Prevention of Postoperative Fatigue Syndrome in Rat Model by Ginsenoside Rb1 via Down-Regulation of Inflammation along the NMDA Receptor Pathway in the Hippocampus

Abstract

Postoperative fatigue syndrome (POFS) is a common complication which decelerates recovery after surgery. The present study investigated the anti-fatigue effect of ginsenoside Rb1 (GRb1) through the inflammatory cytokine-mediated N-methyl-D-aspartate (NMDA) receptor pathway. A POFS rat model was created by major small intestinal resection and assessed with an open field test. Real-time quantitative polymerase chain reaction, western blot analysis, high performance liquid chromatography and a transmission electron microscopic analysis were used to determine typical biochemical parameters in the hippocampus. Our results showed that POFS rats exhibited fatigue associated with an increased expression of inflammatory cytokines and NMDA receptor 1, higher (kynurenine)/(tryptophan) and (kynurenine)/(kynurenic acid) on postoperative days 1 and 3, and an increased expression of indoleamine 2,3-dioxygenase (IDO) on postoperative day 1. Degenerated neurons were found in the hippocampus of POFS rats. The NMDA receptor antagonist MK801 had a significant effect on central fatigue on postoperative day 1. GRb1 had no effect on IDO or tryptophan metabolism, but exhibited a significant effect on POFS by inhibiting the expression of inflammatory cytokines and NMDA receptor 1. These data suggested that inflammatory cytokines could activate tryptophan metabolism to cause POFS through the NMDA receptor pathway. GRb1 had an anti-fatigue effect on POFS by reducing inflammatory cytokines and NMDA receptors.

Ginseng is the dried root of Panax ginseng C. A. MEYER (Araliaceae) which has been known as one of the most widely recognized traditional Chinese medicines and used in many diseases for thousands of years. Ginsenosides are the major biological active ingredients of ginseng. It has been reported that many different types of ginsenosides have a wide range of therapeutic and pharmacological actions.¹⁾ Accumulating evidence indicates that ginsenoside Rb1 (GRb1), one of the ginsenosides, provides diverse benefits against inflammation, fatigue and oxidation.^2–4)

Postoperative fatigue syndrome (POFS) is a series of clinical symptoms which decelerates recovery after major abdominal or cardiac surgery.^5–7) POFS can be divided into peripheral fatigue and central fatigue, the former manifests itself as the decline of skeletal muscle motor function; the latter mainly shows up as the changes of spirit and mood state. POFS reduces the quality of life after surgery, increases medical costs, has a great influence on patients, their families, hospitals even society.⁸⁾ Unfortunately, there is not a full explanation to the etiology of POFS, even its central mechanism. There are few effective interventions to improve POFS because of its unclear mechanism.

As is playing an important role in neurons cellular plasticity, learning and memory processes,⁹⁾ N-methyl-D-aspartate (NMDA) receptor has been associated with the pathophysiology of a variety of neurological and psychiatric diseases such as major depression, anxiety, chronic pain syndrome, Alzheimer’s disease, Parkinson’s disease and Huntington’s disease.^10–13) NMDA receptor-mediated neuro-transmission is one of the etiologies of stress-related cognitive impairment and behavioral abnormalities.¹⁴⁾ Severe stress response will release large amounts of glutamate to excessively activate NMDA receptor, and then neurons will be damaged to the death with intracellular calcium overload, finally produces neuro-toxicity.^15,16) Indoleamine 2,3-dioxygenase (IDO) widely exists in the brain endothelial cells, astrocytes and microglia cells, which is activated by inflammatory cytokines such as interleukins-1β (IL-1β), tumor necrosis factor-α (TNF-α) and interferon-γ (IFN-γ).^17,18) IDO can decompose tryptophan (TRP) into kynurenine (KYN). KYN is then metabolized into quinoline acid (QA) which is a strong agonist of NMDA receptor and can lead to neuronal damage, or kynurenic acid (KYNA) which is known as an antagonist of NMDA receptor and reduces NMDA overstimulation to protect neurons.^17–20) A recent research by Morimoto et al. indicated that NMDA receptor antagonist can improve central mental fatigue induced by intraperitoneal injection of lipopolysaccharide (LPS) in mice.²¹⁾

However, the detail mechanism of GRb1 is still unknown and there is little information about the effect of NMDA receptor on central fatigue of POFS. So we aim to find out whether GRb1 had an effect on central fatigue of POFS through the inflammatory cytokines mediated NMDA receptor pathway. In this study, based on a POFS rat model induced by major small intestinal resection,²²⁾ we used open field test and typical biochemical parameters of inflammatory response, tryptophan metabolism and changes of NMDA receptor in the hippocampus to further study the central mechanism of POFS and the anti-central fatigue effect of GRb1 on POFS.

MATERIALS AND METHODS

Animals

Adult specific-pathogen-free male Sprague-Dawley rats (weighing 230±10 g) were obtained from Shanghai SLAC Laboratory Animal Co., Ltd. in China. The rats were maintained under specific pathogen-free conditions, at a temperature of 21±1°C, humidity 45–55% and 12 : 12 h light : dark cycle with a free access to tap water and standard laboratory rat chow. All animals received humanitarian concern in accordance with “Guiding Principles for the Care and Use of Laboratory Animals.” The protocol for the animal experiment was approved by the Institutional Animal Committee of Wenzhou Medical University.

Animal Grouping and Administration

After an adaptation period for one week, rats were randomized into 5 different groups as follows: control group (CG), POFS rat model group (MG), GRb1-treated POFS model group (GG), NMDA receptor antagonist group (NG) and GRb1-treated control group (RG). The POFS rat model was induced by major small intestinal resection as described previously.²²⁾ Briefly, rats in the MG, the GG and the NG group had 70% of the length of small intestine resected. The length of the small intestinal mesenterium starting from 10 cm below the ligament of Treitz was measured and defined as the small intestinal length. The CG and RG group went through the same procedure, but without any small intestinal resected. Rats in the GG and RG group received intraperitoneal injection of GRb1 at a dose of 15 mg/(kg×d) 3 d before surgery and every day after surgery until sacrificed,²³⁾ GRb1 (purity over 98%, purchased from Shanghai Tauto Biotech Co., Ltd., Shanghai, China) was dissolved in the saline with a concentration of 3.75 mg/mL. Rats in the NG group received intraperitoneal injection of NMDA receptor antagonist MK801 (purchased from Sigma, St. Louis, MO, U.S.A.) at a dose of 0.3 mg/kg once immediately after surgery.²⁴⁾ Rats in the CG and MG group were administrated an equal amount of saline by the same method. On postoperative days 1, 3, 5 and 7, rats were randomly selected from each group to assess fatigue with open field test. The rats were then immediately sacrificed by decapitation for hippocampus specimens taken after perfusion from left ventricle with normal saline. The samples were stored at −80°C for further analyses.

Open Field Test (OFT)

The open-field apparatus was made of plywood (100 cm×100 cm×50 cm) and painted black except for 3 mm thick white lines, which divided the floor into 25 squares. The entire room was kept quiet during the experiment. Each rat (n=8 for each group) was put into the center of the square initially, the following parameters were recorded by an image acquisition system (SONY) for 3 min: latency to leave the center (defined as time taken to leave the start central grid), number of rearing (defined as number of the rat stands on its hind limbs), number of grids crossed with three paws (including periphery and central area), time of rest (defined as time of the absence of movement), time of grooming (defined as time of the rat groom facial region and other parts of its body). The mobility score is a total number of rearing and grids crossing which reflects the ability of movement.²⁵⁾ The open field test was conducted after the drug injection.

Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Assays

Real-time quantitative PCR were performed for quantitate expression of inflammatory cytokines (IL-6, IL-1β, TNF-α) and NMDA receptor 1 (n=8 for the CG, MG and GG group). β-Actin gene, which is a housekeeping gene, was chosen as an internal gene control. The total RNA was extracted from partial hippocampus tissues with 1 mL TRIzol reagent (Invitrogen Life Technologies, Grand Island, NY, U.S.A.) and the integrity of RNA was identified by the method agarose gel electrophoresis. RNA concentration and purity were quantified by microplate reader (Thermo Scientific, Bremen, Germany). Then 1 µL total RNA was reverse transcribed to 50 µL cDNA with reverse-transcription (RT) kit (TOYOBO Co., Ltd., Japan). Real-time quantitative PCR-experiments were performed using ABI Prism 7500HT (Applied Biosystems, Carlsbad, CA, U.S.A.) with SYBR Green RT-PCR Master Mix (TOYOBO Co., Ltd.). The reaction condition for 3 min preheating at 95°C, followed by 40 cycles of 15 s at 95°C, 15 s at 60°C, 45 s at 72°C and then melting curve was used. mRNA expression levels were expressed as relative to control and were compared as fold change using the comparative Ct method described previously.²⁶⁾ The sense sequence and the anti-sense sequence of each gene were shown in Table 1.

Table 1. The Sense Sequence and the Anti-sense Sequence of Each Gene

Gene	Sequence (5′–3′)	Product length (bp)
β-Actin	Sense: TCACCAACTGGGACGATATG	119
	Anti-sense: GTTGGCCTTAGGGTTCAGAG
IL-6	Sense: AAGGACCAAGACCATCCAAC	129
	Anti-sense: ACCACAGTGAGGAATGTCCA
IL-1β	Sense: GCATCCAGCTTCAAATCTCA	108
	Anti-sense: ACGGGCAAGACATAGGTAGC
TNF-α	Sense: GAGATGTGGAACTGGCAGAG	97
	Anti-sense: AGCAGGAATGAGAAGAGGCT
NMDA receptor 1	Sense: CAAAAAGGAGTGGAACGGAATG	200
	Anti-sense: TGCTCTGAAAAGGCTGCATAAA

Western Blot Analysis

Western blots were performed on proteins from hippocampus tissue homogenates (n=8 for the CG, MG and GG group), which was homogenized in RIPA lysis buffer (Beyotime Biotechnology, China). Protein concentrations were determined and quantified using the bicinchoninic acid (BCA) protein assay kit (Beyotime Biotechnology, China). Proteins samples (30 µg) were separated on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) by electrophoresis performed according to standard procedures. After the electrophoresis, the gel was separated from the glass plates and the proteins were electrotransferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA, U.S.A.) in a wet transfer system (Bio-Rad, U.S.A.). The membranes were blocked with 5.0% skim milk in TBST (TBS containing 0.05% Tween 20) in 25°C for 1 h and subsequently incubated overnight at 4°C with a rabbit anti-NMDAR1 primary antibody (1 : 1000; Cell Signaling Technology, U.S.A.) or a rabbit anti-indoleamine 2,3-dioxygenase antibody (1 : 50; Abcam plc, Cambridge, U.K.). Glyceraldehyde-3-phosphate dehydrogenase (rabbit anti-GAPDH primary antibody; 1 : 1000; from Goodhere Biotechnology Co., Ltd., Hangzhou, China) protein expression was used as an internal control. After three washings with TBST over 10 min, the membranes were incubated at 25°C for 1 h with horseradish peroxidase (HRP) conjugated anti-rabbit immunoglobulin G (IgG) secondary antibody (1 : 5000; Bioworld Technology, Inc., U.S.A.). Followed by exposure to X-ray films (Kodak), the resulting labeled bands were quantified with Quantity One software 4.6.2 (Bio-Rad, Hercules, CA, U.S.A.). The quantification of proteins was performed by calculating the density of each individual band sample and was compared as fold change to internal control.

High Performance Liquid Chromatography (HPLC)

Hippocampal samples (n=8 for the CG, MG and GG group) were processed with 5% perchloric acid for removing the impurities, then centrifuging at 18000 rpm/min at 4°C for 15 min. The supernatant solutions were measured for the concentrations of tryptophan (TRP), kynurenine (KYN) and kynurenic acid (KYNA) using the HPLC-fluorescence detection system (Agilent 1260 Infinity, U.S.A.) with a Hyspersil C18 column (250 mm×4.6 mm i.d., 5 mm particle size, from Elite Analytical Instrument Co., Ltd., Dalian, China). The mobile phase consisted of 0.2 mol/L zinc acetate, 8.3 mmol/L acetate acid with 2.5% (v/v) acetonitrile. The flow rate was maintained at 1.5 mL/min. The fluorescence excitation and emission wavelengths and the preparation of standard working solutions were described previously.²⁷⁾ TRP, KYN and KYNA were purchased from Sigma (St. Louis, MO, U.S.A.). Their concentrations were determined from ratios of their peak areas to standards separately.

Transmission Electron Microscopic (TEM) Analysis

An ultrastructural TEM analysis of hippocampal neurons was performed on postoperative day 1 (n=2 for each group). Small pieces of the hippocampus were cut into 1 mm³ and immediately fixed in 2.5% glutaraldehyde at 4°C overnight. Samples were then post-fixed in 1% osmium tetroxide for 1 h and were dehydrated in a series of graded acetone (50%, 70%, 90%, 95%, 100% and 100% again, respectively) every treating for 10 min. Specimens were embedded in epoxy resin for 72 h at 40°C and for 24 h at 60°C. Semi thin sections were stained with toluidine blue. Ultrathin sections fabricated and observed were under examined by transmission electron microscopy (H-7500, HITACHI, Tokyo, Japan).

Statistical Analysis

Data were all expressed as mean±standard deviation (S.D.). Statistical analyses were performed using the SPSS software for Windows (version 17.0) statistical program. The significance of the mean difference was determined by one-way ANOVA, followed by post-hoc tests (using Least Significant Difference test, LSD-t) for multi-group comparisons. Differences between groups were considered statistically-significant when p-values were less than 0.05 (two-tailed).

RESULTS

Open Field Test

The results are shown in Table 2. Compared with the CG group on postoperative days 1 and 3, the mobility score of the MG group was significantly lower (p<0.05); meanwhile, the latency to leave the center, time of rest and ratio of periphery/central locomotion of the MG group significantly increased (p<0.05). Compared with the MG group, on postoperative days 1 and 3, the mobility score of the GG groups significantly increased (p<0.05) while the latency to leave the center, time of rest and ratio periphery/central locomotion of the GG group significantly decreased (p<0.05). In addition, on postoperative day 1, the latency to leave the center and ratio periphery/central locomotion of the NG group significantly decreased (p<0.05), compared with the MG group. There was no significant difference between CG and RG. In addition, there was no significant difference in the time of grooming among five groups.

Table 2. Results of Open Field Test

Group	Time	Latency to leave the center (s)	Mobility score	Time of rest (s)	Time of grooming (s)	Ratio periphery/central locomotion
CG	POD 1	1.90±1.41	40.88±7.06	51.31±4.39	18.20±2.16	10.28±2.52
	POD 3	2.03±0.64	46.63±7.17	52.75±3.16	19.68±3.41	9.98±2.18
	POD 5	2.25±0.71	58.25±5.06	31.81±4.28	23.95±3.42	10.31±1.32
	POD 7	1.75±0.71	61.63±3.42	29.06±1.86	24.81±3.06	10.51±1.47
MG	POD 1	3.58±1.41*	30.63±5.95**	64.81±5.75**	17.76±2.96	13.61±2.73*
	POD 3	3.93±0.83**	28.50±4.54**	68.50±4.93**	17.43±2.61	13.19±2.31*
	POD 5	3.06±0.86	53.63±5.89	36.56±3.50	22.46±2.52	11.82±1.92
	POD 7	1.63±0.74	59.75±3.41	30.94±3.35	23.56±1.68	10.67±1.10
GG	POD 1	2.20±1.11#	37.25±5.92#	58.81±2.84#	16.95±2.49	10.65±2.37#
	POD 3	2.88±0.92#	34.63±3.62#	62.00±5.60#	17.83±2.58	10.69±2.41#
	POD 5	2.63±0.92	55.38±3.50	35.13±6.51	23.24±3.76	10.43±1.35
	POD 7	1.69±0.70	61.38±2.00	30.81±4.12	23.58±2.48	10.48±1.56
NG	POD 1	2.19±1.03#	32.50±5.04	62.96±4.67	16.26±2.43	10.26±2.06#
	POD 3	3.37±0.97	29.50±6.80	70.76±4.76	18.54±2.44	12.38±2.52
	POD 5	2.70±0.84	54.13±5.40	36.95±3.08	23.91±2.51	10.65±1.80
	POD 7	1.58±0.70	61.13±2.36	29.80±4.17	22.70±2.53	10.01±1.50
RG	POD 1	1.94±0.86	41.75±4.27	50.81±4.74	19.50±2.39	10.30±2.35
	POD 3	1.94±0.68	49.38±4.47	49.75±3.88	18.88±2.53	10.29±2.50
	POD 5	2.43±0.79	60.13±5.22	32.23±4.40	24.13±3.48	10.28±1.95
	POD 7	1.88±0.44	62.88±2.47	28.25±2.29	23.88±2.03	10.63±1.11

CG (Control group), MG (POFS model group), GG (Ginsenoside Rb1-treated POFS model group), NG (NMDA receptor antagonist group), RG (Ginsenoside Rb1-treated control group), POD (postoperative day). Values are expressed as the mean±S.D. * p<0.05 and ** p<0.01 means the significant of MG compared with CG at the same time point, and ^# p<0.05 means the significance of GG or NG compared with MG at the same time point, respectively.

mRNA Expression of Inflammatory Cytokines (IL-6, IL-1β, TNF-α)

The results are shown in Fig. 1. Compared with the CG group on postoperative days 1 and 3, we found significantly increased mRNA expressions of each inflammatory cytokine in the MG group (p<0.05). The fold change of IL-6 mRNA expressions on postoperative day 3 markedly increased in the MG group (p<0.01). The mRNA expressions of each inflammatory cytokine of the MG group returned to the level of the CG group on postoperative day 7. In addition, on postoperative days 1 and 3, the GG group showed a significantly lower mRNA expression of each inflammatory cytokine than that of the MG group (p<0.05).

Fig. 1. Results of Real-Time PCR of IL-6 (a), IL-1β (b), TNF-α (c) and NMDA Receptor 1 (d)

CG (Control group), MG (POFS model group), GG (Ginsenoside Rb1-treated POFS model group), POD (Postoperative day). Values are expressed as the mean±S.D. * p<0.05 and ** p<0.01 means the significant of MG compared with CG at the same time point, and ^# p<0.05 means the significance of GG compared with MG at the same time point, respectively.

Expression of IDO, Activity of IDO (Ratio KYN/TRP) and Tryptophan Metabolism

The protein expressions of IDO are shown in Fig. 2a. On postoperative day 1, the protein levels of IDO of the MG groups significantly increased (p<0.05), compared with that of the CG group; however, the protein expression levels of IDO were not significantly altered in the GG group compared with the MG group. The activity of IDO and the results of tryptophan metabolism are shown in Table 3. There was a tendency of increased concentrations of TRP and KYN and deceased concentrations of KYNA in the MG group compared with the CG group on postoperative days 1 and 3. However, the ratios KYN/TRP and KYN/KYNA increased significantly (both p<0.05) in the MG group compared with the CG group on postoperative days 1 and 3. In addition, there was no significant difference in the ratio KYN/TRP, ratio KYN/KYNA or concentrations of TRP, KYN and KYNA between the GG group and the MG group.

Fig. 2. Protein Expressions of IDO (a) and NMDA Receptor 1 (b)

CG (Control group), MG (POFS model group), GG (Ginsenoside Rb1-treated POFS model group), POD (Postoperative day). Values are expressed as the mean±S.D. * p<0.05 means the significant of MG compared with CG at the same time point, and ^# p<0.05 means the significance of GG compared with MG at the same time point, respectively.

Table 3. Result of HPLC

Groups	Time	TRP (nmol/g)	KYN (nmol/g)	KYNA (nmol/g)	Ratio KYN/TRP	Ratio KYN/KYNA
CG	POD 1	34.34±2.78	5.26±0.67	0.321±0.023	0.153±0.016	16.36±1.51
	POD 3	39.43±4.16	6.27±0.79	0.379±0.047	0.159±0.011	16.61±1.93
	POD 5	30.97±6.80	4.60±0.74	0.303±0.085	0.150±0.011	15.51±1.45
	POD 7	30.00±3.71	4.23±0.56	0.283±0.030	0.141±0.007	15.00±1.86
MG	POD 1	35.83±6.81	6.11±1.24	0.320±0.045	0.171±0.012*	19.07±2.85*
	POD 3	41.51±6.78	7.30±1.49	0.363±0.072	0.175±0.013*	20.16±2.35*
	POD 5	32.82±5.56	5.09±0.68	0.300±0.037	0.156±0.007	17.08±2.10
	POD 7	30.70±5.98	4.28±0.61	0.274±0.054	0.141±0.008	15.79±1.41
GG	POD 1	35.36±4.84	5.87±0.55	0.314±0.041	0.167±0.019	18.80±1.63
	POD 3	41.61±4.50	7.22±0.90	0.370±0.036	0.174±0.010	19.71±3.25
	POD 5	32.04±6.00	4.87±0.71	0.291±0.066	0.153±0.009	16.98±1.40
	POD 7	31.20±5.36	4.33±0.44	0.286±0.027	0.140±0.010	15.28±2.06

CG (Control group), MG (POFS model group), GG (Ginsenoside Rb1-treated POFS model group), POD (Postoperative day). TRP (Tryptophan), KYN (Kynurenine), KYNA (Kynurenic acid). Values are expressed as the mean±S.D. * p<0.05 means the significant of MG compared with CG at the same time point, and ^# p<0.05 means the significance of GG compared with MG at the same time point, respectively.

Expression of NMDA Receptor 1

The mRNA and protein expression of NMDA receptor 1 are shown in Figs. 1d and 2b, respectively. We found both significantly increased mRNA and protein expressions of NMDA receptor 1 (p<0.05) in the MG group compared with the CG group on postoperative days 1 and 3, then returned to the level of the CG group on postoperative day 7. Furthermore, the mRNA and protein expressions of NMDA receptor 1 showed a significant decline in the GG group (p<0.05) compared with the MG group on postoperative days 1 and 3.

Ultrastructural Change of Hippocampal Neurons

Figure 3 shows the ultrastructure micrographs of hippocampal neurons in four groups. Hippocampal neuron in the MG group on postoperative day 1 was degenerating, in association with nuclear membrane crinkling like wave shape, chromatin condensing and gathering near the blurred nuclear membrane. In addition, we could see rarefaction and vacuoles of the mitochondrial structure, break and disappearance of the mitochondrial cristae, disorderly distributed endoplasmic reticulum and reduced free ribosomes in the hippocampal neuron. In the CG group on postoperative day 1, hippocampal neuron nuclei were large and round, with the uniformly distributed chromatin inside. Plenty of normal endoplasmic reticulum, ribosomes, mitochondria and other organelles in the perikaryon could be observed. In addition, the hippocampal neurons in both the GG and NG group were relatively improved.

Fig. 3. Representative Photographs of Transmission Electron Micrographs of Hippocampal Neuron on Postoperative Day 1 (5000× and 10000×)

CG (Control group), MG (POFS model group), GG (Ginsenoside Rb1-treated POFS model group), NG (NMDA receptor antagonist group).

DISCUSSION

In the present study, based on the POFS model induced by major small intestinal resection in rats, we used open field test to assess fatigue and determined typical biochemical parameters to research the central fatigue mechanism on POFS, tried to explain why patients have the feeling of fatigue and cognitive impairment after major abdominal surgery. The results indicated that the up regulated mRNA expressions of inflammatory cytokines (IL-6, IL-1β, TNF-α) could active IDO which effected the metabolism of tryptophan in the brain, then stimulated NMDA receptor to neuronal injury in hippocampus, showed a kind of central fatigue in rats with POFS. GRb1 could improve this central fatigue by preventing the increased expressions of inflammatory cytokines and NMDA receptor.

OFT was used to assess POFS model in the present study. Many published studies also used OFT to reflect the changes in the hippocampus.^28,29) The mobility score showed an ability of locomotion. The latency to leave the center is an indication of anxiety. The time of grooming showed an ability of self-cleaning. In this open field situation, rats walked close to the walls, a behavior called thigmotaxis which was indicated by ratio of periphery/central locomotion in this study. When compared with non-emotional rats, they had fewer entries in the central part and higher stay of periphery area. It can be used as an index of timidity and a high-stress state.³⁰⁾ The results indicated that POFS rats had decreased levels of short-term activity, space cognition, excitability and exploratory behavior to the new environment within 3 d after surgery. These are consistent with the typical fatigue syndromes, learning and cognitive impairment and anxiety, which are also presented in patients after surgery.

It is well accepted that the inflammatory response is one of the pathophysiologic responses to surgical injury. Some research on the relationship between inflammation and spirit, mood and emotion showed that some inflammatory cytokines such as IL-6 and TNF-α play a vital role in causing weakness behavior and are associated with cognitive impairment and mood changes.^31,32) In the present study, we found that POFS rats had a significantly increased mRNA expression of IL-6, IL-1β and TNF-α in the hippocampus on postoperative days 1 and 3, which was also consistent with the result of open field test postoperatively.

NMDA receptors are abundant in the neurons of hippocampus and it is suggested that there is a close relationship between NMDA receptor and various psychiatric disorders like learning and memory impairment, anxiety and depression.³³⁾ As previous study suggested that the amount of excitatory NMDA receptor has a relationship with the extent of the hippocampus pyramidal neuronal death,³⁴⁾ the change of hippocampal neurons morphology may be caused by NMDA receptor stimulation, the neural injury in the hippocampus can impede the neural function, and this could be a direct cause for the change of behavior in the POFS rats. In the present study, we confirmed the mRNA and protein expressions of NMDA receptor 1. The result showed that POFS rats performed postoperative fatigue associated with a significantly increased expression of NMDA receptor 1 on postoperative days 1 and 3. NMDA receptor antagonist MK801 could improve the central fatigue of POFS by reducing the ratio of periphery/central locomotion and latency to leave the center and protecting the hippocampal neurons. So we speculated that the overexpression of NMDA receptor may belong to a pathophysiologic response to surgical injury and inflammatory cytokines, which could be linked with the central fatigue of POFS.

IDO is an enzyme which is present in monocytes, macrophages and microglial cells within the brain parenchyma and converts TRP into KYN.^35,36) As is well known that IDO activity is mainly stimulated by the pro-inflammatory cytokines, in the present study POFS rats had a significantly increased protein level of IDO on postoperative day 1, which was combined with up regulation of the inflammatory cytokines IL-6, IL-1β and TNF-α. Both TRP level and KYN level in the hippocampus of POFS rats increased postoperatively but there was no significant difference. However, the ratio KYN/TRP was significantly higher in POFS rats on postoperative days 1 and 3, indicating that the activity of IDO was strengthened postoperatively. In our previous study, we found that free tryptophan (f-TRP) and the ratio of f-TRP/BCAA increased in the early postoperative period in the POFS rats,³⁷⁾ so we speculated that surgical trauma may decrease the nutritional status of patients and enhance protein catabolism, thus increased TRP levels on the brain; at the same time the high transcriptional levels of IL-6, IL-1β and TNF-α may active IDO and tryptophan metabolism within 3 d after surgery. Some studies summarized that the abdomen injury signal can be spread to central nervous system (CNS) through two pathways: 1) Inflammatory cytokines are released into blood and spread to CNS through the blood flow; 2) Abdominal injury signal transmit to CNS through the vagus nerve and released some cytokines. They act synergistically to give rise to postoperative fatigue symptoms. In addition, that microglia is the resident macrophages of the brain and spinal cord which secreted pro-inflammatory cytokines, and act as the main form of active immune defense in the brain.^38,39) However, the present study did not determine which pathway mentioned above to stimulate the microglia in the hippocampus to synthesis inflammatory cytokines in the brain was dominant. Our further research will explain this problem.

In addition, we also found a decreased tendency of KYNA level postoperatively and a significantly increased ratio KYN/KYNA, indicating there was an imbalance between KYN and KYNA, or between QA and KYNA. Some studies have demonstrated the neurotoxicity of KYN and its metabolite QA by stimulating NMDA receptor.^40,41) However, KYNA, another metabolite of KYN, is known as an antagonist of the NMDA receptor and can reduce NMDA overstimulation to protect neurons.⁴²⁾ This imbalance between neurotoxic and neuroprotective metabolites may result in a greater neurotoxic damage through NMDA receptor. Thus, the neurotoxic metabolites could overstimulate hippocampal NMDA receptor to intracellular calcium overload and neuronal injury.

Ginseng, as a Chinese traditional medicine, has been used as a tonic to treat various disorders. GRb1 is one of the active substances in ginsenosides. GRb1 exerts a protective effect in various conditions.^3,43,44) GRb1 also showed an anti-fatigue effect on which may be associated with the improvement of energy metabolism and the suppression of skeletal muscle oxidative stress in previous study.⁴⁾ In the present study, GRb1 decreased the levels of inflammatory cytokines (IL-6, IL-1β, TNF-α) and NMDA receptor, improved the behavioral manifestations on the postoperative days 1 and 3, indicating it could minimize the effects of central fatigue and protect the hippocampal neurons from neural injury for the POFS rats. In addition, GRb1 had no effects for the rats in RG group, indicating that GRb1 may have more beneficial effect on the pathophysiologic changes of POFS. Moreover, GRb1 had no significant effects on IDO and tryptophan metabolism. It may protect the hippocampal neurons by reducing the amount of NMDA receptor or playing neurotrophic effect. Therefore, a future study may be performed for the exact mechanism of GRb1’s anti-fatigue effect on POFS.

In conclusion, our study demonstrates that inflammatory cytokines can active tryptophan metabolic pathways on the hippocampus to cause fatigue through NMDA receptor on POFS induced by major small intestinal resection in rat. GRb1 has an anti-fatigue effect on POFS by reducing inflammatory cytokines and NMDA receptor. To our knowledge, this is the first study demonstrating that GRb1 can prevent increased both inflammatory cytokines and NMDA receptor in POFS in vivo. As 5 hydroxytryptamine (5-HT) receptor pathways play an important role in cognitive-behavioral impairment, a further study is required to determine the interaction between 5-HT receptor pathways and NMDA receptor pathways. In addition, as GRb1 has multiple pharmacological effects, we should consider whether GRb1 has an anti-fatigue effect through 5-HT pathway or whether the anti-fatigue effect of GRb1 may involve anti-oxidation or neuroprotection in hippocampus of POFS rats.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (No. 81171857), the Natural Science Foundation of Zhejiang Province (No. LZ12H07001), the Ministry of Health and Zhejiang Province Co-founded program (No. 201231118) and the Health Department of Zhejiang program (No. 2013ZDA014), and was also partly supported by the clinical nutriology area of the medical support discipline of Zhejiang Province (No. 11-ZC24).

Conflict of Interest

The authors declare no conflict of interest.

REFERENCES

• 1) Attele AS, Wu JA, Yuan CS. Ginseng pharmacology: multiple constituents and multiple actions. Biochem. Pharmacol., 58, 1685–1693 (1999).
• 2) Li QY, Chen L, Fu WH, Li ZD, Wang B, Shi XJ, Zhong MK. Ginsenoside Rb1 inhibits proliferation and inflammatory responses in rat aortic smooth muscle cells. J. Agric. Food Chem., 59, 6312–6318 (2011).
• 3) Shen L, Xiong Y, Wang DQ, Howles P, Basford JE, Wang J, Xiong YQ, Hui DY, Woods SC, Liu M. Ginsenoside Rb1 reduces fatty liver by activating AMP-activated protein kinase in obese rats. J. Lipid Res., 54, 1430–1438 (2013).
• 4) Tan S, Zhou F, Li N, Dong Q, Zhang X, Ye X, Guo J, Chen B, Yu Z. Anti-fatigue effect of ginsenoside Rb1 on postoperative fatigue syndrome induced by major small intestinal resection in rat. Biol. Pharm. Bull., 36, 1634–1639 (2013).
• 5) Zargar-Shoshtari K, Hill AG. Postoperative fatigue: a review. World J. Surg., 33, 738–745 (2009).
• 6) Kehlet H, Dahl JB. Anaesthesia, surgery, and challenges in postoperative recovery. Lancet, 362, 1921–1928 (2003).
• 7) Rubin GJ, Hotopf M. Systematic review and meta-analysis of interventions for postoperative fatigue. Br. J. Surg., 89, 971–984 (2002).
• 8) DeCherney AH, Bachmann G, Isaacson K, Gall S. Postoperative fatigue negatively impacts the daily lives of patients recovering from hysterectomy. Obstet. Gynecol., 99, 51–57 (2002).
• 9) Olney JW, Farber NB. Glutamate receptor dysfunction and schizophrenia. Arch. Gen. Psychiatry, 52, 998–1007 (1995).
• 10) Li SX, Fujita Y, Zhang JC, Ren Q, Ishima T, Wu J, Hashimoto K. Role of the NMDA receptor in cognitive deficits, anxiety and depressive-like behavior in juvenile and adult mice after neonatal dexamethasone exposure. Neurobiol. Dis., 62, 124–134 (2014).
• 11) Ahmed I, Bose SK, Pavese N, Ramlackhansingh A, Turkheimer F, Hotton G, Hammers A, Brooks DJ. Glutamate NMDA receptor dysregulation in Parkinson’s disease with dyskinesias. Brain, 134, 979–986 (2011).
• 12) Milnerwood AJ, Gladding CM, Pouladi MA, Kaufman AM, Hines RM, Boyd JD, Ko RW, Vasuta OC, Graham RK, Hayden MR, Murphy TH, Raymond LA. Early increase in extrasynaptic NMDA receptor signaling and expression contributes to phenotype onset in Huntington’s disease mice. Neuron, 65, 178–190 (2010).
• 13) Salter MW, Pitcher GM. Dysregulated Src upregulation of NMDA receptor activity: a common link in chronic pain and schizophrenia. FEBS J., 279, 2–11 (2012).
• 14) Cull-Candy S, Brickley S, Farrant M. NMDA receptor subunits: diversity, development and disease. Curr. Opin. Neurobiol., 11, 327–335 (2001).
• 15) Stone TW, Addae JI. The pharmacological manipulation of glutamate receptors and neuroprotection. Eur. J. Pharmacol., 447, 285–296 (2002).
• 16) McEntee WJ, Crook TH. Glutamate: its role in learning, memory, and the aging brain. Psychopharmacology, 111, 391–401 (1993).
• 17) Myint AM, Kim YK. Cytokine-serotonin interaction through IDO: a neurodegeneration hypothesis of depression. Med. Hypotheses, 61, 519–525 (2003).
• 18) Müller N, Schwarz MJ. The immune-mediated alteration of serotonin and glutamate: towards an integrated view of depression. Mol. Psychiatry, 12, 988–1000 (2007).
• 19) Stone TW, Darlington LG. Endogenous kynurenines as targets for drug discovery and development. Nat. Rev. Drug Discov., 1, 609–620 (2002).
• 20) Wichers MC, Koek GH, Robaeys G, Verkerk R, Scharpe S, Maes M. IDO and interferon-alpha-induced depressive symptoms: a shift in hypothesis from tryptophan depletion to neurotoxicity. Mol. Psychiatry, 10, 538–544 (2005).
• 21) Morimoto Y, Zhang Q, Adachi K. Quinolinic acid decreases mental activity in mice by damaging brain neurons through the activation of N-methyl-D-aspartate receptors: proposed relationship to human mental fatigue. J. Health Sci., 57, 153–163 (2011).
• 22) Zhang XD, Chen BC, Dong QT, Andersson R, Pan XD, Tan SJ, Ye XZ, Yao JG, Yu Z. Establishment and assessments of a new model for the postoperative fatigue syndrome by major small intestinal resection in rats. Scand. J. Gastroenterol., 46, 1302–1309 (2011).
• 23) Zhuang CL, Mao XY, Liu S, Chen WZ, Huang DD, Zhang CJ, Chen BC, Shen X, Yu Z. Ginsenoside Rb1 improves postoperative fatigue syndrome by reducing skeletal muscle oxidative stress through activation of the PI3K/Akt/Nrf2 pathway in aged rats. Eur. J. Pharmacol., 740, 480–487 (2014).
• 24) Chen J, Kitanishi T, Ikeda T, Matsuki N, Yamada MK. Contextual learning induces an increase in the number of hippocampal CA1 neurons expressing high levels of BDNF. Neurobiol. Learn. Mem., 88, 409–415 (2007).
• 25) Walsh RN, Cummins RA. The Open-Field Test: a critical review. Psychol. Bull., 83, 482–504 (1976).
• 26) Schmittgen TD, Livak KJ. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc., 3, 1101–1108 (2008).
• 27) Xiang ZY, Tang AG, Ren YP, Zhou QX, Luo XB. Simultaneous determination of serum tryptophan metabolites in patients with systemic lupus erythematosus by high performance liquid chromatography with fluorescence detection. Clin. Chem. Lab. Med., 48, 513–517 (2010).
• 28) Ye Y, Wang G, Wang H, Wang X. Brain-derived neurotrophic factor (BDNF) infusion restored astrocytic plasticity in the hippocampus of a rat model of depression. Neurosci. Lett., 503, 15–19 (2011).
• 29) Hovens IB, Schoemaker RG, van der Zee EA, Heineman E, Nyakas C, van Leeuwen BL. Surgery-induced behavioral changes in aged rats. Exp. Gerontol., 48, 1204–1211 (2013).
• 30) Prut L, Belzung C. The open field as a paradigm to measure the effects of drugs on anxiety-like behaviors: a review. Eur. J. Pharmacol., 463, 3–33 (2003).
• 31) Dantzer R. Cytokine, sickness behavior, and depression. Immunol. Allergy Clin. North Am., 29, 247–264 (2009).
• 32) Huang Y, Henry CJ, Dantzer R, Johnson RW, Godbout JP. Exaggerated sickness behavior and brain proinflammatory cytokine expression in aged mice in response to intracerebroventricular lipopolysaccharide. Neurobiol. Aging, 29, 1744–1753 (2008).
• 33) Toro C, Deakin JF. NMDA receptor subunit NRI and postsynaptic protein PSD-95 in hippocampus and orbitofrontal cortex in schizophrenia and mood disorder. Schizophr. Res., 80, 323–330 (2005).
• 34) Andiné P, Jacobson I, Hagberg H. Enhanced calcium uptake by CA1 pyramidal cell dendrites in the postischemic phase despite subnormal evoked field potentials: excitatory amino acid receptor dependency and relationship to neuronal damage. J. Cereb. Blood Flow Metab., 12, 773–783 (1992).
• 35) Dale WE, Dang Y, Brown OR. Tryptophan metabolism through the kynurenine pathway in rat brain and liver slices. Free Radic. Biol. Med., 29, 191–198 (2000).
• 36) Russo S, Kema IP, Fokkema MR, Boon JC, Willemse PH, de Vries EG, den Boer JA, Korf J. Tryptophan as a link between psychopathology and somatic states. Psychosom. Med., 65, 665–671 (2003).
• 37) Dong QT, Zhou F, Yu Z, Tan SJ, Wang Q, Zhang XD. Association of the changes of central serotonin and peripheral blood free amino acids with postoperative fatigue after abdominal surgery. Zhonghua Wei Chang Wai Ke Za Zhi, 14, 968–972 (2011).
• 38) Hanisch UK, Kettenmann H. Microglia: active sensor and versatile effector cells in the normal and pathologic brain. Nat. Neurosci., 10, 1387–1394 (2007).
• 39) Kim SU, de Vellis J. Microglia in health and disease. J. Neurosci. Res., 81, 302–313 (2005).
• 40) Santamaría A, Galván-Arzate S, Lisý V, Ali SF, Duhart HM, Osorio-Rico L, Rios C, Sut’astný F. Quinolinic acid induces oxidative stress in rat brain synaptosomes. Neuroreport, 12, 871–874 (2001).
• 41) Owe-Young R, Webster NL, Mukhtar M, Pomerantz RJ, Smythe G, Walker D, Armati PJ, Crowe SM, Brew BJ. Kynurenine pathway metabolism in human blood–brain-barrier cells: implications for immune tolerance and neurotoxicity. J. Neurochem., 105, 1346–1357 (2008).
• 42) Stone TW. Inhibitors of the kynurenine pathway. Eur. J. Med. Chem., 35, 179–186 (2000).
• 43) Hwang YP, Jeong HG. Ginsenoside Rb1 protects against 6-hydroxydopamine-induced oxidative stress by increasing heme oxygenase-1 expression through an estrogen receptor-related PI3K/Akt/Nrf2-dependent pathway in human dopaminergic cells. Toxicol. Appl. Pharmacol., 242, 18–28 (2010).
• 44) Zhu J, Jiang Y, Wu L, Lu T, Xu G, Liu X. Suppression of local inflammation contributes to the neuroprotective effect of ginsenoside Rb1 in rats with cerebral ischemia. Neuroscience, 202, 342–351 (2012).