2017 年 40 巻 10 号 p. 1678-1685
α-Cyperone, a sesquiterpene compound represents 25.23% of the total oil and is the most abundant compound in Cyperus rotundus oil. Endothelial cell protein C receptor (EPCR) is a main member in protein C (PC) anti-coagulation system. EPCR could be shed from cell surface, and is mediated by tumor necrosis factor-α converting enzyme (TACE). Nothing that EPCR is a marker of vascular barrier integrity in vascular inflammatory disease and takes part in systemic inflammatory disease. In this study, we investigated whether α-cyperone could inhibit EPCR shedding. To observe the effect, we investigated this issue by detection the effect of α-cyperone on phorbol-12-myristate 13-acetate (PMA)-induced EPCR shedding in human umbilical vein endothelial cells (HUVECs). The cells were pretreated with α-cyperone for 12 h, and then stimulated by PMA for 1 h. The solute EPCR (sEPCR) and expression of membrane EPCR (mEPCR) were measured by enzyme-linked immunosorbent assay (ELISA) and Western blot. The mRNA, protein level and activity of TACE were tested by quantitative (q)RT-PCR, Western blot and InnoZyme TACE activity assay kit. Furthermore, we measured the protein level of mitogen-activated protein kinase (MAPK) signaling and protein kinase C (PKC) pathway under this condition by Western blot. The results showed that α-cyperone could suppress PMA-induced EPCR shedding through inhibiting the expression and activity of TACE. In addition, α-cyperone could inhibit PKC translocation, but not have an effect on phosphorylation of c-Jun N-terminal kinase (JNK), p38 and extracellular regulated protein kinases (ERK) 1/2. Given these results, α-cyperone inhibits PMA-induced EPCR shedding through PKC pathway, which will provide an experimental basis for further research on α-cyperone.
Endothelial cell protein C receptor (EPCR), a crucial component of the protein C anti-coagulation system, is a type I transmembrane protein. And its structure is similar to the major histocompatibility complex class 1/cluster of differentiation (CD) I family of proteins.1) It widely exists in the cell membrane of the endothelium of large vessels.2) EPCR has a high affinity (Kd=30 nM) to bind protein C (PC) and activated protein C (APC).1) Previous work showed that EPCR can bind to PC, and then combine with thrombin–thrombomodulin (TM) complex to enhance APC.3) APC is then released to combine with protein S (PS) and down-regulate the coagulation factors Va and VIIIa,3) resulting in anti-coagulation.
Exposition of EPCR, a cell surface constituent, relies on EPCR shedding from cell membrane and then its release in the soluble form which is named solute EPCR (sEPCR).4,5) The activation and function of EPCR are regulated by metalloproteinase-mediated protein cleavage.1,6) Due to the shedding of EPCR, sEPCR can be discovered in plasma, and a previous study demonstrated that excess sEPCR in plasma could cause systemic inflammatory diseases.7)
Tumor necrosis factor-α converting enzyme (TACE), also known as ADAM17, is a key member of the ADAM (a disintegrin and metalloproteinase) family. It has been reported that TACE could mediate PMA-induced EPCR shedding in human umbilical vein endothelial cells (HUVECs).8) Furthermore, numerous in vitro experiments show that TACE is regulated by activated protein kinase C (PKC).9–13) PKC is widely distributed in various tissues, organs and cells. In quiescent cells, PKC exists mainly in the cytoplasm.14) When cells are stimulated, PKC shifts from cytoplasm to cell surface, referred to as translocation14,15); generally, PKC translocation is a sign of PKC activation.16) However, there are no data to show that PKC pathway could regulate TACE-mediated, PMA-induced EPCR shedding in HUVECs. Consequently, we hypothesized that PKC pathway may regulate this process in these cells.
Cyperus rotundus (Cyperaceae) is a Chinese herbal medicine, and it is called “Xiang Fu” in China. It has been widely used as an antidiabetic, antidiarrheal, anti-inflammatory, antidepressant, and analgesic.17–19) Previous studies have demonstrated that Cyperus rotundus has extensive pharmacological properties, including antibacterial,18) and antimutagenic.20) Moreover, a recent study showed that the essential oil of Cyperus rotundus exhibits considerable antigenotoxic, antimutagenic, and antibacterial effects as well.21) It has been reported that α-cyperone, a sesquiterpene compound represents 25.23% of the total oil and is the most abundant compound in Cyperus rotundus oil.22) Also in China, we named α-cyperone with “α Xiang Fu Tong.” However, there are no studies reporting whether α-cyperone has an effect on EPCR shedding. EPCR play a very important role in protecting the integrity of the vascular barrier and excessive shedding of EPCR will destroy this balance,23) resulting in systemic inflammatory diseases.7) On this basis, we hypothesized that α-cyperone, which has been reported to have anti-inflammatory function,24,25) may inhibit EPCR shedding. Therefore, in this study we focused on whether α-cyperone could inhibit PMA-induced EPCR shedding through the PKC pathway in HUVECs.
Phorbol-12-myristate 13-acetate (PMA) and dimethyl sulfoxide (DMSO) were obtained from Sigma (St. Louis, MO, U.S.A.). Bisindolylmaleimide I (BIS) was purchased from CST (Beverly, MA, U.S.A.). PROCR (Human) enzyme-linked immunosorbent assay (ELISA) Kit was obtained from Abnova (Taiwan). Antibody sources were as follows: human EPCR antibody (R&D Systems, Inc., Minneapolis, MN, U.S.A.); anti-ADAM17 antibody—Cytoplasmic domain (ab39162), anti-Sodium Potassium ATPase antibody [EP1845Y]—Plasma membrane Loading Control (ab76020) (Abcam, Cambridge, U.K.), PKC Isoform Antibody Sampler Kit#9960, Phospho-PKC Antibody Sampler Kit#9921, mitogen-activated protein kinase (MAPK) Family Antibody Sampler Kit#9926, Phospho-MAPK Family Antibody Sampler Kit#9910 (Cell Signaling, Beverly, MA, U.S.A.), Mouse monoclonal anti-beta-actin (sc-47778), goat anti-rabbit antibody, rabbit anti-goat antibody, goat anti-mouse antibody (Santa Cruz Biotech, Santa Cruz, CA, U.S.A.).
α-Cyperoneα-Cyperone (C15H22O, 98% purity, Lot: 150910) was obtained from Aoke Biology Research Co., Ltd. (Beijing, China). Its structure is showed in Fig. 1. α-Cyperone was dissolved in DMSO, and the concentration of DMSO was used at 0.1% in treatment.
HUVECs were obtained from ATC C (Rockville, MD, U.S.A.). Briefly, cells were cultured in high glucose-Dulbecco’s modified Eagle’s medium (DMEM) basal media with 10% fetal bovine serum (Hyclone) in incubator with 5% CO2 at 37°C. Before cells were used for experiment, must culture at approximately 90% confluence. In our study, cells were pretreated with α-cyperone (0.1 to 10 ng/mL) for 12 h or with PKC inhibitor bisindolylmaleimide I (20 nM to 2 µM) for 30 min or with non-treatment, then stimulated with PMA for 1 h which could induce EPCR shedding8) and phosphorylation of MAPK.26–28)
Cell ViabilityCCK-8 assay was used to evaluate the cell viability. Cells were cultured to confluence in 96-well plates, and then cells were treated with increasing concentrations of α-cyperone (0.04 to 40 µg/mL) for 24 h. After, 10 µL CCK-8 was added to each well, and cells were incubated for 2 h at 37°C. At last, the optical density of each well was measured at 450 nm using a microplate reader.
ELISA for sEPCRConcentrations of EPCR in cell culture media were detected using ELISA kits. First, samples were prepared from cell culture media, and 0.1 mL of sample was added per well in 96-well plate. Then, the plate was sealed with the adhesive cover and incubated at 37°C for 90 min, after which plate content was discarded. The plate was then incubated at 37°C for 60 min with 0.1 mL of biotinylated anti-human EPCR antibody working solution per well. Following incubation, the plate was washed three times with 0.01 M Tris-buffered saline (TBS), and subsequently incubated at 37°C for 30 min with 0.1 mL of ABC working solution per well. The plate was then washed five times with 0.01 M TBS, and 90 µL of tetramethylbenzidine (TMB) color developing agent was added into each well and incubated at 37°C in the dark for 20 min. Finally, 0.1 mL of TMB stop solution was added into each well, and the optical density (O.D.) absorbance at 450 nm was read using a microplate reader.
Western BlotProteins lysates were obtained by homogenizing HUVECs with lysis buffer (AR0102) (Boster, Wuhan, China) for total proteins and with lysis buffer (AR0155) (Boster) for membrane proteins. Protein concentration was measured by using BCA Protein Assay Kit (Beyotime, Jiangsu, China). Equivalent amounts of proteins (15 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) (10%) and transferred to polyvinylidene difluoride (PVDF) membranes. Then, the PVDF membranes were blocked with 0.5% skim milk for 1 h at room temperature (r.t.) with sustained shaking, and membranes were incubated with monoclonal antibody of EPCR (1 : 2000 dilution), TACE (1 : 1000 dilution), PKCα (1 : 2000 dilution), Phospho-PKC (pan) (βII Ser660) (1 : 2000 dilution), Phospho-PKCα/βII (Thr638/641) (1 : 2000 dilution), Phospho-MAPK family antibody (1 : 2000 dilution), MAPK family antibody (1 : 2000 dilution), anti-beta-actin (1 : 15000 dilution), anti-Sodium Potassium ATPase antibody (1 : 100000 dilution) at 4°C overnight. Subsequently, the membranes were incubated with secondary antibody (goat anti-mouse or rabbit or rabbit anti-goat, 1 : 10,000 dilution) at r.t. for 1 h, and developed with ECL-plus system (Bio-Rad, Hercules, CA, U.S.A.). Equal loading of protein was confirmed by measuring anti-Sodium Potassium ATPase expression. Densitometric analysis of Western blot bands was performed using Alpha image software (Alpha Innotech, CA, U.S.A.).
Quantitative RT-PCRRNA was isolated with using TRI-Reagent (Invitrogen, Grand Island, NY, U.S.A.). cDNA was synthesized using the iScript cDNA Synthesis Kit (Bio-Rad), and real-time polymerase chain reactions were performed using iQ SYBR Green Supermix (Bio-Rad). On the basis of the instructions, the mRNA expressions of TACE and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) were performed using a CFX Connect™ Real-Time PCR Detection System (Bio-Rad) for quantitative RT-PCR. Table 1 listed the primer sequences used in this study. All data were normalized to the mRNA expression level of GAPDH.
| Genes | Primer for real time-PCR | |
|---|---|---|
| Forward (5′→3′) | Reverse (5′→3′) | |
| TACE | ACCTGAAGAGCTTGTTCATCGAG | CCATGAAGTGTTCCGATAGATGTC |
| GAPDH | TCGGAGTCAACGGATTT | CCACGACGTACTCAGC |
To detect TACE activity, InnoZyme TACE activity assay kit (EMD Millipore, Billerica, MA, U.S.A.) was used according to the instructions. Proteins lysates were obtained with CytoBuster™ Protein Extraction Reagent (EMD Millipore).
Statistical AnalysisAll the results were presented as the mean±standard deviation (S.D.), and all the data were measured by three independent experiments. The Statistical significances of the data were determined using ANOVA (SPSS, version 14.0, SPSS Science, Chicago, IL, U.S.A.). p<0.05 was considered to be statistically significant.
To estimate the cytotoxicity of α-cyperone on PMA-induced HUVECs, cells were treated with α-cyperone (0.04 to 40 µg/mL) for 24 h, and then CCK-8 assay was used to measure cell viability. The data in Fig. 2 show that α-cyperone at a concentration no more than 50 µg/mL had no significant cellular toxicity to the HUVECs (p>0.05) during a 24 h treatment.
Cells were pretreated with growing concentrations of α-cyperone (0.04 to 40 µg/mL) for 24 h, and then CCK-8 assay was used to measure the cell viability. As a control, cells were incubated in a medium without α-cyperone.
Much of the research has examined that PMA can increase EPCR shedding from the cell surface.8,29) To further look into the effects of PMA on EPCR shedding, cells were stimulated with PMA at the concentration gradient of 0, 1, 2, and 4 µM for 1 h. The results showed that soluble EPCR (sEPCR) in the culture media was increased, and membrane EPCR (mEPCR) expression was decreased by PMA in a dose-dependent manner (Figs. 3A–C). It is also observed by Lee et al.30) In order to ascertain whether α-cyperone could inhibit EPCR shedding induced by a higher concentration of PMA, cells were pretreated with α-cyperone for 12 h, after that stimulated with 2 µM PMA for 1 h. The results indicated that α-cyperone at concentrations ranging from 0.1 to 10 µg/mL decreased the amount of sEPCR and increased the amount of mEPCR (Figs. 3D–F), suggesting that α-cyperone can inhibit EPCR shedding under the strong stimulation of PMA.
A–C. A higher concentration of PMA could induce the more serious EPCR shedding in HUVECs. The cells were treated with growing concentration of PMA (1 to 4 µM). D–F. α-Cyperone could remarkably inhibit EPCR shedding induced by PMA in HUVECs. Before stimulated with 2 µM PMA for 1 h, cells were in a pretreatment with increasing concentration of α-cyperone (0.1 to 10 µg/mL) for 12 h. sEPCR and mEPCR protein expression were determined by ELISA (C, F) and WB (A, D), B and E manifest the corresponding densitometric measurement of Western blot bands. * p<0.05 vs. PMA group, # p<0.05 vs. Control group, ## p<0.01 vs. Control group.
TACE is responsible for PMA-induced EPCR shedding,8) however, since there is very little literature relating to this detail, we sought to further determine both of protein and mRNA expression and activity of TACE stimulated with increasing concentrations of PMA. The results demonstrated that expression and activity of TACE were enhanced by PMA in a dose-dependent manner (Figs. 4A–D). Since α-cyperone could significantly prevent the EPCR shedding stimulated by PMA, we tested whether this effect was attributed to the inhibition of expression and activity of TACE. Figures 4E–G showed both of mRNA and protein expression of TACE were decreased after α-cyperone treatment, and the data in Fig. 4H also showed that the activity of TACE was inhibited by α-cyperone.
A–D. PMA could enhance expression and activity of TACE in a dose-dependent manner. The cells were treated with increasing concentration of PMA (1 to 4 µM). E–H. The effect of α-cyperone on PMA-stimulated expression and activity of TACE in HUVECs. Before stimulated with 2 µM PMA for 1 h, the cells were in a pretreatment with increasing concentration of α-cyperone (0.1 to 10 µg/mL) for 12 h. The mRNA and protein level were tested by qRT-PCR (C, G) and WB (A, E), B and F manifest the corresponding densitometric measurement of Western blot bands. The activity of TACE was determined by InnoZyme TACE activity assay, the result was shown in D and H. * p<0.05 vs. PMA group, # p<0.05 vs. Control group, ## p<0.01 vs. Control group.
In previous reports, it is well-known that ERK1/2, p38 and JNK are taken parts in EPCR shedding, and PMA could induce phosphorylation of ERK, p38 and JNK.26–28) Besides, we further tested the effect of α-cyperone on PMA-stimulated phosphorylation of MAPK. Cells were pretreated with α-cyperone under the safety concentration for 12 h, followed by treatment with 2 µM PMA for 1 h. We observed that α-cyperone did not reduce phosphorylation of JNK, p38 MAPK and ERK1/2 (Figs. 5C, D). According to this result, α-cyperone inhibiting EPCR shedding induced by PMA is not through MAPK signaling. And also we found that phosphorylation of MAPK did not increase by PMA in a dose-dependent manner (Figs. 5A, B).
A, B the effect of PMA-induced phosphorylation of MAPK in HUVECs. The cells were treated with increasing concentration of PMA (1 to 4 µM) for 1 h. C, D the effect of α-cyperone on PMA-induced phosphorylation of MAPK. The cells were treated with increasing concentration of α-cyperone (0.1 to 10 µg/mL) for 12 h, then stimulated with 2 µM PMA for 1 h and assayed by WB (A, C). Densitometric analysis was used to implement the protein quantification (B, D). The result showed that α-cyperone does not reduce phosphorylation of MAPK induced by PMA (p>0.05). # p<0.05 vs. Control group, ## p<0.01 vs. Control group.
A series of experiments showed that TACE is also regulated by the PKC pathway9–13); furthermore, PMA is also a potent PKC activator. All of these reports indicate that the activation of the PKC pathway is involved in EPCR shedding, but which PKC isoform is playing the pivotal role in this process is still unclear. We utilized Bisindolylmaleimide I (BIS), a potent and selective inhibitor of PKC,31,32) to treat the cells for 30 min, followed by treatment with 2 µM PMA for 1 h. The result indicated that BIS could fully suppress EPCR shedding (Figs. 6A–C) when the concentration of BIS is more than 20 nM, which is sufficient to inhibit PKCα or PKCβ.31,32) Then, we sought to determine whether the effect of α-cyperone on EPCR shedding induced by PMA was through PKCα or PKCβ. As shown in Figs. 7A and B, α-cyperone at concentrations ranging from 0.1 to 10 µg/mL could decrease the expression of PKCα on cell membrane, suggesting α-cyperone blocked the translocation of PKCα to the cell membrane to inactivate the PKC pathway. Meanwhile, 10 µg/mL α-cyperone could remarkably decrease phospho-PKCα/βII (Thr638/641) and 0.1 to 10 µg/mL α-cyperone markedly decreased phospho-PKCβII (Ser660). All of the above results suggest that α-cyperone could inhibit PKC pathway to regulate the TACE and EPCR shedding.
Cells were treated with growing concentration of BIS (20 to 2000 nM) for 30 min, followed by treatment with 2 µM PMA for 1 h. The sEPCR and EPCR protein level were determined by ELISA (C) and WB (A), and B manifest the corresponding densitometric measurement of Western blot bands. * p<0.05 vs. PMA group, # p<0.05 vs. Control group.
Cells were treated with growing concentration of α-cyperone (0.1 to 10 µg/mL) for 12 h, then stimulated with 2 µM PMA for 1 h. Then PKC membrane protein level was measured by WB (A), and the corresponding densitometric measurement was shown in B. ** p<0.01 vs. PMA group, ## p<0.01 vs. Control group.
In our study, the data show a novel effect of α-cyperone on PMA-stimulated EPCR shedding, suggesting that using α-cyperone may be able to ameliorate vascular disease caused by EPCR shedding. We found that α-cyperone inhibits EPCR shedding via the PKC pathway, not MAPK signaling, in PMA-induced HUVECs.
Recently, it has been reported that many natural medicines could inhibit EPCR shedding. And in those studies, HUVECs were treated with 1 µM PMA to induce EPCR shedding. We observed that EPCR shedding was induced in a dose-dependent manner in the presence of PMA. However, no study demonstrated the role of α-cyperone in the EPCR shedding under the strong stimulation of PMA. In our study, we found that α-cyperone could inhibit EPCR shedding induced by 2 µM PMA. To clarify the molecular mechanisms underlying the α-cyperone effects on EPCR shedding induced by 2 µM PMA, we first tested the protein, mRNA level and activity of TACE in HUVECs. TACE has been reported to mediate a number of protein cleavage events,9–13) including EPCR8) and its function mainly depends on its activity and protein expression, which we found could be inhibited by α-cyperone. It is well known that TACE is regulated by MAPK signaling which has been reported that ERK and p38 could activate TACE,33,34) so we measured the effect of α-cyperone on the phosphorylation of MAPK induced by PMA. Unexpectedly, α-cyperone had no effect on the phosphorylation of MAPK induced by 2 µM PMA. This is obvious that α-cyperone inhibits PMA-induced EPCR shedding via another pathway.
Nothing that TACE-mediated receptor shedding also is regulated by PKC pathway, such as that of heparin binding-epidermal growth factor (EGF) release regulated by PKCδ and PKCα 11), PKCδ and PKCη involvement in interleukin (IL)-6 receptor cleavage,13) and shedding of tumor necrosis factor α (TNF-α) regulated by PKCδ,12) these studies provide further evidence that the PKC pathway plays a very important role in regulating TACE-mediated ectodomain shedding, and also PMA is a PKC activator. We hypothesized that PMA-induced EPCR shedding may be regulated by PKC pathway. To confirm our hypothesis, we measured the effect of a PKC inhibitor, BIS, on EPCR shedding stimulated by PMA, and found that 20 nM BIS could fully suppress EPCR shedding, suggesting that PKCα or PKCβ might regulate this event.31,32) Moreover, in HUVECs, it has been already reported that PKCα is involved in the regulation of VEGF35) the one is mediated by TACE.36,37) These results show that PKCα or PKCβ may be involved in the mechanism of TACE-mediated EPCR shedding induced by PMA, although further study is necessary. We have known that PKC translocation is a sign of PKC activation.16) Based on this foundation, then we measured the effect of α-cyperone on the translocation of PKC induced by PMA. We found that α-cyperone could inhibit the translocation of PKCα, phospho-PKCα/βII (Thr638/641) and phospho-PKCβII (Ser660) suggesting that α-cyperone inhibits PMA-induced activity and expression of TACE by mediating PKCα or PKCβ, thus suppressing EPCR shedding.
However, in the previous researches about the treatment of EPCR shedding, they only focused MAPK signaling due to ERK and p38 activation of TACE,33,34) but lose sight of PMA, a PKC activator. Importantly, our study showed that 1 µM PMA, the concentration used in those previous studies, did not induce the translocation of PKC obviously in a short time, but at concentrations of greater than 2 µM, PMA could induce this effect significantly (Supplementary Fig. 1). Furthermore, our data show that EPCR shedding, protein expression and activity of TACE, and PKC translocation existed in a dose-dependent manner in the presence of PMA, but phosphorylation of MAPK did not follow the same pattern. From these data, we hypothesized that the PKC pathway may play a key role in this mechanism of induced serious EPCR shedding. In this study, we have found that the PKC pathway plays an important role in regulation of EPCR shedding, and presents a novel method to study the mechanism of EPCR shedding.
In summary, we found that EPCR shedding is not only regulated by MAPK signaling but also PKC pathway. Our study showed that α-cyperone inhibits PMA-induced EPCR shedding through the down-regulation of both of mRNA and protein expression and activity of TACE via PKC pathway. Moreover, we find that PKC is a novel regulator of EPCR shedding through utilization of a PKC inhibitor. Noting that EPCR plays a crucial role in venous thromboembolism,38) our study reveals a new potential regulatory mechanism of EPCR shedding and a possible treatment of vascular inflammation disease by using α-cyperone.
This study was supported by the National Natural Science Foundation of China (No. 31302138) and the Open Project Program of Beijing Key Laboratory of Traditional Chinese Veterinary Medicine at Beijing University of Agriculture.
The authors declare no conflict of interest.
The online version of this article contains supplementary materials.
