Full Paper
MAP3K7CL Inhibits the Inflammatory Responses in Goose Fatty Liver
2026 年 63 巻 論文ID: 2026005
詳細
2026 年 63 巻 論文ID: 2026005
Inflammation often accompanies the development of liver diseases in humans, but appears to be repressed in geese. This study investigated the role of MAP3K7 C-terminal-like (MAP3K7CL) in goose fatty liver formation. Sixteen healthy 70-day-old male geese were randomly divided into control and overfed groups. Additionally, the transcriptome analysis after MAP3K7CL overexpression and lipopolysaccharide (LPS) treatment were performed in goose primary hepatocytes. The results showed that the MAP3K7CL mRNA expression was increased in the liver of overfed treatment compared to control group. Overexpression of MAP3K7CL in primary goose hepatocytes identified differentially expressed genes enriched in the mitogen-activated protein kinase (MAPK) signaling pathway. Specifically, DNA damage-inducible transcript 3 (DDIT3), insulin-like growth factor 1 receptor (IGF1R), neurofibromin 1 (NF1), and platelet-derived growth factor subunit B (PDGFB) were significantly downregulated upon MAP3K7CL overexpression, whereas heat shock protein family B member 1 (HSPB1) was significantly upregulated. Furthermore, transfection of goose hepatocytes with the MAP3K7CL overexpression vector lowered the expression of lipopolysaccharide-induced TNF factor (LITAF) and cysteinyl aspartate-specific proteinase-3, which are associated with inflammation and apoptosis, respectively. In accordance with these findings, DDIT3 and LITAF were downregulated in the overfed group, whereas HSPB1 was upregulated. Compared with the control, LPS treatment significantly decreased MAP3K7CL expression, while promoting that of LITAF and interleukin-6 (IL-6). Moreover, the combination of lipopolysaccharide and MAP3K7CL overexpression upregulated MAP3K7CL while downregulating LITAF and IL-6 with respect to LPS alone and empty vector control groups. Therefore, MAP3K7CL may inhibit the inflammatory response in goose fatty liver.
In the wild, migratory birds consume large amounts of food within a brief period prior to migration. This leads to the accumulation of excess adipose tissue in the liver and the formation of fatty liver. During migration, these fat deposits are gradually used up, and the liver reverts to its original state. Typical migratory birds such as geese do not display any pathological symptoms, including cirrhosis or necrosis, during this process[1,2]. Conversely, fatty liver disease in mammals is frequently accompanied by inflammation and fibrosis. In fact, inflammation plays an important role in the onset and progression of most chronic liver diseases, including non-alcoholic fatty liver disease (NAFLD). It can promote fibrosis, cirrhosis, and even hepatocellular carcinoma[3]. Hepatocyte apoptosis, a hallmark of non-alcoholic steatohepatitis (NASH), is prevalent in liver injury and can result in tissue inflammation and fibrosis[4,5]. The pathological sections showed significantly lower inflammation scores in goose fatty liver compared to normal liver[6]. In addition, there was no significant difference in apoptosis levels between normal and fatty liver[7]. These findings point to unique mechanisms preventing inflammation and apoptosis in goose fatty livers.
The mitogen-activated protein kinase (MAPK) signaling pathway is closely related to inflammatory responses and apoptosis. Three important kinases participate in this pathway: extracellular signal-regulated kinases, p38 MAPK, and c-Jun N-terminal kinases. They are involved in cell proliferation, inflammatory responses, and cell death[8]. Inflammation induced by lipopolysaccharide (LPS) relies mainly on p38 MAPK signaling[9]. MAP3K7 C-terminal-like protein (MAP3K7CL) is a paralog of MAP3K7[10,11], a key regulator of the MAPK signaling pathway involved in cell development, survival, and immune response[12,13]. As a homolog of MAP3K7, MAP3K7CL may have a similar function, but its specific physiological role remains unknown. RNA-sequencing of our laboratory has revealed significantly higher expression of MAP3K7CL in goose fatty liver, thereby prompting the present investigation on the role of MAP3K7CL in goose fatty liver formation.
Landes geese used in this study were purchased from the Li Cheng Livestock and Poultry Breeding Company (Huaian, P. R. China). Sixteen 70-day-old healthy male geese with similar body weight (3.83 ± 0.20 kg) were selected and randomly divided into a control and an overfed group, with eight geese per group. All geese were housed individually in single cages and provided with ad libitum water. The geese in the overfeeding treatment group were force-fed using electromechanical feeding equipment, as reported by Zhao et al.[14]. Geese in the control group were fed ad libitum with the same feed. The feed consisted principally of maize supplemented with soybean oil (1%), sodium chloride (1%), and a multivitamin mixture (2 g/kg). The composition and nutrient content of the diet are presented in Table 1. Following 24 days of treatment and 12 h of fasting, six geese were randomly selected from each group. The geese were weighed to calculate body weight gain and then euthanized via carbon dioxide inhalation. The liver was weighed, and fresh liver samples were collected in 1.5-mL RNase-free cryotubes. Following freezing in liquid nitrogen, the samples were stored in an ultra-low-temperature refrigerator at -80°C for subsequent testing. All animal protocols were approved by the Institutional Animal Ethics Committee of Yangzhou University.
| Ingredients (g/kg) | Value |
| Corn | 978.00 |
| Soybean oil | 10.00 |
| Sodium chloride | 10.00 |
| Multivitamin mixture1 | 2.00 |
| Total | 1000.00 |
| Calculated nutrient levels | Value |
| Apparent metabolizable energy (MJ/kg) | 13.54 |
| Crude protein (%) | 7.82 |
| Calcium (%) | 0.02 |
| Available phosphorus (%) | 0.05 |
| Lysine (%) | 0.23 |
| Methionine (%) | 0.17 |
| Arginine (%) | 0.36 |
1The multivitamin mixture contained (per kg of diet): retinyl acetate for vitamin A, 2700 IU; cholecalciferol for vitamin D3, 300 IU; DL-α-tocopheryl acetate for vitamin E, 7 mg; vitamin K, 0.7 mg; thiamin, 0.8 mg; riboflavin, 1.3 mg; niacin, 20 mg; pantothenic acid, 5 mg; pyridoxine, 1 mg; biotin, 0.05 mg; folic acid, 0.15 mg; vitamin B12, 0.007 mg.
Liver tissue samples (1 cm × 1 cm × 1 cm) were immersed in 4% paraformaldehyde (0.1 M, pH 7.4) for 24 h to prepare paraffin sections. Following fixation, tissue samples were dehydrated and embedded in paraffin. The trimmed wax blocks were sliced using a paraffin slicer (RM216; Leica Instruments, Shanghai, P. R. China) to a thickness of 4 μm. Then, the paraffin slices were dewaxed and hydration, stained with hematoxylin and eosin (Servicebio Technology Co., LTD, Wuhan, P. R. China), dehydrated, and sealed. Sections were photographed at 200× magnification using a Nikon Eclipse E100 microscope (Tokyo, Japan) equipped with Nikon DS-U3 imaging software.
Culture of primary goose hepatocytesLandes goose eggs were provided by the National Gene Pool of Waterfowl (Taizhou, P. R. China). The eggs were cleaned, sterilized, and placed in the trays of an automatic incubator. Incubation was conducted in accordance with standard procedures for 23 days, after which primary goose hepatocytes were isolated by collagenase digestion, as reported by Osman et al.[15]. Subsequently, the cells were incubated in 12-well plates at a density of 1 × 106/well and transferred to a cell incubator maintained at 37°C and 5% CO2.
Transfection of primary hepatocytesThe pcDNA3.1/MAP3K7CL expression and empty vectors were supplied by GenePharma Co., Ltd. (Suzhou, P. R. China). The vectors were transfected into goose primary hepatocytes using liposomes. In brief, each well was washed twice with 0.5 mL phosphate-buffered saline (PBS). Thereafter, 800 μL of serum-free Dulbecco’s Modified Eagle Medium was added to each well, and the plate was returned to the cell culture incubator. Solution A, consisting of 96 μL Opti-MEM medium (ThermoFisher Scientific, Waltham, MA, USA) + 4 μL Lipofectamine 2000 (Biosharp, Hefei, P. R. China), and Solution B, consisting of 96 μL Opti-MEM medium + 4 μL MAP3K7CL overexpression vector/empty vector, were prepared separately in autoclaved centrifuge tubes. Solutions A and B were then mixed thoroughly using a vortex and left to stand for 23 min at room temperature. The mixture was added to the culture plate at a volume of 200 μL per well. Following a 6-h incubation, the cells were washed twice with preheated PBS and replenished with complete medium containing serum. The primary hepatocytes were collected after 24 h. Six replicates were used for each treatment.
LPS-treated primary goose hepatocytesHepatocytes were grown in complete culture medium (control group) or exposed to 10 μg/mL LPS for 12 h (LPS group). The same treatment and grouping were applied to hepatocytes transfected with the empty plasmid and MAP3K7CL overexpression plasmid and cultured for 24 h in an incubator. The cells were collected for subsequent assays.
RNA-sequencingSamples from the control and MAP3K7CL overexpression groups were used for RNA-sequencing on an Illumina NovaSeq platform[14]. The reference genome was Anser cygnoides domesticus (AnsCyg_PRJNA183603_v1.0). Differentially expressed genes (DEGs) were defined as exhibiting > 2-fold or < 0.5-fold change of treatment over control and P < 0.05. The clusterProfiler R package (3.4.4) was used to test for enrichment of DEGs in the Kyoto Encyclopedia of Genes and Genomes (KEGG).
RNA extraction, cDNA synthesis, and mRNA expressionTotal RNA from the liver and primary hepatocytes was obtained using TRNzol reagent (Tiangen Biochemical Technology, Beijing, P. R. China). The RNA was reverse-transcribed to cDNA according to the reverse transcription kit (Vazyme Bioscience and Technology, Nanjing, P. R. China). Real-time quantitative PCR was performed using a commercial kit (Vazyme Bioscience and Technology), with reaction conditions previously established by our laboratory[6]. The 2−ΔΔCT method was used to calculate relative mRNA expression abundances. Primer sequences are listed in Table 2.
| Gene | GenBank Number | Primer sequence (5’-3’) | Product size (bp) |
| MAP3K7CL | XM_013192901 | F: CAGCCTCTGCCTCCTTGTC | 226 |
| R: GCTTCAGCGTTCGGTTCTC | |||
| DDIT3 | XM_066985555 | F: TGACTGCACTTATCCCCCTC | 211 |
| R: GTCTCTGATGGCCCTTCCTGT | |||
| FLT4 | XM_048057244 | F: CTGGGACATACACGCTGGTT | 91 |
| R: ATGCGTGGAGGAACGTTGAC | |||
| HSPB1 | XM_048068161 | F: GTGGAGATCACCGGCAAGC | 75 |
| R: GTATTTTCGGGTGAAGCACCG | |||
| IGF1R | XM_067003772 | F: GCACTCCGATGTCTGGTCTTT | 97 |
| R: GCGGAGCACTTGTTCATTGG | |||
| NF1 | XM_066979779 | F: GCAACTTGCCACTCTCTACTG | 108 |
| R: TCCAACTGCTCCAATGCTGT | |||
| PDGFB | XM_048069820 | F: GAGAGACGAAGCCTGGATGC | 290 |
| R: TGATCCTCCAAAGGCACGAC | |||
| IL-6 | XM_048070285 | F: CGACGATAAGGCAGATGGTGATA | 172 |
| R: ACAGCCCTCACGGTTTTCTC | |||
| LITAF | XM_013189514 | F: GTATGTGCAGCAACCCGTAG | 228 |
| R: TGGGCATTGCAATTTGGACA | |||
| Bcl-2 | XM_048076100 | F: TCGTGGCCTTCTTCGAGTTC | 161 |
| R: CTCCACGAAGGCATCCCAG | |||
| Caspase-3 | XM_048078363 | F: TCCCTGGTTCCAAAGGAATGAA | 145 |
| R: AGCCCGGTATCTTTGTGGAA | |||
| Caspase-9 | XM_048067306 | F: GCCTGTGGTGGAGACCAAAA | 133 |
| R: CCGGCTCGTCCATATTACCC | |||
| Fas | XM_048069013 | F: ACCGCTCGTATGTACAGATGTT | 233 |
| R: GGCTGCTTAGTAGGGTTCCA | |||
| GAPDH | XM_067004670 | F: GCCATCAATGATCCCTTCAT | 132 |
| R: CTGGGGTCACGCTCCTG |
MAP3K7CL, MAP3K7 C-terminal like; DDIT3, DNA damage-inducible transcript 3; FLT4, Fms-related receptor tyrosine kinase 4; HSPB1, heat shock protein family B member 1; IGF1R, insulin-like growth factor 1 receptor; NF1, neurofibromin 1; PDGFB, platelet-derived growth factor subunit B; IL-6, interleukin-6; LITAF, lipopolysaccharide-induced TNF factor; Bcl-2, B-cell lymphoma-2; Caspase-3, cysteinyl aspartate-specific proteinase-3; Caspase-9, cysteinyl aspartate-specific proteinase-9; Fas, Fas cell surface death receptor; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.
Data are presented as the mean ± standard error (SE). Data from the control and treatment groups were subjected to an independent-samples t-test. P < 0.01 indicates a highly significant difference; P < 0.05 indicates a significant difference.
Compared to the control group, goose fatty liver showed severe lipid deposition by hematoxylin and eosin staining (Fig. 1A, B). Geese in the overfed group exhibited higher body and liver weight gain than those in the control group (P < 0.05; Fig. 1C, D), along with higher MAP3K7CL mRNA expression (Fig. 1E).
Effect of overfeeding on goose liver physiology. (A, B) Hematoxylin and eosin staining of liver tissue from normally fed control geese (A) and geese subjected to 24 days of overfeeding (B). (C) Body weight gain in control and overfed geese. (D) Liver weight gain in control and overfed geese. (E) MAP3K7 C-terminal like (MAP3K7CL) mRNA expression in the liver of control and overfed geese. **P < 0.01. Data represent the mean ± SE (n = 6).
Transcriptome analysis identified 2574 DEGs upon MAP3K7CL overexpression, of which 1571 were upregulated, and 1003 were downregulated. KEGG pathway analysis of upregulated DEGs revealed enrichment in drug metabolism-cytochrome P450, metabolism of xenobiotics by cytochrome P450, tryptophan metabolism, peroxisome, glutathione metabolism, cytokine-cytokine receptor interaction, and the peroxisome proliferator-activated receptor (PPAR) signaling pathway (Fig. 2A). In contrast, downregulated DEGs were enriched in cell adhesion molecules, extracellular matrix-receptor interactions, tight junctions, arachidonic acid metabolism, ether lipid metabolism, linoleic acid metabolism, and MAPK signaling pathways (Fig. 2B).
KEGG analysis in goose hepatocytes overexpressing MAP3K7CL. (A) Pathways enriched in upregulated DEGs. (B) Pathways enriched in downregulated DEGs. Hepatocytes transfected with empty pcDNA3.1(+) vector served as the control group; those transfected with pcDNA3.1(+) containing the goose MAP3K7CL coding sequence represented the overexpression treatment. DEGs were identified by DESeq software as exhibiting > 2 fold or < 0.5 fold change of treatment over control and P < 0.05. Statistical enrichment of DEGs was confirmed by the clusterProfiler R package (3.4.4).
MAP3K7CL mRNA expression was dramatically elevated in primary hepatocytes transfected with the pcDNA3.1/MAP3K7CL vector compared to controls. Several important genes identified by RNA sequencing as being enriched in the MAPK signaling pathway were selected for validation. The mRNA levels of DNA damage-inducible transcript 3 (DDIT3), insulin-like growth factor 1 receptor (IGF1R), neurofibromin 1 (NF1), and platelet-derived growth factor subunit B (PDGFB) were significantly decreased, whereas those of heat shock protein family B member 1 (HSPB1) were significantly increased in cells transfected with the MAP3K7CL overexpression vector (P < 0.05, Fig. 3).
Effect of MAP3K7 C-terminal like (MAP3K7CL) overexpression on genes in the MAPK pathway.*P < 0.05, **P < 0.01. Data represent the mean ± SE (n = 6). DDIT3, DNA damage-inducible transcript 3; FLT4, Fms-related receptor tyrosine kinase 4; HSPB1, heat shock protein family B member 1; IGF1R, insulin-like growth factor 1 receptor; NF1, neurofibromin 1; PDGFB, platelet-derived growth factor subunit B.
Compared to the control treatment, MAP3K7CL overexpression lowered LPS-induced TNF factor (LITAF) and cysteinyl aspartate-specific proteinase-3 (Caspase-3) expression (P < 0.05, Fig. 4).
Effect of MAP3K7CL overexpression on inflammation- and apoptosis-related genes.*P < 0.05, **P < 0.01. Data represent the mean ± SE (n = 6). IL-6, interleukin-6; LITAF, lipopolysaccharide-induced TNF factor; Bcl-2, B-cell lymphoma-2; Caspase-3, cysteinyl aspartate-specific proteinase-3; Caspase-9, cysteinyl aspartate-specific proteinase-9; Fas, Fas cell surface death receptor.
Compared to the control group, overfed geese showed significant downregulation of DDIT3 (P < 0.01, Fig. 5A) and LITAF (P < 0.01, Fig. 5C), but upregulation of HSPB1 (P < 0.01, Fig. 5B).
Effect of overfeeding on mRNA expression of key genes in the goose liver. (A) DDIT3, (B) HSPB1, (C) LITAF, and (D) Caspase-3. Geese in the overfed group were subjected to 24 days of overfeeding, while those in the control group had free access to the same feed. *P < 0.05, **P < 0.01. Data represent the mean ± SE (n = 6). DDIT3, DNA damage-inducible transcript 3; HSPB1, heat shock protein family B member 1; LITAF, lipopolysaccharide-induced TNF factor; Caspase-3, cysteinyl aspartate-specific proteinase-3.
Compared to the control group, LPS treatment significantly decreased MAP3K7CL expression, while increasing the levels of LITAF and interleukin-6 (IL-6; P < 0.01, Fig. 6A–C). In contrast, the combination of LPS and MAP3K7CL overexpression resulted in a substantial increase in MAP3K7CL (P < 0.01, Fig. 6D), but a notable reduction in LITAF and IL-6 (P < 0.01, Fig. 6E, F) when compared to the LPS and empty vector control groups.
Effect of MAP3K7 C-terminal like (MAP3K7CL) overexpression on inflammation-related genes induced by lipopolysaccharide (LPS). (A–C) Hepatocytes treated for 12 h with 10 μg/mL LPS (LPS group) or complete culture medium (control group). (D–F) Hepatocytes transfected with empty pcDNA3.1(+) vector and then treated with 10 μg/mL LPS for 12 h (LPS+EV group) or transfected with pcDNA3.1(+) containing the goose MAP3K7CL coding sequence and then treated with PBS (LPS+OE group). **P < 0.01. Data represent the mean ± SE (n = 6). IL-6, interleukin-6; LITAF, lipopolysaccharide-induced TNF factor.
Successful induction of the goose fatty liver model was confirmed by an approximately 10-fold increase in liver weight, as well as extensive vacuolization and steatosis in the overfed group compared to controls. Expression of the MAP3K7CL gene was significantly higher in the overfed group than in the control group, suggesting a role in fatty liver formation. To confirm this hypothesis, we overexpressed the MAP3K7CL gene in primary goose hepatocytes and performed transcriptome sequencing. KEGG pathway analysis of DEGs identified enrichment in the PPAR signaling pathway, cytokine-cytokine receptor interaction, arachidonic acid metabolism, ether lipid metabolism, linoleic acid metabolism, and the MAPK signaling pathway in response to MAP3K7CL overexpression. The PPAR signaling pathway is closely related to insulin sensitivity, as well as glucose and lipid metabolism[16]. Arachidonic acid, ether lipid, and linoleic acid metabolism are interconnected pathways integral to lipid metabolism[17]. Cytokine-cytokine receptor interactions play a central role in the onset and progression of NAFLD, and act as key drivers of the progression from simple hepatic steatosis to inflammation, fibrosis, cirrhosis, and hepatocellular carcinoma[18]. Moreover, the MAPK signaling pathway is associated with inflammatory responses and apoptotic processes[19,20]. Collectively, transcriptome sequencing suggested that the pathways affected by MAP3K7CL overexpression were primarily related to lipid metabolism, inflammatory responses, apoptosis, and immune responses. Therefore, MAP3K7CL may contribute to fatty liver formation by modulating all these pathways.
The inflammatory response is suppressed in goose fatty liver, but not in healthy tissue[6]. This aligns with our histological observations and those of other studies[2,21] showing no significant pathological damage in overfed geese. The MAPK signaling pathway is pivotal for converting extracellular signals into intracellular ones, and plays a crucial role in the regulation of cell growth, survival, differentiation, apoptosis, and migration[19,20]. Furthermore, this pathway is critically involved in the development of fatty liver disease. In alcoholic liver disease, activation of the MAPK pathway can induce the production of pro- or anti-inflammatory cytokines, thereby contributing to liver injury[22]. Furthermore, activation of MAPK signaling has been implicated in the modulation of the hepatocyte proliferative response, cell cycle, and collagen synthesis, which in turn influences the fibrotic process[23]. In the present study, we selected several DEGs enriched in the MAPK signaling pathway for further validation. Overexpression of MAP3K7CL in primary goose hepatocytes significantly downregulated DDIT3, IGF1R, NF1, and PDGFB, while significantly upregulating HSPB1. PDGFB is enriched in the extracellular membrane. Zhang et al.[24] found that expression of PDGFB in the rat liver was significantly higher in a dimethylnitrosamine-induced hepatic fibrosis model than in the control, suggesting that PDGFB may be important in the pathogenesis of hepatic fibrosis. Expression of IGF1R was found to be increased in patients with chronic liver disease, which in turn regulated hepatocyte apoptosis[25]. NF1 is associated with the MAPK signaling pathway, which regulates processes such as cell proliferation and can lead to the aberrant multiplication of hepatocellular carcinoma cells[26]. Here, DDIT3 was downregulated in both goose fatty liver and in primary goose hepatocytes transfected with a MAP3K7CL overexpression vector. DDIT3 is a key marker of endoplasmic reticulum stress[27]. Willy et al.[28] reported that DDIT3 triggered inflammation and death in human hepatocytes. Moreover, DDIT3 has been identified as a contributing factor in the progression of NASH to hepatocellular carcinoma[29,30]. Therefore, MAP3K7CL may influence goose fatty liver formation by modulating genes in the MAPK pathway, and inhibit the inflammatory response by downregulating the expression of DDIT3 once the fatty liver is formed.
During fatty liver pathogenesis, excessive intake of sugars and lipids leads to fat accumulation in the liver, causing accelerated beta oxidation and increased production of reactive oxygen species. The latter can induce oxidative stress, which promotes the release of inflammatory mediators and enhances the expression of various pro-apoptotic factors. Consequently, this cascade may lead to inflammation, apoptosis, and necrosis of hepatocytes[31]. Apoptosis is a form of programmed cell death that facilitates the removal of senescent and damaged hepatocytes and contributes to the maintenance of liver function. However, excessive apoptosis has the potential to induce liver damage[32]. Effective anti-apoptotic therapy has been shown to prevent the development of inflammation and fibrosis in NASH[33,34]. Therefore, oxidative stress and apoptosis are important factors in the development and progression of NAFLD. In the present study, no significant difference in Caspase-3 mRNA expression was detected in the liver of control and overfed groups. This result is consistent with observations reported by Sun et al.[7], suggesting that goose fatty liver can resist the induction of apoptosis by high steatosis. One study reported growing liver weight but no sign of apoptosis within the first ten days of overfeeding in ducks; only the final stages of forced feeding were associated with the onset of apoptosis[35]. Xing et al.[36] observed rising levels of apoptotic markers in a fatty liver model in laying hens. Despite the short-term force-feeding regimen used to induce fatty liver in waterfowl, both geese and ducks maintained a low degree of apoptosis in the early stages despite high lipid accumulation. This indicates that waterfowl, particularly geese, possess anti-apoptotic mechanisms in fatty liver. The significant downregulation of Caspase-3 after MAP3K7CL overexpression in goose primary hepatocytes observed here suggests that MAP3K7CL may inhibit apoptosis in goose fatty liver. HSPB1 can protect cells from damage caused by adverse environmental conditions, such as heat shock, endotoxin shock, apoptosis, and oxidative stress[37,38]. Aloy et al.[39] demonstrated that reduced HSPB1 expression exacerbated cellular stress and promoted apoptosis. Our results reveal significant upregulation of HSPB1 in goose fatty liver, as well as in hepatocytes after transfection with the MAP3K7CL overexpression vector. Consequently, MAP3K7CL may play a regulatory role in apoptosis and oxidative stress by stimulating HSPB1 expression in goose fatty liver.
Tumor necrosis factor alpha (TNF-α) is a pro-inflammatory cytokine that promotes cell death by binding to the receptor TNFR1 and activating the mitochondrial pathway[40]. Crespo et al.[41] reported significant upregulation of TNF-α in the liver of NASH patients as the disease progressed. LITAF is an important transcription factor that induces the expression of TNF-α, but also participates in apoptosis and inflammation[42]. In the present study, LITAF was downregulated in the fatty liver of geese, consistent with the results reported by Xue et al.[21]. Furthermore, LITAF expression was markedly reduced following overexpression of MAP3K7CL in primary goose hepatocytes. To further investigate the modulation of inflammation, we treated primary goose hepatocytes with LPS to establish an inflammatory model. Our results showed that LPS elevated the levels of LITAF and IL-6 in goose primary hepatocytes. Conversely, LITAF and IL-6 were downregulated upon joint LPS and MAP3K7CL overexpression treatment. Interestingly, overexpression of MAP3K7CL in healthy hepatocytes did not significantly alter IL-6 expression. This suggests that MAP3K7CL plays a critical role in suppressing inflammation when hepatocytes are exposed to stress. As mentioned previously, the formation of goose fatty liver is influenced by lipid metabolism imbalance, oxidative stress, and inflammation. Hence, MAP3K7CL may exert a suppressive effect on the inflammatory response in goose fatty liver. Ning et al.[43] established a duck fatty liver model by overfeeding ducks with a corn-based diet for 21 days, which led to the absence of adipose inflammation and hepatic fibrosis. This outcome differs markedly from fatty liver in chickens, which is often accompanied by lipid accumulation, oxidative stress, and inflammatory responses[44], further suggesting the uniqueness of fatty liver in waterfowl. Additional research is required to elucidate the anti-inflammatory mechanisms in waterfowl fatty liver.
In summary, MAP3K7CL may inhibit inflammatory responses and apoptosis in goose fatty liver by modulating the expression of key genes in the MAPK signaling pathway, especially DDIT3 and HSPB1.
This work was supported by the National Key Research and Development Program Project under Grant number 2024YFF1000900 and the National Natural Science Foundation of China under Grant numbers 32472895 and 32172756.
Minmeng Zhao, Jiahui Li, and Xiang Fan conducted the experiments and analyzed the data; Minmeng Zhao, Daoqing Gong, and Yihui Zhang designed the experiments; Minmeng Zhao, Long Liu, and Mengqing Lv wrote and revised the manuscript. All the authors have read and approved the manuscript for publication.
The authors report no conflicts of interest.
