Garcinia Cambogia Extracts Prevented Fat Accumulation via Adiponectin-AMPK Signaling Pathway in Developing Obesity Rats

Abstract

This study was conducted to investigate the effect of Garcinia cambogia extracts on body weight gain and fat accumulation in rats rendered obese by a high fat diet. Results showed that Garcinia Cambogia extracts could significantly reduce body weight gain, Lee's index, BMI, the relative weight of epididymal fat, serum glucose, serum triglycerol, serum non-esterified fatty acid and hepatic triglycerol content in rats under high-fat diet, and hepatic lipase activity also was significantly increased in HFD+L group. Adipose triacylglyceride lipase mRNA expression level was significantly increased in the HFD+M and HFD+H groups, hepatic adenosine 5′-monophosphate-activated protein kinase (AMPK) α1 mRNA expression level in HFD+H group was significantly increased, adiponectin mRNA expression level in HFD+L group rats was increased, and adiponectin receptor 1 mRNA expression level was significantly increased in all Garcinia Cambogia extracts treated groups. These results demonstrated that Garcinia Cambogia extracts could attenuated fat accumulation and body weight gain in rat model with high-fat diet induced obesity possibly through regulation of lipolysis gene expression by affecting Adiponectin-AMPK signaling pathway.

Introduction

Obesity is a public health problem which is fast growing throughout the modern world. It is a serious risk factor for so-called lifestyle-related diseases such as diabetes, cardiovascular disease and hypertension (Jebb and Moore, 1999; Nakamura et al., 1994). In addition to exercise, it is well known that anti-obesity foods and food ingredients could control and reduce body weight. Some herbal products and plant extracts, such as Semen Cassiaem (Junbao et al., 2004), Panax ginseng berry extract(Attele et al., 2002), Singiber officinale Roscoe (Hasegawa, 2001), and Platycodi radix (Han et al., 2000) have been shown to exert anti-obesity effects in rodents with high fat diet induced obesity (Kim et al., 2007).

Garcinia cambogia is an edible fruit native to Southeast Asia (Saito et al., 2005). Its dried rind has been used for centuries throughout Southeast Asia as a food preservative, flavoring agent and carminative. Also, Garcinia cambogia extracts has been used as an ingredient of dietary supplements for weight loss. (-)-Hydroxycitric acid (HCA), a primary acid and the major active ingredient in the fruit rinds of Garcinia Cambogia (Lewis and Neelakantan, 1965), has been shown to suppress appetite, body weight gain and fat accumulation in both experimental animals and humans (Greenwood et al., 1981; Heymsfield et al., 1998; Ohia, 2002; Rao and Sakariah, 1988; Sullivan et al., 1974; Sullivan et al., 1977). HCA had been identified as a potent competitive inhibitor of the extra-mitochondrial enzyme adenosine triphosphate-citrate-lyase (Watson and Lowenstein, 1970), which catalyzes the cleavage of citrate in extra-mitochondrial to oxaloacetate and acetyl-CoA, a building block of fatty acids synthesis (Márquez, 2012). The inhibitory action of HCA induces the reduction of acetyl-CoA content, thus limiting the biosynthesis of fatty acids and cholesterol (Lowenstein, 1971; Sullivan et al., 1974). Also, the reduction of acetyl-CoA content could decrease the concentration of malonyl-CoA, which stimulates carnitine palmitoyltransferase I (CPT-1) activity and fatty acid oxidation (Ishihara et al., 2000; McCarty, 1994; Saha et al., 1999). Although some studies had revealed that HCA may suppress de novo fatty acid biosynthesis and appetite (Kovacs and Westerterp-Plantenga, 2006) and increase energy expenditure (Kim et al., 2008), subsequently reducing fat accumulation and body weight gain (Amin et al., 2011; Chuah et al., 2013) in experimental animals. Dietary supplements of Garcinia cambogia extracts, a potential therapy for fat deposition reduction, may be a practical way to reduce excessive fat accumulation in human or animal production. However, the precise physiological mechanism of HCA has not yet been full clarified, and the definitive conclusion that HCA supplements can be used as an efficient tool against fat deposition remains to be further investigated in various physiological state animal models.

The present study was conducted to investigate whether a long-term administration of Garcinia Cambogia extracts could prevent body weight gain and fat accumulation in Sprague-Dawley rats under fed high-fat diet, which could provide the evidence for using Garcinia Cambogia extracts to control body weight and curb obesity-related disease.

Materials and Methods

The extract of Garcinia cambogia    The Garcinia cambogia extracts containing (-)-HCA was obtained from An Yun Co.Ltd (Zhengzhou, China). The Garcinia cambogia contain 56% – 58% (−)-hydroxycitric acid including its free and lactone form, and it also contains 12% – 14% cellulose, 5.5% – 6% α-D-melibiose, 2.5% – 3% β-D-lactin, 1.5% – 2% D-mannopyranose, 11% – 12% oxophenic acid, 2% – 3% octadecyl alcohol, 3.5% – 4% Coenzyme A and 1.5 – 2% inorganic elements.

Animals and diets    Five-week old male Sprague-Dawley (SD) rats weighing 200 ± 20 g were purchased from Shanghai Experimental Animal Center of the Chinese Academy of Sciences (China). Rats were housed individually under conditions of constant temperature of 25°C and humidity of 50 – 60% and maintained on a 12 – 12 h light/dark cycle. All animal handling procedures were performed in strict accordance with guidelines established by Institutional Animal Care and Use Committee of Nanjing Agricultural University. Rats were acclimatized to the environment conditions for 1 week, and were then randomly assigned to one of five groups: normal diet control group(CD, n = 20), high-fat diet control group (HFD, n = 20), high-fat diet with low dose of Garcinia Cambogia extracts group (HFD+L, n = 20), high-fat diet with medium dose of Garcinia Cambogia extracts group (HFD+M, n = 20) and high-fat diet with high dose of Garcinia Cambogia extracts group (HFD+H, n = 20). Rats were fed either normal diet (3.57 kcal/g, calories provided by 24.6% protein, 16.4% fat and 59% Carbohydrate, formula GB14924. 3 – 2010, China) or high-fat diet (4.45 kcal/g, calories provided by 18% protein, 44% fat and 38% Carbohydrate). The CD group rats were fed normal diet, and HFD+L, HFD+M, HFD+H group rats were fed high-fat diet with supplement of Garcinia Cambogia extracts at 0, 25, 50 and 75 g/kg diet. The content of Garcinia Cambogia were equivalent to 0, 1000, 2000, 3000 mg/kg diet of HCA levels. Rats were fed ad libitum with free access to water for 8 weeks, diet was removed for the last 12 hours of the experimental term, and then the rats were sacrificed by decapitation. The blood samples were collected, the liver and epididymal fat were promptly weighed and then kept at –70°C until further analysis.

Measurement of serum lipid metabolic parameters    Serum contents of blood sugar, triglyceride (TG), total cholesterol (TC), high-density lipoprotein (HDL), and non-esterified fatty acid (NEFA) were measured using commercial kits (Nanjing Jiancheng Biotechnology Institution, China).

Measurement of liver lipid metabolic parameters    Hepatic TC and NEFA contents and hepatic lipase (HL) activity were estimated using commercial kits from Nanjing Jiangcheng Biotechnology Institution (China). A portion of the liver was homogenized, and the lipids were extracted with a mixture of chloroform-methanol (2:1 v/v) according to the method of Folch et al (Folch et al., 1957). TG content in the homogenates of liver was determined by enzymatic/colorimetric GPO-PAP kit (Dongou, China) following the manufacturer's protocols, and the optic density of the samples was measured using spectrophotometer in triplicate at a wavelength of 546 nm.

Determination the lipid metabolic gene mRNA level by Real-time PCR    Total RNA was extracted from hepatic and adipose samples using Trizol reagent (Takara, Japan) according to the manufacturer's protocol. The quality of RNA was checked by an Agilent 2100 Bionalyzer. Total RNA (1 ug) was reverse transcribed into cDNA using Superscript II kit (Invitrogen), according to the manufacturer's recommendations. Real-time PCR reactions were then carried out in a 20 µL reaction mixture (2 µL cDNA; 16 µL SYBR Green PCR Master Mix, 1 µL of a 0.5 µmol/L specific gene primer pair solution) in iCycler iQ Real Time Detection System (Bio-Rad, Hercules, USA). The PCR program was conduct with a 5 min reaction at 95°C before 40 thermal cycles of 10 sec each at 95°C, 5 sec at 60°C, and 30 sec at 72°C. Fold change was calculated using the 2^−ΔΔCT method. The primer for β-actin (use as an internal control) and lipid metabolic genes are listed in Table 1. The primers of fatty acid synthesis (FAS), ATP-citrate lyase (ACY), Acyl-CoA oxidase (ACO), adipose triglyceride lipase (ATGL), Adenosine 5'-monophosphate-actvated protein kinase (AMPK) and adiponectin receptor (AdipoR) were determined according to the published guideline (Chen et al., 2009) or designed by Primers Premier 5 and synthesized by Invtrogen Biological Company (China).

Table 1. Prime sequence of β-actin and targeted gene

Gene	Genebank accession Number	Primer sequences (5′-3′)	Orientation	Product size (bp)
β-actin	NM_031144	CCCTGTGCTGCTCACCGA	Forward	186
		CAGTGTGGGTGACCCCGTC	Reverse
FAS	NM_017332	GGACATGGTCACAGACGATGAC	Forward	94
		GTCGAACTTGGACAGATCCTTCA	Reverse
ACL	NM_016987	TGGACGCCACTGCT	Forward	83
		TGGGTATGCCTCACG	Reverse
ACO	NM017340	CTTTCTTGCTTGCCTTCCTTCTCC	Forward	415
		GCCGTTTCACCGCCTCGTA	Reverse
ATGL	EU357899	TCACCAACACCAGCATCCA	Forward	197
		GCACATCTCTCGAAGCACCA	Reverse
AMPKα1	NM_019142.2	CGCAGACTCAGTTCCT	Forward	132
		CTTGCCCACCTTCACT	Reverse
AMPKα2	NM_023991.1	CCTCGGTCAAGTGTCG	Forward	174
		GGGTTATCAACGGGCTA	Reverse
Adiponectin	NM_144744	TGGCAGAGATGGCACTCC	Forward	101
		CTTCCGCTCCTGTCATTCC	Reverse
AdipoR1	NM_207587.1	GGCTGAAAGACAATGACTAC	Forward	156
		TCAAGATTCCCAGAAAGAG	Reverse
AdipoR2	XM_232323	CACAACCTTGCTTCATCTACC	Forward	222
		TGAGCATTAGCCAGCCTATC	Reverse

Statistical Analyses    The data are analyzed using the Statistical Package for Social Sciences (SPSS; Chicago, IL, USA). The T-test was applied to compare with different diet control groups, and one-way analysis of variance (ANOVA) was used for the different group with fed the same die. A value of P < 0.05 was considered statistically significant.

Results

Impact of Garcinia Cambogia extracts on body weight and epididymal fat    As shown in Fig.1, rats in the HFD group attained 305.50 ± 7.75 g of cumulative body weight gain in 8 weeks, significantly higher than the body weight gain in CD group (P < 0.01). Rats in HFD group are obesity when compared with CD group which indicated as body mass index (BMI), Lee's index (mathematically, Lee's index is expressed as:) and relative weight of epididymal fat in HFD group were significantly higher than that in CD group (P < 0.01). Average daily feed intake was significantly increased in the HFD+M and HFD+L diet groups than that in HFD diet group (P < 0.01). Diet supplementation with different dose of Garcinia Cambogia extracts could significantly reduce body weight gain, Lee's index, BMI and relative weight of epididymal fat in rats under high-fat diet (P < 0.01).These results indicated that Garcinia Cambogia extracts could prevent body weight gain and fat accumulation in the rats fed with high-fat diet.

Fig. 1.

Impact of Garcinia Cambogia extracts average daily feed intake, on body weight gain, BMI and Lee's index

A: average dialy feed intake; B: body weight gain; C: Lee's index; D: body mass index (BMI); E: relative weight of epididymal fat. CD = normal diet group; HFD = high-fat diet group; HFD+L = high-fat diet with low dose of Garcinia Cambogia extracts-supplemented group; HFD+M = high-fat diet with middle dose of Garcinia Cambogia extracts-supplemented group; HFD+H = high-fat diet with high dose of Garcinia Cambogia extracts-supplemented group. Values are means ± SEM, n = 20. **P < 0.01 and *P < 0.05, compared to CD group values. ## P < 0.01 and # P < 0.05, compared to HFD group values.

Effect of Garcinia Cambogia extracts on serum lipid parameters    No statistical differences were observed on the contents of serum TG, glucose and NEFA between HFD and CD groups, while TC content was significantly higher in HFD group than that in CD group (P < 0.05) (Fig.2). Serum TG content was significantly lower in HFD+M (P < 0.05) and HFD+H (P < 0.01) groups (Fig.2A), and the NEFA content was significantly decreased in HFD+M (P < 0.05) and HFD+H (P < 0.05) groups (Fig.2B) when compared to those of the HFD rats. Compared to HFD group, dietary supplementation with different doses of Garcinia Cambogia extracts could significantly decrease serum glucose content in rats under fed high-fat diet (P < 0.05) (Fig.2C). No significant changes was observed on TC content in Garcinia Cambogia extracts treated groups than that in CD group (P > 0.05) (Fig.2D).

Fig. 2.

Effect of Garcinia Cambogia extracts on serum lipid parameters

A: Serum triglyceride content; B: serum NEFA content; C: Serum glucose content; D: Serum total cholesterol content. CD = normal diet group; HFD = high-fat diet group; HFD+L = high-fat diet with low dose of Garcinia Cambogia extracts-supplemented group; HFD+M = high-fat diet with middle dose of Garcinia Cambogia extracts-supplemented group; HFD+H = high-fat diet with high dose of Garcinia Cambogia extracts-supplemented group. Values are means ± SEM, n = 20. **P < 0.01 and *P < 0.05, compared to CD group values. ## P < 0.01 and # P < 0.05, compared to HFD group values.

Effect of Garcinia Cambogia extracts on hepatic lipid parameters    Hepatic TG and TC contents were significantly increased, while HL activity was significantly decreased in the HFD group than that in CD group (P < 0.01) (Fig.3). Compared with HFD group, dietary supplementation with different dose of Garcinia Cambogia extracts could significantly reduce hepatic TG content in rats under fed high-fat diet (P < 0.05) (Fig.3A), while no statistical differences were observed on TC content (P > 0.05) (Fig.3B). The HL activity was significantly increased in the HFD+L group when compared to HFD group (P < 0.05) (Fig.3C).

Fig. 3.

Effect of Garcinia Cambogia extracts on hepatic lipid parameters

A: Triglyceride content; B: Total cholesterol content; C: Hepatic lipase activity. CD◊normal diet group; HFD = high-fat diet group; HFD+L = high-fat diet with low dose of Garcinia Cambogia extracts-supplemented group; HFD+M = high-fat diet with middle dose of Garcinia Cambogia extracts-supplemented group; HFD+H = high-fat diet with high dose of Garcinia Cambogia extracts-supplemented group. Values are means ± SEM, n = 20. **P < 0.01 and *P < 0.05, compared to CD group values. ## P < 0.01 and # P < 0.05, compared to HFD group values.

Effect of Garcinia Cambogia extracts on hepatic lipid metabolic related gene expression    ACL, FAS and ACO mRNA levels were significantly decreased in the HFD group than that in CD group (P < 0.01), while no significant differences was observed on the ATGL mRNA level in the HFD group when compared to CD group (P > 0.05) (Fig.4). Dietary supplementation of Garcinia Cambogia extracts did not affected on the ACL, FAS and ACO mRNA levels in the liver of rats under fed high-fat diet (P > 0.05) (Fig.4A–C), while the ATGL mRNA level was significantly increased in the HFD+M (P < 0.05) and HFD+H groups (P < 0.01) when compared to HFD group (Fig.4D).

Fig. 4.

Effect of Garcinia Cambogia extracts on hepatic lipid metabolism related gene mRNA expression level.

A: ACL mRNA expression level; B: FAS mRNA expression level; C: ACO mRNA expression level; D: ATGL mRNA expression level. CD = normal diet group; HFD = high-fat diet group; HFD+L = high-fat diet with low dose of Garcinia Cambogia extracts-supplemented group; HFD+M = high-fat diet with middle dose of Garcinia Cambogia extracts-supplemented group; HFD+H = high-fat diet with high dose of Garcinia Cambogia extracts-supplemented group. Values are means ± SEM, n = 20. **P < 0.01 and *P < 0.05, compared to CD group values. ## P < 0.01 and # P < 0.05, compared to HFD group values.

Effect of Garcinia Cambogia extracts on AMPKa1 and AMPKa2 mRNA levels    AMPK α2 (P < 0.01) mRNA levels was significantly decreased in the HFD group than that in CD group, while no difference was observed on the AMPK α1 mRNA level (P < 0.05) (Fig.5). The AMPK α1 mRNA level in livers of rats supplemented low and high dose of Garcinia Cambogia extracts was significantly higher than that in HFD group (P < 0.05) (Fig.5A), while the AMPK α2 mRNA level has no significant changes (P > 0.05) (Fig.5B).

Fig. 5.

Effect of Garcinia Cambogia extracts on AMPKα1 and AMPKα2 mRNA expression levels.

A: AMPKα1 mRNA expression level; B: AMPKα2 mRNA expression level. CD = normal diet group; HFD = high-fat diet group; HFD+L=high-fat diet with low dose of Garcinia Cambogia extracts-supplemented group; HFD+M = high-fat diet with middle dose of Garcinia Cambogia extracts-supplemented group; HFD+H = high-fat diet with high dose of Garcinia Cambogia extracts-supplemented group. Values are means ± SEM, n = 20. **P < 0.01 and *P < 0.05, compared to CD group values. ## P < 0.01 and # P < 0.05, compared to HFD group values.

Effect of Garcinia Cambogia extracts on adiponectin and adiponectin receptor mRNA levels    Although no significant difference was observed on the adiponectin mRNA level in epididymal of CD group rats than that in HFD group, while the AdipoR1 and AdipoR2 mRNA levels in liver were significantly decreased in the HFD group when compared to CD group (P < 0.01) (Fig.6). The adiponectin mRNA level in epididymal of HFD+L group rats was higher than that in HFD group (P < 0.05) (Fig.6A). Dietary supplementation of different doses of Garcinia Cambogia extracts could enhance the adipoR1 mRNA level in the liver of rats under fed high-fat diet (P < 0.05) (Fig.6B), while no change was observed on the adipoR2 mRNA level (P > 0.05) (Fig.6C).

Fig. 6.

Effect of Garcinia Cambogia extracts on adiponectin and adiponectin receptor mRNA expression levels.

A: Adiponectin mRNA expression levels; B: AdipoR1 mRNA expression levels; C: AdipoR2 mRNA expression levels. CD = normal diet group; HFD = high-fat diet group; HFD+L = high-fat diet with low dose of Garcinia Cambogia extracts-supplemented group; HFD+M = high-fat diet with middle dose of Garcinia Cambogia extracts-supplemented group; HFD+H = high-fat diet with high dose of Garcinia Cambogia extracts-supplemented group. Values are means ± SEM, n = 20. **P < 0.01 and *P < 0.05, compared to CD group values. ## P < 0.01 and # P < 0.05, compared to HFD group values.

Discussion

Present results showed that the body weight, Lee's index and BMI were significantly higher in the rats with fed high-fat diet than the rats under fed normal diet. This result is similar with previous report that feeding high-fat diet results in enhancement of body weight, Lee's index and BMI in rodents. Adiposity was determined by Lee's index, which is the cubic root of body weight in grams divided by the naso-anal length in millimeters multiplied by 104. The Lee's index and BMI are highly correlated with the percentage of body fat (Adeneye et al., 2010). Also, our results showed that the relative weight of epididymal fat and triglyceride content were significantly increased in rats under fed high-fat diet than the rats under normal diet. These results indicated that the high-fat diet in our experiment was rendered rat obesity, and this result warrants our further study.

Numerous studies have shown an association between Garcinia Cambogia extracts treatment and obesity control and other metabolic effects, such as inhibiting fat accumulation and dyslipidemia (Kim et al., 2007; Roy et al., 2003; Roy et al., 2007; Saito et al., 2005). In the present study, we investigated the anti-obesity effect of Garcinia Cambogia extracts in rats under fed high-fat diet and the possible mechanism of this action. The body weight gain, Lee's index, relative weight of epididymal fat, and triglyceride concentrations in serum and hepatic were significantly decreased in dietary supplementation of Garcinia Cambogia extracts to rats under fed high-fat diet. This observation concurs with the finding of Kim et al (Kim et al., 2007), who reported that Garcinia Cambogia extracts could reduce the accumulation of visceral fat mass and triglyceride content in rats rendered obese by a high fat diet. As a weight loss agent, many studies had reported that (-)-HCA, the principal acid and the major active ingredient of Garcinia Cambogia extracts, safely promote weight loss in laboratory animals (Kang et al., 2007; Kim et al. 2004) and humans (Kim et al., 2011; Márquez, 2012), and suggested food intake regulation may be a major mechanism of weight loss by Garcinia Cambogia extracts-induced (Louter-van de Haar et al., 2005). Present study showed that supplemental with median and high dose of Garcinia Cambogia extracts could increase the average daily feed intake was observed in rats under fed high-fat diet. This results was contract with previous reported that supplemented with HCA could reduce food intake of rats with high glucose+fat diet (Kim et al., 2008). Also, it had reported that no significant treatment effects were observed on appetite indices in the diet supplemented with HCA (Kovacs et al., 2001). Combined with previous reported, we presumed that the differences in the experimental setups such as the nutrient contents of diet, the preparation or extraction of HCA, the rat strains and physiology state of rats could contribute to such the discrepancy. In our study, the increasing of average daily feed intake indicated that suppressive effect of Garcinia Cambogia extracts on body weight in rats is not via regulating the feed intake. Also, it is well known that the decrease in body weight gain is caused not only by a decrease in food intake but also an increase in energy expenditure is involved. Previous study had showed that Garcinia Cambogia extracts could enhance energy expenditure in rats (Vasselli et al., 1998). It had reported that the suppressive effect of Garcinia Cambogia extracts on body weight regain cannot only be due to a reduction in food intake, presumably also increased thermogenesis (Leonhardt et al., 2001). Although we did not measure energy expenditure, but an increasing in feed intake provides indirect evidence for that rats supplemental with Garcinia Cambogia extracts were less efficient in using the food energy for the accretion of body mass, which suggests that energy expenditure was increased. Previous studies also reported that the Garcinia Cambogia extracts could remarkably reduce body weight gain, visceral fat accumulation, and serum lipid concentration in high-fat diet-induced obesity rats (Kim et al., 2008; Kim et al., 2004). Hepatic lipase catalyzes the hydrolysis of triacylglycerol and mediates the removal of lipoprotein from plasma, which results in the reduction of serum triacylglycerol. Consistent with the decreasing of serum triacylglycerol, present study also found that Garcinia Cambogia extracts could significantly enhance the hepatic lipase activity in rats under fed high-fat diet. The above data verified that Garcinia Cambogia extracts could effectively prevent body weight gain and fat accumulation in rats with by high-fat diet.

It is reported that HCA could inhibit ACL (Sullivan et al., 1977) which decreases the transformation of citrate into acetyl CoA, an essential building block for cholesterol and triacylglycerol biosynthesis. In this study, the decrease of serum NEFA and triacylglycerol contents in dietary supplementation of Garcinia Cambogia extracts to rats under fed high-fat diet supports that HCA-containing Garcinia Cambogia could inhibit the activity of ACL and then suppress de novo fatty acid synthesis, even though ACL mRNA level has no significant changes. This may be due to Garcinia Cambogia extracts inhibit the ACL activity rather than its mRNA levels, and the precise mechanism need further investigation. Lipid metabolism is a complex process and controlled by expression of genes related lipogenesis and lipolysis (Brun et al., 1997). FAS is a key enzyme that catalyzes the synthesis of long-chain fatty acid (Wakil, 1989). Present study found that FAS mRNA level was significantly decrease in rats only fed high-fat diet, supplemental with Garcinia Cambogia extracts has no any effect on the FAS mRNA level in rats under fed high-fat diet. These results hinted that exogenous fat intake might dramatically down regulation of ACL and FAS expression which resulting in the inhibition of endogenous triglycerides synthesis, while supplemental with Garcinia Cambogia extracts had no effect on the synthesis of endogenous triglycerides in rats under fed high-fat diet. ATGL is the rate-limiting enzyme of lipolysis that hydrolyzes triglycerides to diglycerides (Zimmermann et al., 2004) and ACO is the first-step enzyme in peroxisomal that catalyzes the β-oxidation of fatty acid (Ishii, Ishii, Suga & Kazama, 1985). It has been demonstrated that triglyceride storage and fatty acid release are mainly influenced by the expression of ATGL in the basal state (Miyoshi et al., 2008). It has been shown that ATGL is down-regulated in mouse models of obesity (Villena et al., 2004). Present study showed that dietary supplement of Garcinia Cambogia extracts has no affected on the ACO mRNA level in rats fed high-fat diet, while dietary supplement of median and high dose of Garcinia Cambogia extracts could significantly increase the ATGL mRNA level in the liver of rats fed high-fat diet. Together with the reduction of abdominal fat, we presumed that dietary supplement of Garcinia Cambogia extracts possibly could accelerate the lipolysis of exogenous triglyceride rather than suppress the synthesis of endogenous triglycerides which eventually results in the decrease of abdominal fat deposition in rats under high-fat diet. However, elucidation of the precise effects of Garcinia Cambogia extracts on the gene involved in triglycerides metabolism needs further investigation.

AMPK plays an important role in the regulation of lipid and cholesterol metabolism. When AMPK is activated, it switches on lipid catabolic pathways while switching off lipid biosynthetic pathways. Some key factors in the process of lipid metabolism, such as FAS and ATGL are the downstream factors of AMPK (Chen et al., 2012). Present study found that AMPKα2 mRNA levels tend to increased, and AMPKα1 mRNA levels were significantly increased in rats under high-fat diet treated with low and high dose of Garcinia Cambogia extracts. Adiponectin is an adipocyte-derived plasma protein and it plays an important role in the regulation of glucose and lipid metabolism and body weight (Arita et al., 1999). Yamauchi et al. (Yamauchi et al., 2003) found that adiponectin had two different isoforms receptors (AdipoR1 and AdipoR2) (Fasshauer et al., 2004). In this study, we found that Garcinia Cambogia extracts could enhance the adiponectin and AdipoR1 mRNA levels in rats under high-fat diet. In vitro, both isoforms of adiponectin receptor can mediate increased AMPK phoshorylation ligand activity by adiponectin binding (Yamauchi et al., 2003). These result indicated that Garcinia Cambogia extracts could activated the Adiponectin-AMPK signaling pathway which resulted in the increasing of ATGL mRNA level, and then decreased the fat accumulation in rats under high-fat diet. The decrease of serum lipid also supports this speculation.

In conclusion, our findings demonstrated that Garcinia Cambogia extracts could attenuated fat accumulation and body weight gain in rat obesity model induced by high-fat diet possibly through regulation lipolysis gene and it could achieved by activating the Adiponectin-AMPK signaling pathway.

Conflict of interest

All the authors declare no conflict of interest.

Acknowledgments    This work was supported by the National Natural Science Foundation of China (NO. 31572483) and Priority Academic Program Development of Jiangsu Higher Education Institutions (PAPD).

Abbreviations

ACL

ATP-citrate lyase

ACO

Acyl-CoA oxidase

AdipoR1

adiponectin receptor 1

AdipoR2

adiponectin receptor 2

AMPK

adenosine 5′-monophosphate-actvated protein kinase

ATGL

adipose triglyceride lipase

BMI

body mass index

CPT-I

carnitine palmitoyltransferase-I

FAS

fatty acid synthesis

HCA

hydroxycitric acid

HDL

high-density lipoprotein

HL

hepatic lipase

NEFA

nonesterified fatty acid

TC

total cholesterol

TG

triglycerol

References

•  Adeneye,  A. A.,  Adeyemi,  O. O., and  Agbaje,  E. O. (2010). Anti-obesity and antihyperlipidaemic effect of Hunteria umbellata seed extract in experimental hyperlipidaemia. Journal of Ethnopharmacology, 130, 307-314.
•  Amin,  K. A.,  Kamel,  H. H., and  Eltawab,  M. A. A. (2011). Protective effect of Garcinia against renal oxidative stress and biomarkers induced by high fat and sucrose diet. Lipids in Health and Disease, 10, 133-143.
•  Arita,  Y.,  Kihara,  S.,  Ouchi,  N.,  Takahashi,  M.,  Maeda,  K.,  Miyagawa,  J.,  Hotta,  K.,  Shimomura,  I.,  Nakamura,  T., and  Miyaoka,  K. (1999). Paradoxical Decrease of an Adipose-Specific Protein, Adiponectin, in Obesity. Biochemical and Biophysical Research Communications, 257, 79-83.
•  Attele,  A.,  Zhou,  Y.,  Xie,  J.,  Wu,  J.,  Zhang,  L.,  Dey,  L.,  Pugh,  W.,  Rue,  P.,  Polonsky,  K., and  Yuan,  C. (2002). Antidiabetic Effects of Panax ginseng Berry Extract and the Identification of an Effective Component. Diabetes, 51, 1851-1858.
•  Brun,  R.,  Kim,  J.,  Hu,  E., and  Spiegelman,  B. (1997). Peroxisome proliferator-activated receptor gamma and the control of adipogenesis. Current Opinion in Lipidology, 8, 212-218.
•  Chen,  N.,  Bezzina,  R.,  Hinch,  E.,  Lewandowski,  P.,  Cameron-Smith,  D.,  Mathai,  M.,  Jois,  M.,  Sinclair,  A.,  Begg,  D., and  Wark,  J. (2009). Green tea, black tea, and epigallocatechin modify body composition, improve glucose tolerance, and differentially alter metabolic gene expression in rats fed a high-fat diet. Nutr Res, 29, 784-793.
•  Chen,  W.,  Chen,  Y.,  Chiang,  Y.,  Wang,  S., and  Lee,  H. (2012). Fenofibrate lowers lipid accumulation in myotubes by modulating the PPARα/AMPK/FoxO1/ATGL pathway. Biochem Pharmacol, 84, 522-531.
•  Chuah,  L.,  Ho,  W.,  Beh,  B., and  Yeap,  S. (2013). Updates on Antiobesity Effect of Garcinia Origin (-)-HCA. Evid Based Complement Alternat Med, 2013, 751658. doi: 10.1155/2013/751658.
•  Fasshauer,  M.,  Klein,  J.,  Kralisch,  S.,  Klier,  M.,  Lössner,  U.,  Blüher,  M., and  Paschke,  R. (2004). Growth hormone is a positive regulator of adiponectin receptor 2 in 3T3-L1 adipocytes. FEBS Letters, 558, 27-32.
•  Folch,  J.,  Lees,  M., and  Stanley,  G. H. S. (1957). A simple method for the isolation and purification of total lipides from animal tissues. Journal of Biological Chemistry, 226, 497-509.
•  Greenwood,  M. R.,  Cleary,  M. P.,  Gruen,  R.,  Blase,  D.,  Stern,  J. S.,  Triscari,  J., and  Sullivan,  A. C. (1981). Effect of (-)-hydroxycitrate on development of obesity in the Zucker obese rat. The American journal of physiology, 240, E72-78.
•  Han,  L.,  Xu,  B.,  Kimura,  Y.,  Zheng,  Y., and  Okuda,  H. (2000). Platycodi radix affects lipid metabolism in mice with high fat diet-induced obesity. J Nutr, 130, 2760-2764.
•  Heymsfield,  S.,  Allison,  D.,  Vasselli,  J.,  Pietrobelli,  A.,  Greenfield,  D., and  Nunez,  C. (1998). Garcinia cambogia (hydroxycitric acid) as a potential antiobesity agent: a randomized controlled trial. Jama-Journal of the American Medical Association, 280, 1596-1600.
•  Ishihara,  K.,  Ohara,  S., and  Yamamoto,  H. (2000). Direct condensation of carboxylic acids with alcohols catalyzed by Hafnium(IV) salts. Science, 290, 1140-1142.
•  Ishii,  H.,  Ishii,  S.,  Suga,  T., and  Kazama,  M. (1985). Developmental changes in the activities of peroxisomal and mitochondrial beta-oxidation in chicken liver. Archives of Biochemistry and Biophysics, 237, 151-159.
•  Jebb,  S. and  Moore,  M. (1999). Contribution of a sedentary lifestyle and inactivity to the etiology of overweight and obesity: current evidence and research issues. Medicine & Science in Sports & Exercise, 31, S534-541.
•  Junbao,  Y. L. J.,  Jiangbi  W,  Yonghui  D,  Tianzhen  Z,  Songyi  Q., and  L,  W. (2004). Inhibitive Effect of Semen Cassiae on the Weight Gain in Rats with Nutritive Obesity. Journal of Chinese Medicinal Materials, 27, 281- 284.
•  Kang,  D.H.,  Jung,  E.Y.,  Chang,  U.J.,  Bae,  S.-H., and  Suh,  H.J. (2007) Psyllium husk combined with hydroxycitrate reduces body weight gain and body fat in diet-induced obese rats. Nutrition Research, 27, 349-355.
•  Kim,  K.,  Lee,  H.,  Kim,  Y., and  Park,  T. (2008). Garcinia cambogia extract ameliorates visceral adiposity in C57BL/6J mice fed on a high-fat diet. Biosci Biotechnol Biochem, 72, 1772-1780.
•  Kim,  M. S.,  Kim,  J. K.,  Kwon,  D. Y., and  Park,  R. (2004). Anti-adipogenic effects of Garcinia extract on the lipid droplet accumulation and the expression of transcription factor. BioFactors, 22, 193-196.
•  Kim,  Y. J.,  Kim,  K.-Y.,  Kim,  M. S.,  Lee,  J. H.,  Lee,  K. P., and  Park,  T. (2007). A Mixture Of The Aqueous Extract Of Garcinia Cambogia , Soy Peptide And L -Carnitine Reduces The Accumulation Of Visceral Fat Mass In Rats Rendered Obese By A High Fat Diet. Genes & Nutrition, 2, 353-358.
•  Kim,  J.-E.,  Jeon,  S.-M.,  Park,  K.H.,  Lee,  W.S.,  Jeong,  T.-S.,  McGregor,  R.A., and  Choi,  M.-S. (2011) Does Glycine max leaves or Garcinia Cambogia promote weight-loss or lower plasma cholesterol in overweight individuals: a randomized control trial. Nutrition Journal, 10, 94.
•  Kovacs,  E.M.R.,  Westerterp-Plantenga,  M.S.,  De Vries,  M.,  Brouns,  F., and  Saris,  W.H.M. (2001). Effects of 2-week ingestion of (−)-hydroxycitrate and (−)-hydroxycitrate combined with medium chain triglycerides on satiety and food intake. Physiology and Behavior, 74:543-549.
•  Kovacs,  E. M. and  Westerterp-Plantenga,  M. S. (2006). Effects of (-)-hydroxycitrate on net fat synthesis as de novo lipogenesis. Physiology & Behavior, 88, 371-381.
•  Leonhardt,  M.,  Hrupka,  B., and  Langhans,  W. (2001) Effect of hydroxycitrate on food intake and body weight regain after a period of restrictive feeding in male rats. Physiology & Behavior, 74, 191-196.
•  Lewis,  Y. S. and  Neelakantan,  S. (1965). (−)-Hydroxycitric acid—the principal acid in the fruits of Garcinia cambogia desr. Phytochemistry, 4, 619-625.
•  Louter-van de Haar,  J.,  Wielinga,  P.Y.,  Scheurink,  A.J., and  Nieuwenhuizen,  A.G. (2005) Comparison of the effects of three different (-)-hydroxycitric acid preparations on food intake in rats. Nutrition & Metabolism, 3, 23.
•  Lowenstein,  J. M. (1971). Effect of (-)-hydroxycitrate on fatty acid synthesis by rat liver in vivo. Journal of Biological Chemistry, 246, 629-632.
•  Márquez,  F. (2012). Evaluation of the Safety and Efficacy of Hydroxycitric Acid or Garcinia cambogia Extracts in Humans. Critical Reviews in Food Science and Nutrition, 52, 585-594(510).
•  McCarty,  M.F. (1994). Promotion of hepatic lipid oxidation and gluconeogenesis as a strategy for appetite control. Medical hypotheses, 42, 215-225.
•  Miyoshi,  H.,  Perfield,  J. W.,  Obin,  M. S., and  Greenberg,  A. S. (2008). Adipose triglyceride lipase regulates basal lipolysis and lipid droplet size in adipocytes. Journal of Cellular Biochemistry, 105, 1430-1436.
•  Hasegawa,  N. (2001). Garcinia extract inhibits lipid droplet accumulation without affecting adipose conversion in 3T3-L1 cells. Phytotherapy Research, 15, 172-173.
•  Nakamura,  T.,  Tokunaga,  K.,  Shimomura,  I.,  Nishida,  M.,  Yoshida,  S.,  Kotani,  K.,  Islam,  A.,  Keno,  Y.,  Kobatake,  T., and  Nagai,  Y. (1994). Contribution of visceral fat accumulation to the development of coronary artery disease in non-obese men. Atherosclerosis, 107, 239-246.
•  Ohia,  S. (2002). Safety and mechanism of appetite suppression by a novel hydroxycitric acid extract (HCA-SX). Molecular and Cellular Biochemistry, 238, 89-103.
•  Rao,  R. N. and  Sakariah,  K. K. (1988). Lipid-lowering and antiobesity effect of (−)hydroxycitric acid. Nutrition Research, 8, 209-212.
•  Roy,  S.,  Rink,  C.,  Khanna,  S.,  Phillips,  C.,  Bagchi,  D.,  Bagchi,  M., and  Sen,  C. (2003). Body Weight and Abdominal Fat Gene Expression Profile in Response to a Novel Hydroxycitric Acid-Based Dietary Supplement. Gene Expression, 11, 251-262(212).
•  Roy,  S.,  Shah,  H.,  Rink,  C.,  Khanna,  S.,  Bagchi,  D.,  Bagchi,  M., and  Sen,  C. (2007). Transcriptome of Primary Adipocytes from Obese Women in Response to a Novel Hydroxycitric Acid-Based Dietary Supplement. DNA & Cell Biology, 26, 627-639.
•  Saha,  A.,  Laybutt,  D.,  Dean,  D.,  Vavvas,  D.,  Sebokova,  E.,  Ellis,  B.,  Klimes,  I.,  Kraegen,  E.,  Shafrir,  E., and  Ruderman,  N. (1999). Cytosolic citrate and malonyl-CoA regulation in rat muscle in vivo. American Journal of Physiology-Endocrinology and Metabolism, 276, E1030-1037.
•  Saito,  M.,  Ueno,  M.,  Ogino,  S.,  Kubo,  K.,  Nagata,  J., and  Takeuchi,  M. (2005). High dose of Garcinia cambogia is effective in suppressing fat accumulation in developing male Zucker obese rats, but highly toxic to the testis. Food and Chemical Toxicology, 43, 411-419.
•  Sullivan,  A.,  Singh,  M.,  Srere,  P., and  Glusker,  J. (1977). Reactivity and inhibitor potential of hydroxycitrate isomers with citrate synthase, citrate lyase, and ATP citrate lyase. Journal of Biological Chemistry, 252, 7583-7590.
•  Sullivan,  A.,  Triscari,  J.,  Hamilton,  J., and  Miller,  O. (1974). Effect of (−)-hydroxycitrate upon the accumulation of lipid in the rat: II. Appetite. Lipids, 9, 129-134.
•  Sullivan,  A. C.,  Triscari,  J.,  Hamilton,  J. G., and  Ontko,  J. A. (1977). Hypolipidemic activity of (−)-hydroxycitrate. Lipids, 12, 1-9.
•  Vasselli,  J.,  Shane,  E.,  Boozer,  C., and  Heymsfield,  S. (1998) Garcinia cambogia extract inhibits body weight gain via increased energy expenditure (EE) in rats. FASEB Journal, 12, A505-A505.
•  Villena,  J.,  Roy,  S.,  Sarkadi-Nagy,  E.,  Kim,  K., and  Sul,  H. (2004). Desnutrin, an adipocyte gene encoding a novel patatin domain-containing protein, is induced by fasting and glucocorticoids: ectopic expression of desnutrin increases triglyceride hydrolysis. Journal of Biological Chemistry, 279, 47066-47075.
•  Wakil,  S. (1989). Fatty acid synthase, a proficient multifunctional enzyme. Biochemistry, 28, 4523-4530.
•  Watson,  J. A. and  Lowenstein,  J. M. (1970). Citrate and the conversion of carbohydrate into fat. Fatty acid synthesis by a combination of cytoplasm and mitochondria. Journal of Biological Chemistry, 245, 5993-6002.
•  Yamauchi,  T.,  Kamon,  J.,  Ito,  Y.,  Tsuchida,  A.,  Yokomizo,  T.,  Kita,  S.,  Sugiyama,  T.,  Miyagishi,  M.,  Hara,  K., and  Tsunoda,  M. (2003). Cloning of adiponectin receptors that mediate antidiabetic metabolic effects. Nature, 6941, 762-769.
•  Zimmermann,  R.,  Strauss,  J.,  Haemmerle,  G.,  Schoiswohl,  G.,  Birner-Gruenberger,  R.,  Riederer,  M.,  Lass,  A.,  Neuberger,  G.,  Eisenhaber,  F., and  Hermetter,  A. (2004). Fat mobilization in adipose tissue is promoted by adipose triglyceride lipase. Science, 306, 1383-1386.