Application of Human Induced Pluripotent Stem Cell-Derived Intestinal Organoids as a Model of Epithelial Damage and Fibrosis in Inflammatory Bowel Disease

Abstract

Inflammatory bowel disease, which typically manifests as Crohn’s disease and ulcerative colitis, is caused by the abnormal production of cytokines such as tumor necrosis factor (TNF)-α and transforming growth factor (TGF)-β. These cytokines damage intestinal epithelial cells and trigger fibrosis, respectively, for which the current in vitro models have many limitations. Therefore, we tested whether human induced pluripotent stem cell-derived intestinal organoids (HiOs) can mimic inflammatory bowel disease (IBD), and whether such a model is suitable for drug screening. HiOs were treated with TNF-α and TGF-β to construct mucosal damage and fibrosis models. TNF-α diminished the mRNA expression of intestinal epithelial cell and goblet cell markers in HiOs. TNF-α also induced epithelial cell damage and degradation of tight junctions but not in the presence of infliximab, an antibody used in the clinic to deplete TNF-α. Furthermore, permeation of the non-absorbable marker FD-4 was observed in HiOs treated with TNF-α or ethylene glycol tetraacetic acid (EGTA), but not in the presence of infliximab. In contrast, TNF-α and TGF-β induced mRNA expression of mesenchymal and fibrosis markers, as well as epithelial–mesenchymal transition. SB431542, a TGF-β inhibitor, significantly reversed these events. The data indicate that HiOs mimic mucosal damage and fibrosis due to IBD and are thus suitable models for drug screening.

INTRODUCTION

Inflammatory bowel disease (IBD), of which Crohn’s disease (CD) and ulcerative colitis (UC) are the two most common forms, constitutes a chronic remission disorder with an increasing incidence worldwide.¹⁾ IBD is associated with the hyperactivation of immune cells, with abundant secretion of some cytokines.^2,3) In particular, inflammatory cytokines, such as tumor necrosis factor-α (TNF-α), are produced by abnormally accelerated macrophages in CD, leading to the damage of intestinal epithelial cells.^4,5) The subsequent invasion of intestinal bacteria and the associated stimulation of the immune system further accelerate disease progression.⁶⁾ In fact, the disruption of epithelial cells is an important factor of the disease state.⁷⁾ Recently, treatment of patients with active IBD with the TNF-α inhibitor infliximab (IFX) was reported to reduce gut inflammation and epithelial damage.⁸⁾ However, there is yet to be an available therapy that promotes wound healing in IBD. Therefore, the development of new therapeutic options that can achieve mucosal healing in patients is required.⁵⁾

Intestinal fibrosis is also a common complication of IBD, such as in CD and UC, and is caused by chronic inflammation.^9,10) In particular, transforming growth factor-β (TGF-β) is a key profibrotic cytokine in the etiology of CD in human and animal models of intestinal fibrosis.^11,12) Epithelial-to-mesenchymal transition (EMT) is also one of the key mechanisms of intestinal fibrosis.^10,12) TGF-β-mediated induction of EMT and activated myofibroblasts are key effector cells in intestinal fibrosis and produce large amounts of collagen-rich extracellular matrix.¹³⁾ During EMT, epithelial cells gain mesenchymal cell markers such as vimentins and α-smooth muscle actin (α-SMA) while lose epithelial cell markers.¹⁴⁾ Excessive fibrosis results in fibrotic stenosis, which not only impairs the QOL but also necessitates surgery.¹⁵⁾ To develop drugs that also promote tissue wound healing, appropriate experimental models for intestinal fibrosis are needed to confirm their efficacy.

The current models for mucosal damage and fibrosis by IBD have many limitations for the screening of therapeutic drugs. In vitro models such as Caco-2, T-84, and CCD-18co cells cannot reflect the complex intestinal architecture.^16,17) In addition, they do not fully recapitulate the disease characteristics in humans, and they have limited utility for large-scale screening.¹⁸⁾ Recently, intestinal organoids, which are three-dimensional tissue structures, have attracted considerable attention and have been proposed as an important tool for research and treatment of intestinal diseases^19–21) owing to their structural resemblance to intestinal tissues.^22,23) Thus, intestinal organoids derived from human tissues are currently being used experimentally¹⁷⁾; however, they are obtained via invasive and difficult methods, resulting in insufficient supply for high-throughput screening. Therefore, intestinal organoids derived from human induced pluripotent stem (iPS) cells, obtained via less invasive procedures, are an attractive alternative.^24–26) For example, Rodansky et al.¹⁸⁾ reported a novel model of intestinal fibrosis using embryonic stem cell-derived intestinal organoids containing myofibroblasts, as well as diverse epithelial cells. However, they used the Matrigel-embedding method in intestinal organoid cultures, leading to scalability limitations and making it difficult to apply the method for high-throughput drug screening.²⁵⁾

In this study, we generated an IBD model using human iPS cell-derived intestinal organoids (HiOs) by treatment with TNF-α and TGF-β. In addition, we generated organoid suspensions without scaffolds for high-throughput drug screening.

MATERIALS AND METHODS

Materials

The following materials were procured from indicated commercial sources: Activin A, (PeproTech Inc., Rocky Hill, NJ, U.S.A.); BD Matrigel matrix growth factor reduced (Matrigel) and 40-µm nylon-mesh cell strainer, (BD Biosciences Co., Bedford, MA, U.S.A.); 6-[[2-[[4-(2,4-dichlorophenyl)-5-(5-methyl-1H-imidazol-2-yl)-2-pyrimidinyl]amino]ethyl]amino]-3-pyridinecarbonitrile (CHIR99021) and (+)-(R)-trans-4-(1-aminoethyl)-N-(4-pyridyl) cyclohexanecarboxamide dihydrochloride (Y-27632), (Focus Biomolecules, Plymouth Meeting, PA, U.S.A.); fibroblast growth factor (FGF) 4 and TNF-α, (BioLegend, San Diego, CA, U.S.A.); EZSPHERE (#900: microwell size: diameter 500 µm, depth 100 µm), AGC (Techno Glass Inc., Shizuoka, Japan); KnockOut serum replacement (KSR), Advanced Dulbecco’s modified Eagle medium/Ham’s F-12 (DMEM/F12), N2 supplement, B27 serum-free supplement, and SlowFade Diamond antifade mountant, (Thermo Fischer Scientific Inc., Waltham, MA, U.S.A.); fetal bovine serum (FBS), Nichirei (Biosciences Inc., Tokyo, Japan); FGF 2, R-spondin 1, noggin, and epidermal growth factor (EGF), (GenScript, Piscataway, NJ, U.S.A.); StemSure^® hPSC medium and SB431542, (Wako Pure Chemical Corporation, Osaka, Japan); 2-(2-amino-3-methoxyphenyl)4H-1-benzopyran-4-one (PD98059) and 3-(6-methyl-2-pyridinyl)-N-phenyl-4-(4-quinolinyl)-1H-pyrazole-1-carbothioamide (A-83-01), (AdooQ Bioscience, Irvine, CA, U.S.A.); 5-aza-2′-deoxycytidine, (Chem-Impex International, Inc., Wood Dale, IL, U.S.A.); IFX, (Novus Biologicals, Littleton, CO, U.S.A.); TGF-β1, (SinoBiological Inc., Beijing, China); OCT compound, (Sakura Finetech Japan Co., Ltd., Tokyo, Japan); fluorescein isothiocyanate-dextran 4000 (average molecular weight; 4000, FD-4), (Sigma-Aldrich, St. Louis, MO, U.S.A.); total RNA from human small intestine and colon samples (five donors), (BioChain Institute Inc., Newark, CA, U.S.A.); all other reagents were of the highest quality available.

Human iPS Cell Differentiation into Intestinal Organoids

A human iPS cell line (Windy) was cultured as previously reported.²⁷⁾ HiOs were generated from human iPS cells as reported by us earlier.²⁷⁾ Briefly, human iPS cells were passaged onto Matrigel-coated plates and cultured with StemSure^® hPSC medium supplemented with 35 ng/mL FGF2 before differentiation. After the cells reached 80% confluence, they were cultured with Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with FBS, 2 mM L-glutamine, 100 units/mL penicillin, 100 µg/mL streptomycin, and 100 ng/mL activin A for 3 d. The FBS concentration was gradually increased from 0 to 0.2 or 2.0%. Subsequently, the medium was replaced with RPMI 1640 medium containing 1% GlutaMAX, 2% FBS, 500 ng/mL FGF4 3 µM CHIR99021 for 4 d, and the cells were then trypsinized for 3 min and filtered through a 40-µm nylon-mesh cell strainer. Next, the cells (3.0 × 10⁶ cells) were seeded onto 10 cm EZSPHERE plates to generate spheroids and were cultured with 10 µM Y-27632 for 72 h, after which the spheroids were transferred to ultralow attachment plates, and after the passage, they were cultured with Advanced DMEM/F12 containing 3% Matrigel, 200 ng/mL R-spondin1, 100 ng/mL noggin, 100 ng/mL EGF, 1% Glutamax, 15 mM N-(2-hydroxyethyl)piperazine-N′-2-ethanesulfonic acid (HEPES), N2 supplement, B27 serum-free supplement, 100 units/mL penicillin, and 100 µg/mL streptomycin for 27 d. On days 19–34, 0.5 µM A-83-01, 20 µM PD98059, and 5 µM 5-aza-2′-deoxycytidine were added. The medium was changed every 3 d.

Generation of a Mucosal Damage Model

After day 34, the HiOs were cultured with Advanced DMEM/F12 containing 3% Matrigel, 200 ng/mL R-spondin1, 100 ng/mL noggin, 100 ng/mL EGF, 1% Glutamax, 15 mM HEPES, N2 supplement, B27 serum-free supplement, 100 units/mL penicillin, and 100 µg/mL streptomycin for 3 d. Then, to generate the IBD mucosal damage model, the HiOs were treated with TNF-α (30 ng/mL) with or without anti-TNF-α antibody (infliximab, 1 µg/mL) for 96 h. The medium was changed every day.

Generation of the IBD Fibrosis Model

After day 34, the HiOs were cultured with advanced DMEM/F12 containing 3% Matrigel, 200 ng/mL R-spondin1, 100 ng/mL noggin, 100 ng/mL EGF, 1% Glutamax, 15 mM HEPES, N2 supplement, B27 serum-free supplement, 100 units/mL penicillin, and 100 µg/mL streptomycin for 3 d. Then, to generate the IBD fibrosis model, the HiOs were treated with TNF-α (30 ng/mL) and TGF-β1 (2 ng/mL) with or without SB431542 (10 µM) for 48 h. The medium was changed every day.

RNA Extraction, Reverse Transcription Reaction, and Real-Time PCR Analysis

Total RNA was isolated from HiOs using the Agencourt RNAdvance Tissue Kit (Beckman Coulter Inc., Brea, CA, U.S.A.). First-strand cDNA was prepared from 0.5 µg of total RNA. The reverse-transcription reaction was conducted using the ReverTra Ace qPCR RT Master Mix (Toyobo, Shiga, Japan) according to the manufacturer’s instructions. Real-time PCR analysis was conducted on a LightCycler 96 Real-Time PCR system using LightCycler 96 S.W.1.1 software (Roche Diagnostics Inc., Basel, CA, U.S.A.). PCR was conducted with the primer pairs listed in Table 1 using a KAPA SYBR Fast qPCR Kit (Nippon Genetics Co., Tokyo, Japan). All mRNA expression levels were normalized relative to that of the housekeeping gene encoding hypoxanthine phosphoribosyltransferase 1 (HPRT1).

Table 1. Primers Used for Real-Time PCR Analysis

Gene name	Sense (5→3)	Antisense (5→3)	Product length (bp)
α-SMA	GCCTGAGGGAAGGTCCTAAC	CAGAGCCATTGTCACACACC	227
APOB	TTGCTGAAGAAAACCAAGAACTC	CCCTCTTGATGTTCAGGATGTAA	142
APOC3	CTCAGCTTCATGCAGGGTTAC	TAACGGTGCTCCAGTAGTCTTTC	148
Aquaporin 3	GATCAAGCTGCCCATCTACACC	CCATTGATCATATCCAAGTGTCCAG	186
CDX2	ACCTGTGCGAGTGGATGC	TCCTTTGCTCTGCGGTTCT	232
Chromogranin A	TCCGACACACTTTCCAAGCC	TTCTGCTGATGTGCCCTCTC	164
Collagen type 1	AAGAGGAAGGCCAAGTCGAG	AGATCACGTCATCGCACAAC	155
Fibronectin	TATGTGGTCGGAGAAACGTG	TCCTTGTGTCCTGATCGTTG	129
HPRT1	CTTTGCTTTCCTTGGTCAGG	TCAAGGGCATATCCTACAACA	148
IL-1β	GTGGCAATGAGGATGACTTGTTC	TAGTGGTGGTCGGAGATTCGTA	124
LGR5	TGCTCTTCACCAACTGCATC	CTCAGGCTCACCAGATCCTC	193
Lysozyme	TCAATAGCCGCTACTGGTGT	AATGCCTTGTGGATCACGGA	143
MUC2	AGAAGGCACCGTATATGACGAC	CAGCGTTACAGACACACTGCTC	137
MUC5B	GTTCCACCCGTCACTGTCTT	TCAGAGAACACGTAGTTGCAAAG	149
OLFM4	CAGACACCACCTTTCCCGTG	CCTTCTCCATGATGTCAATTCGG	171
SATB2	AACTGCTCAAAGAGATGAACCAG	ATGGCCCTCAGGTTTACTAGAAG	136
TNF-α	GGCAGTCAGATCATCTTCTCG	GCTGGTTATCTCTCAGCTCCAC	146
Villin	AGCCAGATCACTGCTGAGGT	TGGACAGGTGTTCCTCCTTC	169
Vimentin	AGGAAATGGCTCGTCACCTTCGTGAATA	GGAGTGTCGGTTGTTAAGAACTAGAGCT	440

Immunofluorescence Staining

HiOs treated with cytokines were fixed with 4% paraformaldehyde, frozen, and embedded in OCT compound. Frozen sections (10 µm) were cut and attached to glass slides. Antigen retrieval was performed with 10 mM citrate buffer (pH 8.0) in a microwave oven. After blocking in phosphate-buffered saline (PBS) containing 5% FBS for 30 min, sections were reacted with the primary antibodies at 4°C overnight, washed, and then incubated with secondary antibodies at room temperature for 1 h. Nuclei were stained with 4,6-diamidino-2-phenylindole (DAPI). The antibodies used and their dilutions are shown in Table 2. Finally, sections were washed and mounted using SlowFade Diamond antifade mountant, and confocal images were captured and analyzed using a Zeiss LSM510 microscope and AxioVision software (Carl Zeiss, Oberkochen, Germany).

Table 2. Primary and Secondary Antibodies

Antibody name	Source	Catalog number	Host animal	Dilution
α-SMA	Abcam	ab5694	Rabbit	1 : 200
Caspase-3 (cleaved)	Cell Signaling Technology	9661S	Rabbit	1 : 100
Chromogranin A	Immunostar	20085	Rabbit	1 : 500
CDX2	BioGenex	MU392A-UC	Mouse	1 : 100
E-cadherin	BD Transduction Laboratories™	610181	Mouse	1 : 100
LGR5	Abgent	AP2745d	Rabbit	1 : 100
Lysozyme	BioGenex	AR024-5R	Rabbit	—
MUC2	Santa Cruz	sc-15334	Rabbit	1 : 200
Occludin	Thermo Fisher Scientific	71-1500	Rabbit	1 : 100
Villin	Santa Cruz	sc58897	Mouse	1 : 100
Vimentin	Abcam	ab8069	Mouse	1 : 200
ZO-1	Thermo Fisher Scientific	RF236801	Mouse	1 : 100
Alexa Fluor® 488 donkey anti-Rabbit IgG (H&L)	Thermo Fisher Scientific	A-21206	Donkey	1 : 200
Alexa Fluor® 488 goat anti-Mouse IgG (H&L)	Thermo Fisher Scientific	A-11001	Goat	1 : 200
Alexa Fluor® 568 goat anti-Mouse IgG (H&L)	Thermo Fisher Scientific	A-11004	Goat	1 : 200
Alexa Fluor® 568 goat anti-Rabbit IgG (H&L)	Thermo Fisher Scientific	A-11011	Goat	1 : 200

FD-4 Permeability Study

As a positive control, the HiOs were treated with 2 mM ethylene glycol tetraacetic acid (EGTA) for 15 min to disrupt tight junctions. The vehicle, TNF-α, TNF-α + IFX, and EGTA treatment group HiOs were washed with Hanks’ balanced salt solution (HBSS; pH 7.4) and then incubated with HBSS containing 1 mg/mL FD-4 for 1 h at 37°C. After incubation, the HiOs were washed with ice-cold HBSS and then observed using an ECLIPSE Ti-S microscope (Nikon, Tokyo, Japan).

Quantification of Total Collagen

Total proteins were collected from the vehicle, TNF-α + TGF-β, and TNF-α + TGF-β + SB431542 treatment groups using T-PER Tissue Protein Extraction Reagent (Thermo Fischer Scientific Inc., Waltham, MA, U.S.A.) supplemented with 1% protease/phosphatase inhibitor cocktail (Cell Signaling Technology, Inc., Danvers, MA, U.S.A.). Total collagen was quantified using the Total Collagen Detection Kit (Chondrex Inc., Redmond, WA, U.S.A.). To correct for total collagen amount, the total protein amountwas measured using a Pierce BCA Protein Assay Kit (TaKaRa Bio, Shiga, Japan) according to the manufacturer’s instructions.

Statistical Analysis

For experiments involving HiOs, “n” represents the number of biological replicates (three wells were collected for each replicate). Each experiment was repeated on at least two separate occasions (independent experiments). Quantified data are represented as means ± standard deviation (S.D.) Statistical comparisons between groups were performed by one-way ANOVA with Dunnett’s two-tailed test (Figs. 1B, 4B, C, 6) using PASW statistics 18 software. Significant differences are indicated by p values listed in the figure legends.

RESULTS

Characteristics of HiOs

Previously, we succeeded in generating human and cynomolgus monkey iPS cell-derived intestinal organoids with pharmacokinetic function.^27,28) In this study, we generated HiOs using our method to induce intestinal differentiation. The HiOs formed highly uniform bubble-like structures (Fig. 1A). Immunofluorescence staining confirmed the existence of enterocytes, goblet cells, enteroendocrine cells, Paneth cells, intestinal stem cells, and mesenchymal cells, which were indicated by villin, mucin (MUC) 2, chromogranin A, lysozyme, leucine-rich repeat-containing G-protein–coupled receptor (LGR) 5, and α-SMA and vimentin, respectively (Fig. 1B). The HiOs included various intestinal epithelial cells and mesenchymal layers. In addition, the mRNA expression levels of small intestinal markers, apolipoprotein (APO) B and APOC3²⁵⁾ were much higher in the HiOs and small intestine than in the colon (Fig. 1C). Meanwhile, mRNA expression levels of the colon markers SATB homeobox (SATB) 2 and MUC5B²⁹⁾ were lower in the HiOs and small intestine than in the colon (Fig. 1C). Together, these observations suggested that the HiOs could be used as an in vitro IBD model.

Fig. 1. Characteristics of Human iPS Cell-Intestinal Organoids (HiOs)

(A) Morphology of HiOs. Scale bar, 500 µm. (B) Immunofluorescence staining of HiOs for various intestinal cell markers, namely villin and leucine-rich repeat containing G-protein-coupled receptor 5 (LGR5), caudal-type homeobox (CDX) 2 and MUC2, E-cadherin (E-cad) and chromogranin A, E-cad and lysozyme (Lyso), and vimentin (Vim) and α-SMA. Nuclei were counterstained with DAPI. Scale bar, 50 µm. (C) Comparison of HiOs with the small intestine and colon (mean ± S.D.; n = 3). The values for HPRT1 were used as normalization controls. The gene expression levels in the adult colon are taken as 1.

Generation of a TNF-α-Induced Mucosal Damage Model

The cytokine TNF-α is an important mediator of mucosal damage and contributes to enhanced intestinal epithelial permeability by stimulating apoptosis and disrupting tight junctions.^4,5) We investigated whether the HiOs can mimic the pathogenesis of IBD by treatment with 30 ng/mL TNF-α for 96 h. After treatment, we observed many HiOs without the lumen structure (Fig. 2A), suggesting that TNF-α collapsed the epithelial cell structure of the HiOs. In addition, mRNA expression levels of villin1 and MUC2 significantly decreased (Fig. 2B), which could be suppressed by treatment with IFX, an antibody of TNF-α used in clinical practice (Fig. 2B). There was no change in the mRNA expression of other intestinal cell marker genes (Fig. 2B). The mRNA expression levels of the inflammatory markers TNF-α and interleukin (IL)-1β, and intestinal stem cell marker olfactomedin (OLFM) 4 were significantly increased by TNF-α treatment, and their increase could be suppressed by IFX treatment (Fig. 2B). Immunofluorescence staining of the tight junction markers ZO-1 and occludin revealed that the structure of the tight junction was destroyed in the HiOs upon treatment with TNF-α (Fig. 3A) but not in the vehicle-treated or TNF-α + IFX-treated HiOs (Fig. 3A). The number of cells positive for the apoptosis marker caspase-3 was higher in the group treated with TNF-α than in the vehicle and TNF-α + IFX groups (Fig. 3B). In addition, caspase-3-positive cells were reduced in the lumen of HiOs (Fig. 3B). To further investigate the state of mucosal damage, we examined the effects of TNF-α on the permeability of the HiOs by exposing them to FD-4. The permeation of FD-4 into the HiOs was observed in treatment groups of TNF-α and EGTA but not in those of vehicle and TNF-α + IFX (Fig. 4). Together, these results suggested that the HiOs could reproduce the mucosal damage observed in IBD pathogenesis and are therefore suitable to evaluate the effect of therapeutic agents such as IFX.

Fig. 2. Characteristics of HiOs after Treatment with TNF-α

The HiOs were treated with TNF-α (30 ng/mL) with or without infliximab (IFX, 1 µg/mL) for 96 h. (A) Morphology of HiOs after treatment with TNF-α. Scale bar, 500 µm. (B) mRNA expression of intestinal and inflammatory markers in HiOs after treatment with TNF-α (means ± S.D.; n = 3). The values for HPRT1 were used as normalization controls. The gene expression levels in the adult colon are taken as 1. Differences relative to the TNF-α group were analyzed for statistical significance using Dunnett’s two-tailed test: * p < 0.05, ** p < 0.01.

Fig. 3. Immunofluorescence Staining of Tight Junction and Apoptosis Markers

HiOs were treated with TNF-α (30 ng/mL) with or without IFX (1 µg/mL) for 96 h. Images showing immunofluorescence staining for the tight junction proteins ZO-1 and occludin (A), and the apoptosis marker caspase-3 (Cas3) (B). White arrowheads show the collapse of the tight junctions. White arrows show the caspase-3-positive area. Nuclei were counterstained with DAPI. Scale bar, 50 µm.

Fig. 4. Permeability of FD-4

TNF-α administration induced FD-4 permeability in HiO. As a positive control, the HiOs were treated with 2 mM ethylene glycol tetraacetic acid (EGTA) for 15 min to disrupt tight junctions. After treatment with TNF-α or IFX for 96 h, the organoids were incubated with FD-4 (1 mg/mL) for 1 h at 37°C. Bright-field and fluorescence image. Scale bar, 50 µm.

Generation of a Fibrosis Model Using HiOs

Since TNF-α is known to stimulate TGF-β-induced EMT and chemotactic migration,³⁰⁾ we hypothesized that co-treatment of the HiOs with TNF-α and TGF-β might result in an induction of EMT. Treatment with 30 ng/mL TNF-α and 2 ng/mL TGF-β for 48 h led to increased numbers of disrupted HiOs compared with that in other treatment groups (Fig. 5A). In addition, the co-treatment significantly induced mRNA expression of the mesenchymal and fibrosis markers α-SMA, vimentin, fibronectin, and collagen type-1 in the HiOs (Fig. 5B). They also significantly induced mRNA expression of TNF-α and IL-1β (Fig. 5B). However, these induced gene expression levels, except that of α-SMA, were significantly suppressed by treatment with the TGF-β inhibitor SB431542 (Fig. 5B). There was no change in the expression levels of other intestinal cell marker genes (Fig. 5C). Immunofluorescence staining indicated the presence of epithelial cells expressing α-SMA and vimentin in the TNF-α + TGF-β group but not in the vehicle and TNF-α + TGF-β + SB431542 groups (Fig. 6A). In addition, the number of caspase-3-positive epithelial cells was more in the TNF-α + TGF-β group than in the vehicle and TNF-α + TGF-β + SB431542 groups (Fig. 6B). These results suggested that co-treatment of TNF-α and TGF-β induced EMT in the HiOs. EMT is known to generate activated mesenchymal cells, notably myofibroblasts that produce excessive amounts of collagen-rich extracellular matrix.³¹⁾ However, the production of total collagen did not change after treatment of HiOs with TNF-α and TGF-β, although treatment with SB431542 significantly suppressed the amount of total collagen (Fig. 7).

Fig. 5. Characteristics of HiOs after Treatment with TNF-α and TGF-β

The HiOs were treated with TNF-α (30 ng/mL) and TGF-β1 (2 ng/mL) with or without SB431542 (SB, 10 µM) for 48 h. (A) Morphology of HiOs after treatment with TNF-α and TGF-β. Scale bar, 500 µm. (B) mRNA expression of mesenchymal and fibrosis markers in HiOs after treatment with TNF-α (means ± S.D.; n = 3). The values for HPRT1 were used as normalization controls. The gene expression levels in the adult colon are taken as 1. Differences relative to the TNF-α and TGF-β group were analyzed for statistical significance using Dunnett’s two-tailed test: * p < 0.05, ** p < 0.01.

Fig. 6. Induction of Mesenchymal Phenotypic Changes by Treatment with TNF-α and TGF-β

The HiOs were treated with TNF-α (30 ng/mL) and TGF-β1 (2 ng/mL) with or without SB431542 (SB, 10 µM) for 48 h. Immunofluorescence staining of the mesenchymal markers α-SMA and vimentin (A), and the apoptosis marker caspase-3 (Cas) (B). White arrowheads show that epithelial cells are positive for α-SMA or vimentin expression. White arrows show the caspase-3-positive area. Nuclei were counterstained with DAPI. Scale bar, 50 µm.

Fig. 7. Changes in Total Collagen in HiOs by Treatment with TNF-α and TGF-β

The HiOs were treated with TNF-α (30 ng/mL) and TGF-β1 (2 ng/mL) with or without SB431542 (SB, 10 µM) for 48 h (means ± S.D.; n = 3). Differences relative to the TNF-α and TGF-β group were analyzed for statistical significance using Dunnett’s two-tailed test: * p < 0.05.

DISCUSSION AND CONCLUSION

In this study, using HiOs, we generated IBD models, including models for mucosal damage and intestinal fibrosis, by treatment with TNF-α and TGF-β. Unlike previously described in vitro intestinal models such as cancer-derived epithelial cell lines (Caco-2 and HT-29 cells), an important feature of the HiOs is that they more closely recapitulate epithelial cell diversity and functionality.^32,33) The intestinal organoids offer new possibilities to develop intestinal disease models and perform drug screening with in vivo physiology.^19,20,34) In addition, our differentiation protocol is more useful for application in high-throughput drug screening than conventional methods,^24,35) because we previously established a HiO suspension method to enable mass culture²⁷⁾ (Fig. 1).

The characteristics of the HiOs resembled those of the small intestine rather than the colon (Fig. 1). Recently, colonic organoids were generated from human iPS cells.³⁰⁾ The authors reported the differentiation into the small intestine by Noggin, and into the colon by bone morphogenetic protein (BMP) 2.³⁰⁾ Thus, we propose that our method can generate colonic organoids from human iPS cells by using BMP2 instead of Noggin to establish in vitro colonic disease models.

IBD is a distressing lifelong condition characterized by periods of intestinal inflammation and remission. The development of therapeutic methods and drugs to treat IBD is urgently required, as there are no therapeutic options that promotes wound healing. In the pathophysiology of IBD, cytokines such as TNF-α play an important role in the inflammatory process. The induction of TNF-α is associated with epithelial cell damage and goblet cell depletion.³⁶⁾ In addition, a previous study indicated that high expression of OLFM4, which is an intestinal stem cell marker, was maintained in CD patients.³⁷⁾ In this study, TNF-α decreased mRNA expression levels of villin1 and MUC2 (Fig. 2B), while those of inflammatory markers such as TNF-α, IL-1β, and OLFM4 significantly increased (Fig. 2B). Moreover, these expression changes were significantly suppressed by IFX, which is used in the clinical treatment of IBD (Fig. 2B). These results suggested that the HiOs could reproduce the pathological condition occurring in CD patients.

Immunofluorescence staining indicated that treatment with TNF-α led to the disruption of tight junction structures and the presence of apoptosis-positive cells, which likely extruded into the lumen (Fig. 3). Furthermore, the permeability of FD-4 was observed by treatment with TNF-α and the Ca²⁺-chelator EGTA, which disrupts tight junctions (Fig. 4). The effects of TNF-α on apoptosis and permeability were effectively inhibited by co-treatment with IFX (Figs. 3, 4). The collapse of tight junctions by epithelial damage, including apoptosis is a major mechanism by which TNF-α contributes to enhanced permeability,^8,38,39) suggesting that paracellular permeability of the HiOs is induced by TNF-stimulated apoptosis.

Intestinal fibrosis, for which there are no pharmacological therapies, is the cause for intestinal obstruction and surgical resection in most patients with CD.^10,40) TGF-β appears to play an important role in regulating the development, proliferation, and differentiation, as well as in the activation of intestinal mesenchymal cells and stimulation of extracellular matrix proteins synthesis, leading to intestinal fibrosis.^11,41) Moreover, EMT is associated with tissue regeneration and organ fibrosis.¹⁰⁾ Intestinal fibrosis is mediated by inflammatory cells and fibroblasts that release a variety of inflammatory signals, as well as components of the extracellular matrix such as collagens, laminins, elastin, and tenacins.³¹⁾ TNF-α can increase TGF-β-induced EMT, an important cellular process of fibrogenesis.³⁰⁾ In this study, the co-treatment of the HiOs with TNF-α and TGF-β significantly induced mRNA expression levels of mesenchymal and fibrosis markers such as α-SMA, vimentin, collagen type 1, and fibronectin (Fig. 5B). In addition, expression levels of TNF-α and IL-1β were markedly increased (Fig. 5B). Immunofluorescence staining confirmed the presence of epithelial cells expressing α-SMA, vimentin, and caspase-3 in the treatment group of TNF-α and TGF-β (Fig. 6). Thus, TNF-α and TGF-β co-treatment induced EMT and intestinal fibrosis along with apoptosis (Figs. 5, 6), indicating that the HiOs could mimic in vitro the pathology of EMT and intestinal fibrosis occurring in CD patients. However, the production of total collagen did not change by the treatment with TNF-α and TGF-β (Fig. 7), although the TGF-β inhibitor SB431542 significantly suppressed the amount of total collagen (Figs. 5, 7). Matrigel is generated from mouse sarcoma and therefore may contain carcinogenic factors and TGF-β along with various growth factors. In this study, we used a medium supplemented with 3% GFR-Matrigel, which contains TGF-β (approx. 1.7 ng/mL) and thus may promote collagen production. Therefore, the HiO culture method should be improved without Matrigel in the future.

Recently, it was reported that intestinal epithelial cells and immune cells such as macrophages and dendritic cells are important not only for preventing pathogen invasion but also for maintaining the homeostasis of intestinal immunity, and it was also proposed that their breakdown may be involved in the onset of IBD.⁴²⁾ In this study, we could not investigate the relationship between intestinal epithelial cells and immune cells. There is no report that intestinal organoids generated from human iPS cells include immune and endothelial cells. To generate a model closer to the human intestine, we need to establish HiOs containing these cells. Organ-on-chip and co-culture systems have been developed in recent years to recapitulate normal tissue-tissue interfaces.^17,43,44) We could construct a novel IBD model using these systems to investigate the impact of immune cells on the HiOs.

In conclusion, this study describes the use of HiOs to investigate mucosal damage and intestinal fibrosis associated with IBD. This model not only represents an efficient method for in vivo study of drugs against mucosal damage and intestinal fibrosis in IBD but also serves as a basis to develop a more effective human organoid IBD model. Furthermore, this culture method of HiOs would enable the screening of many anti-IBD drug candidates.

Acknowledgments

We thank Drs. Hidenori Akutsu, Yoshitaka Miyagawa, Hajime Okita, Nobutaka Kiyokawa, Masashi Toyoda, and Akihiro Umezawa for providing human iPS cells. This work was supported by grants from the Japan Society for the Promotion of Science [16K15164, 17K08421]; the Research on Development of New Drugs from Japan Agency for Medical Research and Development [17937834]; the Japan Research Foundation for Clinical Pharmacology; and a Grant-in-Aid for Research in Nagoya City University in 2018.

Conflict of Interest

Tamihide Matsunaga received a research grant from FUJIFILM Corporation and Nissan Chemical Corporation; Daichi Onozato, Takumi Akagawa, Yuriko Kida, Isamu Ogawa, Tadahiro Hashita and Takahiro Iwao have no conflict of interest.

REFERENCES

• 1) Holmberg FE, Seidelin JB, Yin X, Mead BE, Tong Z, Li Y, Karp JM, Nielsen OH. Culturing human intestinal stem cells for regenerative applications in the treatment of inflammatory bowel disease. EMBO Mol. Med., 9, 558–570 (2017).
• 2) Suenaert P, Bulteel V, Lemmens L, Noman M, Geypens B, Van Assche G, Geboes K, Ceuppens JL, Rutgeerts P. Anti-tumor necrosis factor treatment restores the gut barrier in Crohn’s disease. Am. J. Gastroenterol., 97, 2000–2004 (2002).
• 3) Papadakis KA, Targan SR. Role of cytokines in the pathogenesis of inflammatory bowel disease. Annu. Rev. Med., 51, 289–298 (2000).
• 4) Satsu H, Ishimoto Y, Nakano T, Mochizuki T, Iwanaga T, Shimizu M. Induction by activated macrophage-like THP-1 cells of apoptotic and necrotic cell death in intestinal epithelial Caco-2 monolayers via tumor necrosis factor-alpha. Exp. Cell Res., 312, 3909–3919 (2006).
• 5) Okamoto R, Watanabe M. Role of epithelial cells in the pathogenesis and treatment of inflammatory bowel disease. J. Gastroenterol., 51, 11–21 (2016).
• 6) Kaser A, Niederreiter L, Blumberg RS. Genetically determined epithelial dysfunction and its consequences for microflora-host interactions. Cell. Mol. Life Sci., 68, 3643–3649 (2011).
• 7) Bruewer M, Samarin S, Nusrat A. Inflammatory bowel disease and the apical junctional complex. Ann. N. Y. Acad. Sci., 1072, 242–252 (2006).
• 8) Schulzke JD, Ploeger S, Amasheh M, Fromm A, Zeissig S, Troeger H, Richter J, Bojarski C, Schumann M, Fromm M. Epithelial tight junctions in intestinal inflammation. Ann. N. Y. Acad. Sci., 1165, 294–300 (2009).
• 9) Andres PG, Friedman LS. Epidemiology and the natural course of inflammatory bowel disease. Gastroenterol. Clin. North Am., 28, 255–281, vii (1999).
• 10) Latella G, Sferra R, Speca S, Vetuschi A, Gaudio E. Can we prevent, reduce or reverse intestinal fibrosis in IBD? Eur. Rev. Med. Pharmacol. Sci., 17, 1283–1304 (2013).
• 11) Johnson LA, Rodansky ES, Haak AJ, Larsen SD, Neubig RR, Higgins PD. Novel Rho/MRTF/SRF inhibitors block matrix-stiffness and TGF-beta-induced fibrogenesis in human colonic myofibroblasts. Inflamm. Bowel Dis., 20, 154–165 (2014).
• 12) Rieder F, Kessler SP, West GA, Bhilocha S, de la Motte C, Sadler TM, Gopalan B, Stylianou E, Fiocchi C. Inflammation-induced endothelial-to-mesenchymal transition: a novel mechanism of intestinal fibrosis. Am. J. Pathol., 179, 2660–2673 (2011).
• 13) Andoh A, Bamba S, Brittan M, Fujiyama Y, Wright NA. Role of intestinal subepithelial myofibroblasts in inflammation and regenerative response in the gut. Pharmacol. Ther., 114, 94–106 (2007).
• 14) Powell DW, Mifflin RC, Valentich JD, Crowe SE, Saada JI, West AB. Myofibroblasts. II. Intestinal subepithelial myofibroblasts. Am. J. Physiol., 277, C183–C201 (1999).
• 15) Latella G, Caprilli R, Travis S. In favour of early surgery in Crohn’s disease: a hypothesis to be tested. J. Crohns Colitis, 5, 1–4 (2011).
• 16) Hahn S, Nam MO, Noh JH, Lee DH, Han HW, Kim DH, Hahm KB, Hong SP, Yoo JH, Yoo J. Organoid-based epithelial to mesenchymal transition (OEMT) model: from an intestinal fibrosis, perspective. Sci. Rep., 7, 2435 (2017).
• 17) Noel G, Baetz NW, Staab JF, Donowitz M, Kovbasnjuk O, Pasetti MF, Zachos NC. A primary human macrophage-enteroid co-culture model to investigate mucosal gut physiology and host-pathogen interactions. Sci. Rep., 7, 45270 (2017).
• 18) Rodansky ES, Johnson LA, Huang S, Spence JR, Higgins PD. Intestinal organoids: a model of intestinal fibrosis for evaluating anti-fibrotic drugs. Exp. Mol. Pathol., 98, 346–351 (2015).
• 19) Dedhia PH, Bertaux-Skeirik N, Zavros Y, Spence JR. Organoid models of human gastrointestinal development and disease. Gastroenterology., 150, 1098–1112 (2016).
• 20) Eglen RM, Randle DH. Drug discovery goes three-dimensional: Goodbye to flat high-throughput screening? Assay Drug Dev. Technol., 13, 262–265 (2015).
• 21) Liu F, Huang J, Ning B, Liu Z, Chen S, Zhao W. Drug discovery via human-derived stem cell organoids. Front. Pharmacol., 7, 334 (2016).
• 22) Sato T, Vries RG, Snippert HJ, van de Wetering M, Barker N, Stange DE, van Es JH, Abo A, Kujala P, Peters PJ, Clevers H. Single Lgr5 stem cells build crypt-villus structures in vitro without a mesenchymal niche. Nature, 459, 262–265 (2009).
• 23) Sato T, Stange DE, Ferrante M, Vries RG, Van Es JH, Van den Brink S, Van Houdt WJ, Pronk A, Van Gorp J, Siersema PD, Clevers H. Long-term expansion of epithelial organoids from human colon, adenoma, adenocarcinoma, and Barrett’s epithelium. Gastroenterology., 141, 1762–1772 (2011).
• 24) Spence JR, Mayhew CN, Rankin SA, Kuhar MF, Vallance JE, Tolle K, Hoskins EE, Kalinichenko VV, Wells SI, Zorn AM, Shroyer NF, Wells JM. Directed differentiation of human pluripotent stem cells into intestinal tissue in vitro. Nature, 470, 105–109 (2011).
• 25) Takahashi Y, Sato S, Kurashima Y, Yamamoto T, Kurokawa S, Yuki Y, Takemura N, Uematsu S, Lai CY, Otsu M, Matsuno H, Osawa H, Mizushima T, Nishimura J, Hayashi M, Yamaguchi T, Kiyono H. A refined culture system for human induced pluripotent stem cell-derived intestinal epithelial organoids. Stem Cell Reports, 10, 314–328 (2018).
• 26) Uchida H, Machida M, Miura T, Kawasaki T, Okazaki T, Sasaki K, Sakamoto S, Ohuchi N, Kasahara M, Umezawa A, Akutsu H. A xenogeneic-free system generating functional human gut organoids from pluripotent stem cells. JCI Insight, 2, e86492 (2017).
• 27) Onozato D, Yamashita M, Nakanishi A, Akagawa T, Kida Y, Ogawa I, Hashita T, Iwao T, Matsunaga T. Generation of intestinal organoids suitable for pharmacokinetic studies from human induced pluripotent stem cells. Drug Metab. Dispos., 46, 1572–1580 (2018).
• 28) Onozato D, Yamashita M, Fukuyama R, Akagawa T, Kida Y, Koeda A, Hashita T, Iwao T, Matsunaga T. Efficient generation of cynomolgus monkey induced pluripotent stem cell-derived intestinal organoids with pharmacokinetic functions. Stem Cells Dev., 27, 1033–1045 (2018).
• 29) Munera JO, Sundaram N, Rankin SA, Hill D, Watson C, Mahe M, Vallance JE, Shroyer NF, Sinagoga KL, Zarzoso-Lacoste A, Hudson JR, Howell JC, Chatuvedi P, Spence JR, Shannon JM, Zorn AM, Helmrath MA, Wells JM. Differentiation of human pluripotent stem cells into colonic organoids via transient activation of BMP signaling. Cell Stem Cell, 21, 51–64.e6 (2017).
• 30) Bates RC, Mercurio AM. Tumor necrosis factor-alpha stimulates the epithelial-to-mesenchymal transition of human colonic organoids. Mol. Biol. Cell, 14, 1790–1800 (2003).
• 31) Kalluri R, Weinberg RA. The basics of epithelial–mesenchymal transition. J. Clin. Invest., 119, 1420–1428 (2009).
• 32) Foulke-Abel J, In J, Yin J, Zachos NC, Kovbasnjuk O, Estes MK, de Jonge H, Donowitz M. Human enteroids as a model of upper small intestinal ion transport physiology and pathophysiology. Gastroenterology, 150, 638–649.e8 (2016).
• 33) Zachos NC, Kovbasnjuk O, Foulke-Abel J, In J, Blutt SE, de Jonge HR, Estes MK, Donowitz M. Human enteroids/colonoids and intestinal organoids functionally recapitulate normal intestinal physiology and pathophysiology. J. Biol. Chem., 291, 3759–3766 (2016).
• 34) Crespo M, Vilar E, Tsai SY, Chang K, Amin S, Srinivasan T, Zhang T, Pipalia NH, Chen HJ, Witherspoon M, Gordillo M, Xiang JZ, Maxfield FR, Lipkin S, Evans T, Chen S. Colonic organoids derived from human induced pluripotent stem cells for modeling colorectal cancer and drug testing. Nat. Med., 23, 878–884 (2017).
• 35) Finkbeiner SR, Freeman JJ, Wieck MM, El-Nachef W, Altheim CH, Tsai YH, Huang S, Dyal R, White ES, Grikscheit TC, Teitelbaum DH, Spence JR. Generation of tissue-engineered small intestine using embryonic stem cell-derived human intestinal organoids. Biol. Open, 4, 1462–1472 (2015).
• 36) Dharmani P, Leung P, Chadee K. Tumor necrosis factor-alpha and Muc2 mucin play major roles in disease onset and progression in dextran sodium sulphate-induced colitis. PLoS ONE, 6, e25058 (2011).
• 37) Suzuki K, Murano T, Shimizu H, et al. Single cell analysis of Crohn’s disease patient-derived small intestinal organoids reveals disease activity-dependent modification of stem cell properties. J. Gastroenterol., 53, 1035–1047 (2018).
• 38) Capaldo CT, Nusrat A. Cytokine regulation of tight junctions. Biochim. Biophys. Acta, 1788, 864–871 (2009).
• 39) Edelblum KL, Turner JR. The tight junction in inflammatory disease: communication breakdown. Curr. Opin. Pharmacol., 9, 715–720 (2009).
• 40) Spinelli A, Correale C, Szabo H, Montorsi M. Intestinal fibrosis in Crohn’s disease: medical treatment or surgery? Curr. Drug Targets, 11, 242–248 (2010).
• 41) Flier SN, Tanjore H, Kokkotou EG, Sugimoto H, Zeisberg M, Kalluri R. Identification of epithelial to mesenchymal transition as a novel source of fibroblasts in intestinal fibrosis. J. Biol. Chem., 285, 20202–20212 (2010).
• 42) Strober W, Fuss I, Mannon P. The fundamental basis of inflammatory bowel disease. J. Clin. Invest., 117, 514–521 (2007).
• 43) Kasendra M, Tovaglieri A, Sontheimer-Phelps A, Jalili-Firoozinezhad S, Bein A, Chalkiadaki A, Scholl W, Zhang C, Rickner H, Richmond CA, Li H, Breault DT, Ingber DE. Development of a primary human small intestine-on-a-chip using biopsy-derived organoids. Sci. Rep., 8, 2871 (2018).
• 44) Workman MJ, Gleeson JP, Troisi EJ, Estrada HQ, Kerns SJ, Hinojosa CD, Hamilton GA, Targan SR, Svendsen CN, Barrett RJ. Enhanced utilization of induced pluripotent stem cell-derived human intestinal organoids using microengineered chips. Cell. Mol. Gastroenterol. Hepatol., 5, 669–677.e2 (2018).