Levosimendan, a novel agent developed for the treatment of acute and decompensated heart failure, exerts potent positive inotropic action and peripheral vasodilatory effects. The mechanism of vasodilation by levosimendan may involve reduction of Ca²⁺ sensitivity of contractile proteins in vascular smooth muscle, the lowering of intracellular free Ca²⁺, the potential inhibition of phosphodiesterase (PDE) III, and an opening of K⁺ channels. Although the importance and relative contribution of each of these mechanisms of vasorelaxation is unclear and may be different in various vessels and dependent on the dose of levosimendan, the important roles of K⁺-channel opening and Ca²⁺ desensitization in vascular smooth muscle are obvious, whereas the role of PDE inhibition remains to be defined. This review article briefly discusses the current research data on the mechanism of levosimendan-induced vasodilation with an emphasis on the types of the blood vessels and the K⁺ channels. It also summarizes the current experimental and clinical knowledge of the use of levosimedan in the treatment of heart failure.

View full abstract

Seven or fourteen days or twelve months after suturing one tube into the pyloric sphincter (removed by peristalsis by the seventh day), rats exhibit prolonged esophagitis with a constantly lowered pressure not only in the pyloric, but also in the lower esophageal sphincter and a failure of both sphincters. Throughout the esophagitis experiment, gastric pentadecapeptide BPC 157 (PL 14736) is given intraperitoneally once a day (10 μg/kg, 10 ng/kg, last application 24 h before assessment), or continuously in drinking water at 0.16 μg/ml, 0.16 ng/ml (12 ml/rat per day), or directly into the stomach 5 min before pressure assessment (a water manometer connected to the drainage port of a Foley catheter implanted into the stomach either through an esophageal or duodenal incision). This treatment alleviates i) the esophagitis (macroscopically and microscopically, at either region or interval), ii) the pressure in the pyloric sphincter, and iii) the pressure in the lower esophageal sphincter (cmH₂O). In the normal rats it increases lower esophageal sphincter pressure, but decreases the pyloric sphincter pressure. Ranitidine, given using the same protocol (50 mg/kg, intraperitoneally, once daily; 0.83 mg/ml in drinking water; 50 mg/kg directly into the stomach) does not have an effect in either rats with esophagitis or in normal rats.

View full abstract

Cinnamaldehyde derivatives isolated from Cinnamomum cassia have been widely used for treating dyspepsia, gastritis, and inflammatory disease as well as cancer. To investigate the anti-tumor activities of several cinnamaldehyde derivatives, we compared the inhibitory effect of cinnamaldehyde derivatives on cell growth and AP-1 transcriptional activity in SW620 human colon cancer cells since AP-1 is a transcriptional factor implicated to control cancer cell growth. Among the derivatives, 2'-hydroxycinnamaldehyde (HCA) most significantly inhibited cancer cell growth and AP-1 transcriptional activity in a dose-dependent manner with an IC₅₀ value of 12.5 and 9 μg/ml, respectively. In further studies on the mechanism, we found that consistent with the inhibitory effect on cell growth, HCA dose-dependently (0 – 20 μg/ml) inhibited DNA binding activity of AP-1 accompanied with down regulation of c-Jun and c-Fos expressions. HCA also induced apoptotic cell death as well as expression of the apoptosis-regulating gene caspase-3, but inhibited the anti-apoptosis regulating gene bcl-2 in a dose-dependent manner. These results suggested that HCA has the most potent inhibitory effect against human colon cancer cell growth, and AP-1 may be an important target of HCA.

View full abstract

E3024 (3-but-2-ynyl-5-methyl-2-piperazin-1-yl-3,5-dihydro-4H-imidazo[4,5-d]pyridazin-4-one tosylate) is a dipeptidyl peptidase IV (DPP-IV) inhibitor. Since the target of both DPP-IV inhibitors and α-glucosidase inhibitors is the lowering of postprandial hyperglycemia, we compared antihyperglycemic effects for E3024 and α-glucosidase inhibitors in various oral carbohydrate and meal tolerance tests using normal mice. In addition, we investigated the combination effects of E3024 and voglibose on blood glucose levels in a meal tolerance test using mice fed a high-fat diet. ER-235516-15 (the trifluoroacetate salt form of E3024, 1 mg/kg) lowered glucose excursions consistently, regardless of the kind of carbohydrate loaded. However, the efficacy of acarbose (10 mg/kg) and of voglibose (0.1 mg/kg) varied with the type of carbohydrate administered. The combination of E3024 (3 mg/kg) and voglibose (0.3 mg/kg) improved glucose tolerance additively, with the highest plasma active glucagon-like peptide-1 levels. This study shows that compared to α-glucosidase inhibitors, DPP-IV inhibitors may have more consistent efficacy to reduce postprandial hyperglycemia, independent of the types of carbohydrate contained in a meal, and that the combination of a DPP-IV inhibitor and an α-glucosidase inhibitor is expected to be a promising option for lowering postprandial hyperglycemia.

View full abstract

Intrathecal (i.t.) administration of D-cycloserine (100 and 300 fmol), a partial agonist of the glycine recognition site on the N-methyl-D-aspartate (NMDA) receptor ion-channel complex, produced a behavioral response mainly consisting of biting and/or licking of the hindpaw and the tail along with slight hindlimb scratching directed toward the flank in mice, which peaked at 5 – 10 min and almost disappeared at 15 min after the injection. The behavior induced by D-cycloserine (300 fmol) was dose-dependently inhibited by an intraperitoneal injection of morphine (0.5 – 2 mg/kg), suggesting that the behavioral response is related to nociception. The nociceptive behavior was also dose-dependently inhibited by i.t. co-administration of 7-chlorokynurenic acid (0.25 – 4 nmol), a competitive antagonist of the glycine recognition site on the NMDA receptor ion-channel complex; D-(−)-2-amino-5-phosphonovaleric acid (62.5 – 500 pmol), a competitive NMDA receptor antagonist; MK-801 (62.5 – 500 pmol), an NMDA ion-channel blocker; ifenprodil (0.5 – 8 nmol); arcaine (31 – 125 pmol); and agmatine (0.1 – 10 pmol), all being antagonists of the polyamine recognition site on the NMDA receptor ion-channel complex. However, [D-Phe⁷,D-His⁹]-substance P(6 – 11), a specific antagonist for substance P (NK1) receptors, and MEN-10,376, a tachykinin NK2-receptor antagonist, had no effect on D-cycloserine-induced nociceptive behavior. These results in the mouse spinal cord suggest that D-cycloserine-induced nociceptive behavior is mediated through the activation of the NMDA receptor ion-channel complex by acting on the glycine recognition site and that it does not involve the tachykinin receptor mechanism.

View full abstract

Amyloid β (Aβ) toxicity has been implicated in cell death in the hippocampus, but its specific mechanisms are poorly understood. In this study, Aβ-induced cell death was investigated in organotypic hippocampal slice cultures (OHCs) that were cultured for various periods in vitro. There were no obvious histological differences among slices cultured for 3 to 7 weeks in vitro. Although there was little neurotoxicity after treatment with Aβ_25–35 in OHCs cultured for relatively shorter periods (3 – 5 weeks), age-dependent cell death was evident in OHCs cultured for relatively longer periods (6 – 7 weeks) after exposure to Aβ_25–35. In OHCs cultured for 7 weeks, S-allyl-L-cysteine (SAC), a component of aged garlic extract, protected the cells in areas CA1 and CA3 and the dentate gyrus from Aβ_25–35-induced toxicity. The immunoreactivity of cleaved caspase-12 was increased whereas that of glucose-regulated protein 78 was not altered after exposure to Aβ_25–35. The increases in the cleaved caspase-12 were also reversed by simultaneously applied SAC. These results suggest that OHCs cultured for relatively longer periods are more susceptible to Aβ-induced toxicity and that the Aβ-induced cell death involves caspase-12-dependent pathways. It is also suggested that SAC is able to protect against the Aβ-induced neuronal cell death through the inhibition of the caspase-12-dependent pathway.

View full abstract

The changes of electromyographic activity (EMG seizure) induced by maximal electroshock were studied in comparison with those of behavioral seizures in mice. In addition, the effects of certain antiepileptics on behavioral seizures and EMG seizure induced by maximal electroshock were also studied. High amplitude with high frequency EMG seizure was observed in parallel with the appearance of tonic extensor (TE) seizure and an intimate relationship was observed between the two parameters. On the other hand, to investigate the intensity of TE seizure, the product of the amplitude and the duration in EMG seizure was calculated, and the effects of antiepileptics on the magnitude of EMG seizure were investigated. As a result, a significant difference was observed at the doses of antiepileptics that showed no significant effects on the durations of TE and EMG seizures; that is, phenytoin, phenobarbital, topiramate, and carbamazepine showed significant effects on the magnitude of EMG seizure at doses of 5, 2, 10, and 5 mg/kg, respectively. From these findings, it may be concluded that this index, that is, the magnitude of EMG seizure induced by maximal electroshock, is a more reliable and highly sensitive method for the assessment of the potential activity of antiepileptics.

View full abstract

Desipramine (DP) is a tricyclic antidepressant used for treating depression and numerous other psychiatric disorders. Recent studies have shown that DP can promote neurogenesis and improve the survival rate of hippocampal neurons. However, whether DP induces neuroprotection or promotes the differentiation of neural stem cells (NSCs) needs to be elucidated. In this study, we cultured NSCs derived from the hippocampal tissues of adult rats as an in vitro model to evaluate the modulation effect of DP on NSCs. First, we demonstrated that the expression of Bcl-2 mRNA and nestin in 2 μM DP-treated NSCs were up-regulated and detected by real-time reverse transcriptase polymerase chain reaction (RT-PCR). The results of Western blotting and immunofluorescent study confirmed that Bcl-2 protein expression was significantly increased in Day 3 DP-treated NSCs. Using the Bcl-2 small interfering RNA (siRNA) method, our results further showed that DP protects the lipopolysaccharide (LPS)-induced apoptosis in NSCs, in part by activating the expression of Bcl-2. Furthermore, DP treatment significantly inhibited the induction of proinflammatory factor interleukin (IL)-1β, IL-6, and tumor necrosis factor-α in the culture medium of LPS-treated NSCs mediated by Bcl-2 modulation. The results of high performance liquid chromatography coupled to electrochemical detection further confirmed that DP significantly increased the functional production of serotonin (26 ± 3.5 μM, DP-treated 96 h) and noradrenaline (50 ± 8.9 μM, DP-treated 96 h) in NSCs through activation of the MAPK/ERK pathway and partially mediated by Bcl-2. In conclusion, the present results indicate that DP can increase neuroprotection ability by inhibiting the LPS-induced inflammatory process in NSCs via the modulation of Bcl-2 expression, as confirmed by the siRNA method.

View full abstract

Neurodegenerative brain disorders such as Alzheimer’s disease (AD) have been well investigated. However, significant methods for the treatment of the promotion and progression of AD are unavailable to date. Recent studies suggested that the redox imbalance and the accumulation of amyloid-β (Aβ) peptide occurring in the brain of AD patients lead to oxidatively-induced apoptotic cell death. Here, we show the effects of Shengmai-san (SMS) on Aβ-induced cytotoxicity in PC-12 cells. SMS dose-dependently attenuated the cytotoxicity by Aβ incubation and also prevented the morphological damage in neurites of the PC-12 cells. Hemeoxygenase-1 and glutathione peroxidase-1 expressions were increased by SMS pretreatment. SMS decreased the phosphorylation level of c-jun amino-terminal kinase (JNK) and the activity of caspase-3, which were enhanced by Aβ incubation. Of importance, SMS treatment promoted neurite outgrowth. These data demonstrated dual roles of SMS in PC-12 cells. SMS prevents the apoptosis through the enhancement of anti-oxidant enzymes and inhibition of the JNK signaling pathway with the promotion of nerve cell maturation, thus suggesting benefits of SMS for the treating of neurodegenerative diseases. It may also be beneficial not only for the treatment of brain disorders but also for other diseases caused by oxidative stress.

View full abstract

To find a more potent alternative with less estrogen-related side effects for hormone replacement therapy, we designed and synthesized a nitric oxide (NO)-releasing prodrug of genistein, named NO-donating genistein (NO-G). The characteristics of NO-G were determined by melting point, NMR spectroscopy, and mass spectrometric analysis. HPLC has been used to test the new prodrug’s stability. The releasing capacity of NO-G was tested by Griess reagent in vitro. The bioactivities of NO-G on proliferation, differentiation, and mineralization of the osteoblastic cell line MC3T3-E1 were determined by MTT assay, flow cytometric analysis, measurement of the alkaline phosphatase (ALP) activity and the secreted osteocalcin (OCN), and Alizarin Red-S staining. The product showed ¹H NMR spectra and relative molecular mass in agreement with the designed structure, and it was stable in buffer solution. NO-G continually released low level NO within 5 h in MC3T3-E1 cells. NO-G caused a significant elevation of cell growth, ALP activity, and OCN secretion in both dose- and time-dependent manner. Furthermore, the Alizarin Red-S staining showed that NO-G promoted mineralization of MC3T3-E1 cells. These effects were all significantly greater than those of its parent drugs. The results suggested that NO-G might be a novel drug for the treatment of postmenopausal osteoporosis.

View full abstract

Extracellular cGMP in the striatum of rats exposed to 3000 ppm carbon monoxide (CO) or 8% O₂ was decreased during the early period of exposure. Thereafter, extracellular cGMP in rats exposed to CO, but not 8% O₂, was transiently increased. A nitric oxide (NO) synthase inhibitor, N^G-nitro-L-arginine, strongly reduced the steady-state level of extracellular cGMP in the striatum, indicating a primary role of NO in cGMP production. However, it failed to suppress the CO-induced increase in extracellular cGMP in the striatum. These findings suggest that CO may stimulate cGMP production in rat striatum independently of NO and hypoxia.

View full abstract

Small-conductance Ca²⁺-activated K⁺ (SK2) channel plays an important role in the activation of Jurkat T-lymphocytes by maintaining electrical gradients for the sustained Ca²⁺ influx. Apamin-sensitive K⁺ current was significantly decreased with cell-cycle progression from G₀/G₁ into G₂/M phases, and protein expression of SK2 channels showed parallel down-regulation, with its highest expression at early G₀/G₁ phase. In the G₀/G₁ phase, the apamin-sensitive component of thapsigargin-induced Ca²⁺ influx was significantly larger than that in the G₂/M phase. These observations suggest that SK2-channel activation may largely contribute to the sustained Ca²⁺ influx in the G₀/G₁ phase in comparison of that in the G₂/M phase in Jurkat T-lymphocytes.

View full abstract

Effects of a free radical scavenger, edaravone (3-methyl-1-phenyl-2-pyrazolin-5-one), on ischemia/reperfusion-induced dysfunctions of rat striatal dopaminergic neurons were examined using in vivo brain microdialysis. During transient forebrain ischemia, dopamine levels in dialysates were elevated 140-fold above controls but rapidly recovered after reperfusion. The increase in dopamine levels induced by high K⁺ stimulation after reperfusion was far smaller than that of the controls. Pretreatment with edaravone but not post-treatment dose-dependently improved the response to high K⁺ but not the massive dopamine increase during ischemia. These results suggest that free radicals produced during ischemia play more important roles in ischemia/reperfusion-induced dysfunctions of dopaminergic neurons.

View full abstract

ATP-receptor (P2Y) stimulation induced sustained Ca²⁺-entry, which was essential for the enhanced cell-proliferation in t-BBEC117, an immortalized cell-line derived from bovine brain endothelial cells. Application of Ca²⁺ following store-depletion with thapsigargin in Ca²⁺-free solution induced Ca²⁺-entry through store-operated channels (SOCs). Ca²⁺-entry induced by ATP or 1-oleoyl-2-acetyl-sn-glycerol (OAG) together with Ca²⁺ was significantly larger than that by Ca²⁺ alone, suggesting the involvement of receptor-operated channels (ROCs) in the Ca²⁺-entry. Results obtained using pharmacological tools suggest that the contribution of Ca²⁺ sources to ATP-induced [Ca²⁺]_i rise in t-BBEC117 is estimated as approximately 2:1:2 for Ca²⁺-release and Ca²⁺-entry though SOCs and ROCs, respectively.

View full abstract

Wrong:Oligonucleotide primer pairs specific for the respective TRP isoforms were as follows: TRPC6F: GGCCTCATGATTATTTCTGCAAGT and TRPC6R: GCCTTCAAATCTGTCAGCTGCA, TRPM4F: GTATGCCAACTGGCTGGTGGT and TRPM4R: GTCCACCTTCTGGGACGTGC, TRPV4F: CCCCCATCCTCAAAGTCTTCAA and TRPV4R: GGGCAGCTCCCCAAAGTAGAA.
Right:Oligonucleotide primer pairs specific for the respective TRP isoforms were as follows: TRPC6F: CATCCCAGTGGTGCGGAAGA and TRPC6R: GCCTTCAAATCTGTCAGCTGCA, TRPM4F: GTCATCGTGAGCAAGATGATGAA and TRPM4R: GTCCACCTTCTGGGACGTGC, TRPV4F: GTGCCTGGGCCCAAGAAA and TRPV4R: GGGCAGCTCCCCAAAGTAGAA. For nested PCR, each of the forward primers was changed from that used in the initial PCR, and the sequences of the nested forward primers were as follows: TRPC6NF: GGCCTCATGATTATTTCTGCAAGT, TRPM4NF: GTATGCCAACTGGCTGGTGGT, and TRPV4NF: CCCCCATCCTCAAAGTCTTCAA.

View full abstract