
Small flies, including M. scalaris, can fly and easily contaminate food (Kosone and Kanayama, 2002). Small flies that contaminate food are regarded as unpleasant pests. Although there have been few reports of them causing health problems in Japan, cases of diseases, such as myiasis caused by small flies, have been reported all over the world, and one paper has been published that described the importance of controlling small flies as sanitary pests (Kaneko et al., 1961; Hira et al., 2004; Ghavami and Djalilvand, 2015).
In this study, we selected M. scalaris as an example of a small fly that contaminates food, developed a polymerase chain reaction (PCR)-based analytical method for its detection, and evaluated the performance of the developed method.
Insects M. scalaris, Drosophila melanogaster (Meigen), Musca domestica (L.), Clogmia albipunctatus (Williston), Boettcherisca peregrina (Robineau-Desvoidy), Periplaneta fuliginosa (Serville), and Spodoptera litura (Fabricius) were purchased from Sumika Technoservice Corporation (Hyogo, Japan). The complete nucleotide sequence information of the M. scalaris mitochondrion from a specimen captured in China (DDBJ/EMBL/GenBank database accession number: KF974742) was used. The other insects were reared at the Institute of Food Research, National Agriculture and Food Research Organization (NARO) of Japan. For the specificity tests, we used the common food insects listed in Table 1.
| Order | Family | Species |
|---|---|---|
| Diptera | Phoridae | Megaseria sclaris (Loew) |
| Drosophilidae | Drosophila melanogaster (Meigen) | |
| Muscidae | Musca domestica (L.) | |
| Psychodidae | Clogmia albipunctatus (Williston) | |
| Sarcophagidae | Boettcherisca peregrina (Robineau-Desvoidy) | |
| Blattaria | Blattellidae | Periplaneta fuliginosa (Serville) |
| Lepidoptera | Noctuidae | Spodoptera litura (Fabricius) |
| Pyralidae | Plodia interpunctella (Hubner) | |
| Gelechiidae | Sitotroga cerealella (Olivier) | |
| Coleoptera | Anobiidae | Lasioderma serricorne (Fabricius) |
| Bostrichidae | Rhyzopertha dominica (Fabricius) | |
| Cucujidae | Cryptolestes pusillus (Schonherr) | |
| Silvanidae | Oryzaephilus surinamensis (L.) | |
| Tenebrionidae | Tribolium castaneum (Herbst) | |
| Bruchidae | Callosobruchus chinensis (Linnaeus) | |
| Dryophthoridae | Sitophilus zeamais (Motschulsky) |
DNA extraction and purification for insects Frozen insects were crushed by a grind-masher (Sarstedt, Tokyo, Japan) with extraction buffer. DNA extraction and the purification of total DNA containing mtDNA were performed using DNeasy® Blood & Tissue Kits (Qiagen, Hilden, Germany) according to the manufacturer's ‘Purification of Total DNA from Animal Tissues (Spin-Column Protocol)’ with the following small modification: 50 µL of Buffer AE was used for elution from the DNeasy® Mini Spin Column.
Calculation of the DNA concentration The concentration of the purified DNA solution was determined by measuring the ultraviolet absorption at 260 nm using Q5000 micro-volume UV and UV-Visible spectrophotometers (Quawell Technology, Palo Alto, CA, USA). An optical density at 260 nm of 1.0 was defined as the concentration of 50 ng of DNA (Sambrook and Russell, 2001).
Oligonucleotides DNA alignment was performed using GENETYX® software (Genetyx, Tokyo, Japan). Two primers for the real-time PCR reaction were obtained from FASMAC (Atsugi, Japan) and diluted with TE-buffer. A Taq-Man® probe labeled with 5′-FAM (6-carboxyfluorescein) and 3′-TAMRA (5-carboxytetramethylrhodamine) was also synthesized by FASMAC, purified on a high-performance liquid chromatography column, and diluted with an appropriate volume of TE-buffer. All sequences of the real-time PCR oligonucleotide set for M. scalaris detection are shown in Table 2.
| Name | Oligonucreotides (3′→5′) | Base |
|---|---|---|
| M.scalaris 1-1F | CGGGTGAATTAATCACACACAAC | 23 |
| M.scalaris 1-1R | CAGCCAATGTTCCTGGTCG | 19 |
| M.scalaris 1-1 Tag* | CGCTCATTTAGTTCCTCAGGGAACCCCAGC | 30 |
Real-time PCR Real-time PCR was performed in a 10-µL final volume containing 1 ng of total template DNA, 5 µL of SsoAdvanced™ Universal Probes Supermix (Bio-Rad Laboratories, Hercules, CA, USA), 0.5 µM of the primer pair, and 0.2 µM of probe. Template DNA was prepared using 1 ng of total DNA in 10 µL of reaction mixture or an equivalent amount of reaction mixture without DNA for the no-template control unless otherwise indicated. The reaction was performed using a CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad Laboratories) for rapid detection with the following program: 95 °C for 30 s, and 30 cycles of 95 °C for 5 s and 60 °C for 5 s. The cycle threshold value of the amplification was estimated using CFX Manager™ Software (Bio-Rad Laboratories) that accompanied the equipment, and the threshold level was held at 500 for the real-time PCR data analyses.
Specificity of oligonucleotides False-positive reactions of oligonucleotides were examined using the total DNA of the major insects that contaminate foods. Amplification plots of real-time PCR prepared using 16 species of major insects, including five flies of the order Diptera, are shown in Fig. 1. The fluorescence indicating the amplification of DNA was only detected from the M. scalaris total DNA. No amplification curve was observed with real-time PCR for the other insects described above. The primer/probe sets designed for real-time PCR were highly specific to M. scalaris.
Specificities of real-time PCR. A 10-µL reaction solution contained 1 ng of total insect DNA. The cycle threshold (Ct) line was fixed at 500 for end-point analysis. The fluorescent units indicate the subtraction value of fluorescence between the sample and the no template control. The specificity tests were done with common insects, as shown in Table 1.
Determination of the limit of detection (LOD) The LOD value was estimated by a single-laboratory/in-house validation method.
Referring to the standards of Codex Alimentarius (CAC/GL 74-2010) and the general guidelines for single-laboratory validation (Broeders et al., 2014), the LOD was determined as the lowest concentration achieving more than 20 analyses of positive amplification in 21 replicates (≤ 5% false-negative rate). The M. scalaris total DNA containing mtDNA was used for the PCR template, and the LOD value of real-time PCR was 1 pg of total DNA in a 10-µL reaction mixture (Table 3).
| Total DNA / reaction | Number of replicate | Positive results | Negative results | False negative rate (%) |
|---|---|---|---|---|
| 1 pg | 21 | 21 | 0 | 0 |
Total DNA for the estimation of LOD was prepared from the M. scalaris. A 10-µL reaction solution was used for LOD estimation, the Ct line was fixed on the threshold level of 500 for end-point analysis. LOD was defined as the total DNA concentration level that detected at least 95% of positive results, and hence ensuring 5% false negative results, with 0.95 ≤ confidence level.
In recent years, the field of food manufacturing and distribution has succeeded in reducing the problem of contamination by large-sized insects by maintaining a hygienic environment. Consequently, the number of cases in which smaller foreign substances, such as small flies, are admixed has become the new focus. Japanese food factories with a site area of more than 3 000 m2 are required to secure 20% or more green space under the Industrial Location Law. Small flies can easily live among the organic matter both inside and outside of these premises, and they can pass through narrow gaps and insect repellent nets to eventually contaminate food products (Hayashi and Nakayama, 2010). Therefore, it is difficult to determine the source of outbreaks of small flies.
“Small flies” is a common term for small insects that generally belong to the order Diptera (Mallis, 2004). Insects belonging to the family Drosophilidae, the family Phoridae, the family Mycetophilidae, and the family Psychodidae are the most common members of this group. These families can be identified by characteristic structures, such as wing veins and antennae. However, these structures are destroyed by the physical processing that foods undergo in the manufacturing process, such as shearing, heating, and stirring. In such cases, DNA-based methods for identifying insects are particularly effective. The best-known method for identifying insects by DNA is the DNA barcoding method using cytochrome c oxidase subunit I (COI) sequence information for animal species (Hebert et al., 2003). Indeed, Alam et al. (2016) have already reported an example of the application of the DNA barcode method for M. scalaris. Despite being suitable for the identification of a wide range of insects in a small number of testing samples, this method is complicated and time-consuming.
In this study, we developed a real-time PCR identification method for M. scalaris as a model case of a flying insect. The yield of total DNA that could be extracted from one M. scalaris was 12.1 ± 5.51 ng/µL (N = 5, data not shown); however, the LOD value was small at 1 pg/reaction, as shown in Table 3. Thus, this method is suitable for the detection of damaged samples, and can be performed quickly, as amplification and detection can be done simultaneously using a dedicated thermal cycler. In contrast, simplex PCR uses a general and inexpensive thermal cycler without a fluorescence detector, such that electrophoresis is required to confirm the amplified DNA. Another advantage of our real-time PCR method is its high accuracy. Thus, this approach enables quick and easy analysis without sacrificing accuracy or detail.
In conclusion, this method can be expected to strongly assist traditional insect identification when combined with other insect analysis methods that will be developed in the near future.
Acknowledgements We are grateful to Dr. Yukio Magariyama for years of collaboration and useful discussions. We also thank Ms. Miyuki Tsuru and Ms. Tomomi Endo for their diligent support in this study.
Conflict of interest There are no conflicts of interest to declare.
