Effects of flavonoids on the phage susceptibility of Escherichia coli and on the transcription of chaperone gene dnaK

Abstract

In this study, the dnaK gene-deletion mutant strain of Escherichia coli BW25113 showed a higher susceptibility than the wild-type strain of E. coli BW25113 to phage S127BCL3. Flavonoids, myricetin and quercetin which had been reported to suppress the role of DnaK were tested to examine their effects on the phage susceptibility of E. coli BW25113. A 6-h pretreatment with 500 µmol/L myricetin or quercetin increased the phage susceptibility of E. coli BW25113. A similar result was observed in E. coli O157:H7. Real-time quantitative polymerase chain reaction (qPCR) was conducted to investigate the effects of flavonoids on the transcription of chaperone genes (dnaK, dnaJ, groEL, and grpE) in E. coli. Pretreatment of wild-type E. coli BW25113 with flavonoids decreased the transcription of chaperone genes. This is the first report demonstrating the enhancement of the phage susceptibility of both E. coli BW25113 and E. coli O157:H7 by flavonoids. The results of this study on the combined effects of flavonoids involved in foods and phages on E. coli provide scientific bases for development of a novel biocontrol method of foodborne bacteria.

Introduction

Foodborne diseases are among the leading causes of public health issues and result in high mortality rates worldwide (World Health Organization, 2015). The major pathogens causing foodborne illnesses are Salmonella, Campylobacter, and Escherichia coli O157:H7 (Food and Drug Administration, 2022). In the US, about 96,000 illnesses are attributed to E. coli O157:H7 annually (Scallan et al., 2011). Enterohemorrhagic E. coli serotype O157:H7 is a bacterial pathogen that causes bloody diarrhea, leading to a high risk of hemolytic uremic syndrome (Wang et al., 2017). Recently, the application of bacteriophages as biocontrol agents has attracted attention owing to their host specificity and lytic ability without causing harmful effects in humans and animals (Monk et al., 2010). However, the risk of emergence of phage-resistant bacterial populations is a major issue that impedes the application of phages in food. To overcome this problem, a previous study in our laboratory identified genes that appear to be involved in the phage resistance of E. coli. The ten deletion mutant strains (Δrpe;JW3349, ΔyfcD;JW2296, ΔybcH;JW0556, ΔyaiW;JW0369, Δgor;JW3467, ΔubiE;JW5581, ΔdnaK;JW0013, ΔtolR;JW0728, ΔpriA;JW3906, and ΔtolA;JW0729) out of the 3,909 one-gene-deficient strains showed a phage susceptibility higher than that of the wild-type strain of E. coli BW25113 (manuscript under submission).

In E. coli, the multifunctional DnaK chaperone machine (DnaK/DnaJ/GrpE complex) performs key cellular functions under both physiological and stress conditions (Mayer and Bukau, 2005). In bacteria, DnaK, DnaJ, GroEL, and HtpG are major heat shock proteins. The DnaK and DnaJ pairs are involved in protein folding and survival under stressful conditions (Genevaux et al., 2007). DnaK, also known as the heat shock protein (Hsp70), has a molecular mass of 70 kDa. It is present in the cytoplasm and plays a vital role in preventing protein denaturation during cellular stress responses. Under stressful conditions, DnaK prevents the accumulation and subsequent refolding of misfolded proteins (Hesterkamp and Bukau, 1998). Bacteria require DnaK for their survival under stressful conditions such as high temperatures and high concentrations of heavy met als or antibiotics (Mayer et al., 2000).

The DnaJ-stimulated DnaK ATPase activity is inhibited by blocking the formation of the DnaK-DnaJ complex in vitro (Cesa et al., 2013; Chang et al., 2011). It has also been demonstrated that the heat-dependent expression of HSP-70 is reduced (Hosokawa et al., 1992), and heat-shock transcription factor 1 is downregulated by quercetin (Nagai et al., 1995). Myricetin is a well-known plant flavonoid commonly occurring in many foods and beverages and has potential nutraceutical properties (Sato et al., 2013). Studies have shown that myricetin possesses pharmacological properties, including anti-oxidative, cytoprotective, anti-carcinogenic, antiviral, antiplatelet, anti-inflammatory, and antihyperlipidemic activities (Li and Ding, 2012; Ong and Khoo, 1997). Quercetin is also a prominent flavonoid, possessing antioxidant, antiviral, antimicrobial, antithrombotic, and antitumor properties. Moreover, various studies have reported the antimicrobial activity of flavonoids against gram-positive and gram-negative bacteria (Júnior et al., 2018). The effects of flavonoids on the phage susceptibility of E. coli were investigated in this study.

Recently, bacteriophages have been recognized as an alternative approach for controlling bacterial infections (Bardina et al., 2012). Most researchers have emphasized that the use of bacteriophages is a promising way to overcome antibiotic resistance. In this study, the effects of myricetin and quercetin (which suppress the function of DnaK and transcription of chaperone genes, including dnaK) on the phage susceptibility of E. coli were investigated.

Materials and Methods

Bacterial strains, culture condition and preparation of inoculums E. coli BW25113 and ΔdnaK mutant strains were purchased from the National Institute of Genetics, Shizuoka, Japan. E. coli O157:H7 strains (EC-064, EC-027, EC-041, EC-140, EC-080, EC-071, EC-119, EC-138, and EC-140) were provided by Fukuoka City Institute of Health and Environment (Fukuoka, Japan). Bacterial strains were stored at −80 °C in a microbank. Before use, the bacterial strain was streaked onto tryptic soy agar (TSA; Becton Dickinson and Company, Sparks, MD, USA). A single colony was inoculated into 5 mL of Luria Bertani broth (LB; Becton, Dickinson and Company, Sparks, MD, USA) and incubated overnight at 37 °C with constant shaking at 130 rpm to obtain cells in the stationary phase of growth. To determine cell concentrations, the optical density (OD) of the culture was measured at 600 nm (OD₆₀₀) using a spectrophotometer (UV-160; Shimadzu, Japan). The culture was then diluted with LB broth to attain OD₆₀₀ = 0.1 (approximately 10⁸ CFU/mL). This bacterial suspension was used for subsequent experiments.

Isolation and purification of the phage Phages infecting E. coli O157:H7 strains were isolated and purified from chicken livers. Among the 32 isolated phages, 14 showed lytic activity against E. coli BW25113, and the highest lytic activity was shown by phage S127BCL3. The nucleotide sequence of the genomic DNA of phage S127 BCL3 was registered under the accession number OQ626344. For propagation, the phage solutions were mixed with E. coli BW25113 and cultured overnight at 37 °C in LB medium with shaking. After cultivation, the supernatant obtained by centrifugation (at 12 000 × g and 4 °C for 5 min) was aseptically filtered through a sterile membrane filter with pore size 0.22 µm (As One Corp., Osaka, Japan). The filtrate was used as the phage solution. The phage solution was stored at 4 °C until use. Using the conventional method, the titer of the phage solution was determined as 10¹⁰ PFU/mL. The phage solution was diluted with saline magnesium (SM) buffer (0.05 mol/L Tris-HCl buffer, pH 7.5, containing 0.1 mol/L NaCl, 0.008 mol/L MgSO₄, and 0.01 % gelatin), and the dilutions (100 µL) were mixed with the bacterial host (100 µL) in molten agar (4 mL). The mixture was poured on TSA plates and incubated overnight at 37 °C. The phage titer of the solution was determined as the number of plaques per milliliter.

Treatment of E. coli with flavonoids and phage To investigate the effects of phages on the viability of E. coli BW 25113 and DdnaK mutant, 4.5 mL of LB broth supplemented with 1 mmol/L CaCl₂ was added to a test tube to promote phage infection, to which 0.5 mL bacterial cell suspension with 10⁷ CFU/mL was added to attain a final concentration of 10⁶ CFU/mL. Subsequently, 0.5 mL of phage S127BCL3 suspension was added to the cell suspension, resulting in a final concentration of 10⁷ PFU/mL; this mixture was incubated at 37 °C. For the control, instead of the phage suspension, the same volume of SM buffer was added. Myricetin (>97.0 % pure, Tokyo Kasei Kogyo Co., Ltd., Tokyo, Japan) and quercetin (≥ 98 % pure, Funakoshi Co., Ltd., Tokyo, Japan) were dissolved in 100 % dimethyl sulfoxide (DMSO, Nacalai tesques Co., Ltd., Japan) at 100 mmol/L, and 10, 50, or 100 mmol/L, respectively. The solutions were sterilized by filtration through a Millex^®-FG membrane filter (0.20 µm pore size, Millipore, Carrigtwohill. Co., Inc., Cork, Ireland). The molecular structures of the flavonoids tested in this study are shown in Fig. 1. To investigate the effects of flavonoids on phage susceptibility of E. coli BW 25113, the following method was adopted. To 4.5 mL of LB broth supplemented with 1 mmol/L CaCl₂ in a test tube, 0.5 mL bacterial cell suspension with concentrations 10⁵ CFU/mL and 10⁶ CFU/mL was added to attain a final concentration of 10⁴ CFU/mL (control without flavonoids) and 10⁵ CFU/mL (treatment with flavonoids), respectively. Further, to this cell suspension, 50 µL of flavonoid solutions were added to achieve final concentrations of 500 µmol/L for myricetin and 100, 500, or 1 000 µmol/L for quercetin treatment. The cell suspensions were incubated at 37 °C for 6 h with constant shaking. For the controls, the flavonoid solution was replaced with 50 µL of DMSO. After 6 h of incubation, 0.5 mL of phage S127BCL3 suspension were added to attain a final concentration of 10⁹ PFU/mL and incubated at 37 °C. In the controls, the same volume of SM buffer was added instead of the phage suspension. Identical experiments using myricetin were performed on E. coli O157:H7 (EC-071).

Fig. 1

Molecular structure of flavonoids tested in this study.

Determination of viable counts At each sampling time (0, 3, 6, 9, 12, 24, and 48 h), 20 µL of the culture were withdrawn from each tube, and serially diluted 10-fold with phosphate buffered saline (PBS, 137 mmol/L NaCl, 8.10 mmol/L Na₂HPO₄, 2.68 mmol/L KCl, and 1.47 mmol/L KH₂PO₄; pH 7.4). A 10-µL and 100-µL aliquot of the diluted sample was spotted and spread on TSA plates. After overnight incubation at 37 °C, the viable count was determined by counting the colony units. All experiments were performed in triplicate.

Real time qPCR analysis Quantitative PCR (qPCR) was performed to investigate the transcription levels of dnaK, dnaJ, groEL, and grpE in E. coli BW25113 cells with and without flavonoid treatment. E. coli BW25113 cells (10⁶ CFU/mL) treated with myricetin or quercetin at 500 µmol/L and 37 °C for 6 h with a constant shaking were collected by centrifugation at 12 000 × g and 25 °C for 10 min. For the controls, DMSO (100 %) was added instead of flavonoids. The pellet was resuspended in 3 ml PBS buffer, and the suspension was further centrifuged at 12 000 × g and 25 °C for 10 min. This washing step was repeated twice to remove residual medium, and the bacterial pellets were harvested and used for total RNA isolation. The precipitates were resuspended and disrupted using the FastGene^™ RNA Premium Kit (Nippon Genetics Co., Ltd., Tokyo, Japan), according to the manufacturer’s instructions. The quality and quantity of the RNA preparations were measured using a Nanodrop ND-1000 spectrophotometer (Thermo Scientific, Wilmington, DE, USA). The RNA quality was also checked using an Agilent 2100 Bioanalyzer electrophoresis system (Agilent, USA). Total RNA was used as a template to synthesize cDNA using the ReverTra Ace qPCR RT Master Mix with gDNA Remover (TOYOBO, Japan), following the manufacturer’s protocol. The nucleotide sequences of the genes listed in Table 1 were obtained from the National Center for Biotechnology Information (NCBI). Primers targeting these genes were designed using Clone Manager Suite 7 software (© 2020 Sci Ed Software LLC). The primers were synthesized by Thermo Fisher Scientific Life Technologies, Japan Co., Ltd. Real-Time qPCR was performed using the Mx3000P Real-time PCR System (Stratagene, CA, USA) with THUNDERBIRD™ Next SYBR^® qPCR mix (Toyobo Co., Ltd., Osaka, Japan), according to the manufacturer’s instructions. The real-Time qPCR mixture had a total volume of 20 µL/reaction with ROX as the reference dye. The mixture was denatured initially by 1 cycle of 95 °C for 5 min, followed by 40 cycles of denaturation at 95 °C for 20 s, annealing at 55 °C for 30 s, and extension at 72 °C for 30 s and 1 cycle of denaturation at 95 °C for 60 s, annealing at 55 °C for 30 s, and denaturation at 95 °C for 30 s. The 16S rRNA gene was used as a reference gene, and the data were analyzed using MxPro QPCR software (version 2.0; Stratagene, CA, USA). PCR results were quantified using the 2^DDCt method (where Ct is the threshold cycle)(Livak and Schmittgen, 2001). The transcription of each chaperone gene in E. coli treated with flavonoids was compared with that in the control without flavonoids. The experiments were independently repeated at least three times.

Table 1. Primer sequences used in qPCR analysis.

Gene	aPrimer sequence 5′-3′	Primer length	Annealing temperature	Description of function
dnaK	F: CTCTTGTGTAGCGATTATG R: CTGGGTATAGGCAATGATAG	20 20	55 °C	Protein folding
dnaJ	F: GTTCTGGTCAGGTGCAGATG R: TTGTTGCACGGATCTTTG	20 18	56 °C	ATP binding of chaperone
groEL	F: AAAGGCCGTAACGTAGTTCTGG R: TTTGCTTTAGAGGCAACTTC	22 20	59 °C	ATPase activity of chaperone
grpE	F: AAAGTTGCGAATCTCGAAGC R: TTCTCCAGCGCGAATTTGTG	20 20	59 °C	Nucleotide exchange factor activity and chaperone binding
16s rRNA	F: GTGAAATGTTGGGTTAAGTC R: AGTTTATCACTGGCAGTCTC	20 20	55 °C	Reference gene

^a  F: forward, R: reverse

Statistical analysis All experiments were performed in triplicate. The results are presented as mean values ± standard deviations. Statistical analysis was performed using one-way analysis of variance (ANOVA) with t-Test (Microsoft Excel 2016 for Windows) to determine the differences between treatments and controls and a value of p < 0.05 was considered as a statistical difference.

Results

Effects of dnaK deletion on phage susceptibility of E. coli The ΔdnaK mutant was used to confirm the influence of the dnaK gene of E. coli on their phage susceptibility. The viable count of the ΔdnaK mutant was 1 log lower than that of the BW25113 (wild-type strain) in the presence of the phage after a 4-h incubation with the phage. After 12 and 24 h of incubation with the phage, the viable count of the ΔdnaK mutant was 3 log lower than that of the wild-type strain (Fig. 2). The phage-resistant population survived the phage treatment grew after a 4-h incubation and the growth rate of the phage-resistant population of ΔdnaK mutant was slow compared with that of the wild-type strain from 4 h to 48 h in the presence of phage. Moreover, the viable counts of the ΔdnaK mutant was also 1 log lower than that of the wild-type strain after 48 h of incubation with the phage. However, after a 48-h incubation, the viable cell counts of ΔdnaK mutant with the phage treatment group grew back to the same as the control group.

Fig. 2

Phage susceptibility of E. coli BW 25113 and DdnaK mutant.

E. coli BW 25113 (○, ●), and DdnaK mutant (△, ▲) was incubated in LB broth supplemented with 1mmol/L CaCl₂ in the absence (○, △)and presence (●, ▲) of Phage S12BCL3 at MOI = 10.

The viable counts are represented as mean ± S.D. of three separate experiments.*, p < 0.05

Effects of myricetin treatment period on the phage susceptibility of E. coli To examine the effects of treatment time of myricetin on the phage susceptibility of E. coli BW25113 (wild-type strain), E. coli was pretreated with 500 µmol/L of myricetin for 0, 3, 6, 9, and 12 h before phage addition. As shown in Fig. 3, there are no difference between the viable counts of the control and those of the cells cultured in the presence of 500 µmol/L myricetin for 48 h. Thus, the viable cell counts in the presence and absence of myricetin were similar when the phage was added to the culture at 0 and 3 h of incubation. At 6 and 9 h of myricetin incubation, phage sensitivity significantly increased. After 6 h of phage inoculation, the viable count of the E. coli was 8.4 log and 6.9 log CFU/mL without and with myricetin pretreatment, respectively (Fig. 3c). The viable counts of E. coli BW25113 cells pretreated with myricetin for 6 and 9 h were respectively 1.5 and 1.3 log lower (after 6 h from phage addition) than those of the cells without myricetin pretreatment. Therefore, the treatment time with myricetin was set to 6 h in subsequent experiments.

Fig. 3

Effect of myricetin treatment on the phage susceptibility of E. coli BW 25113 cells. E. coli BW 25113 cells were incubated in the absence (○, ●)and presence (△, ▲) of 500 µmol/L myricetin in LB broth supplemented with 1mmol/L CaCl₂. Phage S127BCL3 (MOI = 1) was added to the culture (○, ●) after 0, 3, 6, 9, and 12 h of incubation.

The viable counts are represented as mean ± S.D. of three separate experiments. The arrowhead shows the timing of phage addition.*, p < 0.05

Effects of flavonoids and phage on the viability and regrowth of E. coli To examine the combined effect of flavonoids and phage on the viability and regrowth of E. coli, phage was added to E. coli BW25113 pretreated with or without 500 µmol/L myricetin and quercetin for 6 h. Fig. 4 shows the variation in the viable counts of E. coli BW25113 from the start of flavonoid pretreatment. Viable counts of the cells incubated with 500 µmol/L myricetin were lower by 1.8 and 2.1 log at 9 and 12 h of incubation, respectively, than those of the control cells incubated without myricetin at 6 h after phage addition (Fig. 4a). The viable counts of E. coli BW25113 increased after 24 h of incubation, despite myricetin pretreatment. The combined effects of 500 µmol/L quercetin and phages in E. coli BW25113 were also investigated (Fig. 4b). The viable counts of E. coli BW25113 cells pretreated with and without quercetin were not significantly different. The viable counts of E. coli BW25113 cells incubated with quercetin were lower by 1.4 log at 9 and 12 h of incubation than those of the cells without quercetin at 6 h after phage addition. Similar to myricetin pretreatment, regrowth of E. coli BW25113 cells after 24 h of incubation was observed, despite quercetin and phage treatments.

Fig. 4

Effects of phage S127BCL3 on the viability of E. coli BW25113 cells cultured in the presence of myricetin or quercetin for 6 h. E. coli BW 25113 was incubated in the absence (○, ●)and presence (△, ▲) of 500 µmol/L myricetin or quercetin in LB broth supplemented with 1mM CaCl₂. Phage S127BCL3 (MOI = 1) was added to the culture (●, △) at 6 h of incubation.

The viable counts are represented as mean ± S.D. of duplicate determinations from three separate experiments. Arrowheads indicate the time of phage addition.*, p < 0.05

Similar results are observed for E. coli O157:H7 (Fig. 5). The viable counts of E. coli O157:H7 cells incubated in the presence of 500 µmol/L myricetin was lower by 2.1 and 1.8 log at 9 and 12 h, respectively (at 6 h after phage addition), than those of the cells incubated in the absence of myricetin. Subsequently, the viable cell counts reached the same level as those of the control incubated without myricetin and phages.

Fig. 5

Effects of phage S127 BCL3 on viability of E. coli O157:H7 cultured in the presence of Myricetin or for 6 h. E. coli O157:H7 was incubated in the absence (○, ●) and presence (△, ▲) of 500 µmol/L Myricetin in LB broth supplemented with 1mM CaCl₂. Phage S127 BCL3 (MOI = 1) was added to the culture (●, ▲) at 6 h of incubation.

The viable counts are the mean ± S.D. of three separate experiments. The arrowhead shows the timing of phage addition.*, p < 0.05

Effect of myricetin and quercetin on the transcription level of the chaperone genes of E. coli Fig. 6 shows the effect of myricetin treatment on the transcription level of chaperone genes (dnaK, dnaJ, groEL, and grpE) of E. coli BW25113. After treatment with 500 µmol/L myricetin for 6 h, the transcription of dnaK, dnaJ, groEL, and grpE decreased by 2⁻², 2^−1.6, 2^−1.5, and 2^−0.7-folds, respectively. After the treatment with 500 µmol/L quercetin for 6 h, the transcription of these chaperone genes decreased: dnaK (2^−0.9-fold), dnaJ (2^−0.5-fold), groEL (2^−0.6-fold), and grpE (2^−0.01-fold).

Fig. 6

Effect of myricetin and quercetin on the transcription of chaperone genes of E. coli BW3511. E. coli BW35113 cells were incubated with myricetin or quercetin at 500 µmol/L and 37 °C for 6 h. qPCR analysis was carried out to measure the changes in the transcriptional levels of the chaperone genes. As a control, myricetin was replaced with 1 % DMSO. The transcription levels of the chaperone genes were compared with that of the control without myricetin. All values are represented as means (of three separate experiments) ± standard deviation.

Discussion

Although phage therapy has received increased attention for controlling various bacteria, its application has been hindered by the emergence of phage-resistant bacterial populations. Therefore, our preliminary research focused on controlling phage-resistant bacteria. To identify the genes involved in bacterial phage resistance, phage susceptibilities of single-gene-deficient mutants of E. coli (Keio collection) were examined. As a result of screening, 10 strains (Δrpe, ΔyfcD, Δgor, ΔubiE, ΔyaiW, ΔtolR, ΔtolA, ΔdnaK, ΔpriA, and ΔbcH) of single-gene-deletion mutants were identified to have increased phage sensitivity compared with that of the wildtype strain (manuscript under submission). In the current study, myricetin and quercetin were selected for the pre-treatment of E. coli cells to investigate the effects of the pre-treatment on the susceptibility of E. coli against phage. These polyphenols were selected since it has been reported that myricetin inhibits the cellular function of DnaK (Chang et al., 2011) and quercetin suppresses the expression of heat shock proteins, including DnaK (Lee et al., 1994).

The E. coli cell population resistant against the phage existed in the inoculum and they grew after the population of the phage susceptible cells were killed (Fig. 2–5). We found that the viable counts of E. coli BW25113 cells preincubated with 500 µmol/L myricetin or quercetin decreased by more than 1 log after 9 and 12 h of incubation, compared with those of control cells incubated without polyphenols at 6 h after phage addition. The same result was obtained for the viable counts of E. coli O157:H7 cells preincubated with 500 µmol/L myricetin. To the best of our knowledge, no studies have reported that pre-incubation with flavonoids increased the phage susceptibility of non-pathogenic and pathogenic E. coli. In our study, long pre-incubation time of myricetin more than 6 h was required to reduce phage resistance significantly (Fig. 3). The log of the apparent permeability coefficient value (LogP _app), which is an index of hydrophobicity, is high at 1.23 for myricetin and 1.59 for quercetin, indicating that these polyphenols are highly hydrophobic (Gonzales et al., 2015). Therefore, it is presumed that the rate of uptake of these substances into microbial cells is extremely slow. This may be the reason why myricetin and quercetin required more than 6 h of incubation to function in E. coli cells.

Flavonoids are the most abundant bioactive compounds in plants. Many researchers are now focusing on naturally occurring plant-derived compounds because phytochemicals, including flavonoids, can damage both gram-positive and gram-negative bacteria and affect specific molecular targets essential for the survival of microorganisms. In the current study, we demonstrated the effects of myricetin and quercetin on the transcription levels of chaperone genes in E. coli. The qPCR analysis results showed that the transcription of the chaperone genes was significantly decreased by pretreatment with myricetin and quercetin at 500 µmol/L (Fig. 6). These results were consistent with those reported by Lee et al. (1994). They demonstrated that hsp 70 gene expression was repressed by 20 % in the presence of 50 µmol/L quercetin, whereas 500 µmol/L quercetin caused suppression by 89 %. Even though the transcription of these chaperone genes was decreased by the myricetin and quercetin, the decrease in transcription of these genes at 6 h of incubation with these polyphenols ranged from 2^−0.01-folds to 2⁻²-folds (Fig. 6). Therefore, the transcription level of these genes after the treatment for 6 h was more than 25 % of those of the control without treatment with polyphenols, suggesting that DnaK protein is continuously expressed in E. coli cells. DnaK protein was already expressed and present in the cells before and during the treatment with polyphenols. The increase in the phage sensitivity in the cells pretreated with the polyphenols was thought to be based on the inhibition of the function of the already expressed DnaK protein in the cells. For these reasons, there seems to be no relationship between the decrease in dnaK gene transcription levels of E. coli due to polyphenol pretreatment (Fig. 6) and the increase in phage susceptibility, which is presumed to be based on inhibition of function of the DnaK protein due to polyphenol pretreatment (Fig. 4). Moreover, among the chaperone genes tested, not only their structurally related activity, but also the position, number, and substitution of hydroxyl groups of the B ring and saturation of the C2-C3 bond are the key factors influencing the flavonoid activity on hsp 70 gene expression (Rusak et al., 2002). A recent study by Philippe et al. (2020) reported that quercetin, myricetin, and p-coumaric acid significantly reduced phage predation by Oenococcus oeni by reducing the adsorption rate of phage OE33PA onto the bacterium; however, the killing activity of the distantly related lytic phage Vinitor162 was intact. They proposed that quercetin interacts with the tail of phage OE33PA and competes with host recognition. Contrastingly, our results indicated that 500 µmol/L myricetin or quercetin pretreatment increased the phage susceptibility of E. coli. The amino acid sequence and conformation of the proteins in the tail of phage OE33PA specific to O. oeni differed from those in the tail of phage S127 BCL3. O. oeni is a gram-positive lactic acid bacterium (LAB), and the phage receptors in LAB and several other gram-positive bacteria comprise cell wall motifs or polysaccharides (Philippe et al., 2023). In contrast, in gram-negative bacteria, proteins (such as Omp proteins) are major outer membrane components localized in the outer membrane, and various sites in lipopolysaccharides act as receptors for several bacteriophages (Rakhuba et al., 2010). Together with the fact that myricetin inhibits the cellular function of DnaK (Chang et al., 2011) and quercetin suppresses the expression of heat shock proteins (including DnaK) (Lee et al., 1994), these flavonoids seem to have a high affinity for the amino acid sequences or 3D structures that are common to LAB-specific surface components and DnaK protein. Further investigations are required to clarify the mechanism underlying the increase in the phage susceptibility of E. coli to flavonoid treatment based on the interaction between flavonoids and DnaK.

Conclusion

In conclusion, our findings suggest that flavonoids, such as myricetin and quercetin, can enhance the phage susceptibility of E. coli by suppressing the function of DnaK and transcription of chaperone genes, including dnaK. Although further investigation and additional in vivo experiments are necessary, our findings suggest that the combination of phages with myricetin or quercetin treatment will provide insights into developing an effective approach to control foodborne bacteria.

Acknowledgements This work was supported by JSPS KAKENHI (grant number JP23H02162).

Conflict of interest There are no conflicts of interest to declare.

References

•  Bardina,  C.,  Spricigo,  D.A.,  Cortés,  P., and  Llagostera,  M. (2012). Significance of the bacteriophage treatment schedule in reducing Salmonella colonization of poultry. Appl. Environ. Microbiol., 78, 6600–6607.
•  Cesa,  L.C.,  Patury,  S.,  Komiyama,  T.,  Ahmad,  A.,  Zuiderweg,  E.R.P., and  Gestwicki,  J.E. (2013). Inhibitors of Difficult Protein-Protein Interactions Identified by High-Throughput Screening of Multiprotein Complexes. ACS Chem. Biol. 8, 1988–1997.
•  Chang,  L.,  Miyata,  Y.,  Ung,  P.M.U.,  Bertelsen,  E.B.,  McQuade,  T.J.,  Carlson,  H.A.,  Zuiderweg,  E.R.P., and  Gestwicki,  J.E. (2011). Chemical Screens against a Reconstituted Multiprotein Complex: Myricetin Blocks DnaJ Regulation of DnaK through an Allosteric Mechanism. Chemistry & Biology 18, 210–221.
•  Genevaux,  P.,  Georgopoulos,  C., and  Kelley,  W.L. (2007). The Hsp70 chaperone machines of Escherichia coli: a paradigm for the repartition of chaperone functions. Molecular Microbiology 66, 840–857.
•  Gonzales,  G.B.,  Van Camp,  J.,  Zotti,  M.,  Kobayashi  V.,  Grootaert  C.,  Raes  K.,  Smagghe  G. (2015). Two- and three-dimensional quantitative structure-permeability relationship of flavonoids in Caco-2 cells using stepwise multiple linear regression (SMLR), partial least squares regression (PLSR), and pharmacophore (GALAHAD)-based comparative molecular similarity index analysis (COMSIA). Med Chem Res 24, 1696–1706.
•  Hesterkamp,  T. and  Bukau,  B. (1998). Role of the DnaK and HscA homologs of Hsp70 chaperones in protein folding in E.coli. EMBO J. 17, 4818–4828.
•  Hosokawa,  N.,  Hirayoshi,  K.,  Kudo,  H.,  Takechi,  H.,  Aoike,  A.,  Kawai,  K., and  Nagata,  K. (1992). Inhibition of the activation of heat shock factor in vivo and in vitro by flavonoids. Mol. Cell Biol. 12, 3490–3498.
•  Júnior,  S.D.D.C.,  Santos,  J.V.D.O.,  Campos,  L.A.D.A.,  Pereira,  M.A.,  Magalhäes,  N.S.S., and  Cavalcanti,  I.M.F. (2018). Antibacterial and antibiofilm activities of quercetin against clinical isolates of Staphyloccocus aureus and Staphylococcus saprophyticus with resistance profile. IJEAB 3, 1948–1958.
•  Lee,  Y.J.,  Erdos,  G.,  Hou,  Z.Z.,  Kim,  S.H.,  Kim,  J.H.,  Cho,  J.M., and  Corry,  P.M. (1994). Mechanism of quercetin-induced suppression and delay of heat shock gene expression and thermotolerance development in HT-29 cells. Mol. Cell. Biochem. 137, 141–154.
•  Li,  Y. and  Ding,  Y. (2012). Minireview: Therapeutic potential of myricetin in diabetes mellitus. Food Science and Human Wellness 1, 19–25.
•  Livak,  K.J. and  Schmittgen,  T.D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 25, 402–408.
•  Mayer,  M.P. and  Bukau,  B. (2005). Hsp70 chaperones: Cellular functions and molecular mechanism. Cell. Mol. Life Sci. 62, 670–684.
•  Mayer,  M.P.,  Rüdiger,  S., and  Bukau,  B. (2000). Molecular Basis for Interactions of the DnaK Chaperone with Substrates. Biol. Chem. 381, 877–885.
•  Monk,  A.B.,  Rees,  C.D.,  Barrow,  P.,  Hagens,  S., and  Harper,  D.R. (2010). Bacteriophage applications: where are we now? Lett. Appl. Microbiol. 51, 363–369.
•  Nagai,  N.,  Nakai,  A., and  Nagata,  K. (1995). Quercetin suppresses heat shock response by down regulation of HSF1. Biochem Biophys Res Commun 208, 1099–1105.
•  Ong,  K.C. and  Khoo,  H.E. (1997). Biological effects of myricetin. Gen. Pharmacol. 29, 121–126.
•  Philippe,  C.,  Chaïb,  A.,  Jaomanjaka,  F.,  Cluzet,  S.,  Lagarde,  A.,  Ballestra,  P.,  Decendit,  A.,  Petrel,  M.,  Claisse,  O.,  Goulet,  A.,  Cambillau,  C., and  Le Marrec,  C. (2020). Wine phenolic compounds differently affect the host-killing activity of two lytic bacteriophages infecting the lactic acid bacterium Oenococcus oeni. Viruses 12, 1316.
•  Rakhuba,  D.V.,  Kolomiets,  E.I.,  Dey,  E.S.,  Novik,  G.I. (2010) Bacteriophage receptors, mechanisms of phage adsorption and penetration into host cell. Pol. J. Microbiol. 59, 145–155.
•  Rusak,  G.,  Gutzeit,  H.O., and  Ludwig-Müller,  J. (2002). Effects of Structurally Related Flavonoids on hsp Gene Expression in Human Promyeloid Leukaemia Cells. Food Technol. Biotechnol. 40, 267–273.
•  Sato,  M.,  Murakami,  K.,  Uno,  M.,  Nakagawa,  Y.,  Katayama,  S.,  Akagi,  K.,  Masuda,  Y.,  Takegoshi,  K., and  Irie,  K. (2013). Site-specific inhibitory mechanism for amyloid ß42 aggregation by catechol-type flavonoids targeting the Lys residues. J. Biol. Chem. 288, 23212–23224.
•  Scallan,  E.,  Hoekstra,  R.M.,  Angulo,  F.J.,  Tauxe,  R.V.,  Widdowson,  M.-A.,  Roy,  S.L.,  Jones,  J.L., and  Griffin,  P.M. (2011). Foodborne illness acquired in the United States—Major Pathogens. Emerg. Infect. Dis. 17, 7–15.
•  Wang,  L.,  Qu,  K.,  Li,  X.,  Cao,  Z.,  Wang,  X.,  Li,  Z.,  Song,  Y., and  Xu,  Y. (2017). Use of bacteriophages to control Escherichia coli O157:H7 in domestic ruminants, meat products, and fruits and vegetables. Foodborne Pathog. Dis. 14, 483–493.
• i)  WHO_FOS_15.02_eng.pdf?sequence=1. (August 30, 2021)
• ii)  https://www.fda.gov/food/consumers/what-you-need-know-about-foodborne-illnesses (October 3, 2023)