Human carboxylesterase 1 (hCE-1, CES1A1, HU1) and carboxylesterase 2 (hCE-2, hiCE, HU3) are a serine esterase involved in both drug metabolism and activation. Although both hCE-1 and hCE-2 are present in several organs, the hydrolase activity of liver and small intestine is predominantly attributed to hCE-1 and hCE-2, respectively. The substrate specificity of hCE-1 and hCE-2 is significantly different. hCE-1 mainly hydrolyzes a substrate with a small alcohol group and large acyl group, but its wide active pocket sometimes allows it to act on structurally distinct compounds of either large or small alcohol moiety. In contrast, hCE-2 recognizes a substrate with a large alcohol group and small acyl group, and its substrate specificity may be restricted by a capability of acyl-hCE-2 conjugate formation due to the presence of conformational interference in the active pocket. Furthermore, hCE-1 shows high transesterification activity, especially with hydrophobic alcohol, but negligible for hCE-2. Transesterification may be a reason for the substrate specificity of hCE-1 that hardly hydrolyzes a substrate with hydrophobic alcohol group, because transesterification can progress at the same time when a compound is hydrolyzed by hCE-1.
   From the standpoint of drug absorption, the intestinal hydrolysis by CES during drug absorption is evaluated in rat intestine and Caco2-cell line. The rat in situ single-pass perfusion shows markedly extensive hydrolysis in the intestinal mucosa. Since the hydrolyzed products are present at higher concentration in the epithelial cells rather than blood vessels and intestinal lumen, hydrolysates are transported by a specific efflux transporter and passive diffusion according to pH-partition. The expression pattern of CES in Caco-2 cell monolayer, a useful in vitro model for rapid screening of human intestinal drug absorption, is completely different from that in human small intestine but very similar to human liver that expresses a much higher level of hCE-1 and lower level of hCE-2. Therefore, the prediction of human intestinal absorption using Caco-2 cell monolayers should be carefully monitored in the case of ester and amide-containing drugs such as prodrugs.
   Further experimentation for an understanding of detailed substrate specificity for CES and development of in vitro evaluation systems for absorption of prodrug and its hydrolysates will help us to design the ideal prodrug.

View full abstract

  Transport of prostaglandin E₁ (PGE₁) was investigated in rat renal brush-border membrane vesicles. The uptake of [³H]PGE₁ was sensitive to osmosis and temperature. This uptake was saturable and mediated by high-affinity (K_m=2.1 μM)/low-capacity (V_max=17.4 pmol/mg protein/30 sec) and low-affinity (K_m=526.5 μM)/high-capacity (V_max=1032.5 pmol/mg protein/30 sec) transport systems. [³H]PGE₁ uptake was Na⁺-independent and inhibited by various eicosanoids including PGE₂ and PGF_2α. Bromcresol green and sulfobromophthalein, potent inhibitors of prostaglandin transporter (PGT), significantly decreased [³H]PGE₁ uptake. Uptake was also inhibited by indomethacin and probenecid, which reportedly have little effect on PGT. Benzylpenicillin and taurocholate decreased the uptake of [³H]PGE₁. Like p-[¹⁴C]aminohippurate (PAH) uptake by vesicles, the uptake of [³H]PGE₁ was stimulated by an inside-positive membrane potential, created by applying an inward K⁺ gradient and valinomycin. However, the uptake of [³H]PGE₁ was not inhibited by PAH, suggesting that PAH and PGE₁ are transported by separate transport systems. [³H]PGE₁ uptake was not stimulated by outwardly directed gradients of Cl^- nor unlabeled PGE₁, indicating that an anion exchanger may not be involved in PGE₁ transport. These findings suggest that the transport of PGE₁ in rat renal brush-border membrane is mediated by specific transport system(s), at least in part, by a potential-sensitive transport system.

View full abstract

  Recent advances in pharmacogenomics have suggested the association of clinical outcome of glucocorticoid-based anti-inflammatory therapy with a single nucleotide polymorphism at position 3435 in exon 26 (C3435T) of the MDR1 gene. In the present study, the effects of the MDR1 C3435T genotype on the time-dependent profiles of gene expression and function of MDR1/P-glycoprotein were evaluated in peripheral blood mononuclear cells (PBMCs) under lipopolysaccharide (LPS)-induced experimental acute inflammation. LPS treatment resulted in the rapid elevation of IL-1β and TNF-α mRNA levels relative to β-actin mRNA at 1 h, with a subsequent slight decrease at 3 h after the treatment, while the down-regulation of the relative concentration of MDR1 mRNA was found at 3 h, not at 1 h, after LPS treatment. Here, the C3435T genotype-dependent down-regulations of MDR1 mRNA level were found for CC³⁴³⁵ and CT³⁴³⁵, but not for TT³⁴³⁵, and were 64.1±10.1%, 71.4±5.9% and 100.0±22.5% (±S.D.), respectively, of their respective baseline levels, which were independent of C3435T (0.010±0.005, 0.011±0.013 and 0.009±0.006 (±S.D.), respectively). The C3435T genotype-dependent down-regulation was supported by the increase of the intracellular accumulation of calcein in PBMCs treated with LPS for 72 h, and the increase was more predominant for CC³⁴³⁵ than TT³⁴³⁵. These data suggested that glucocorticoid-based anti-inflammatory therapy might be more effective for C³⁴³⁵-allele carriers than non-carriers.

View full abstract

  We previously reported that magnesium sulfate (MgSO₄) increases the threshold dose of bupivacaine in inducing seizure in rats. Cytochrome P450 (P450) isoforms involved in the biotransformation of bupivacaine to three oxidative metabolites and the effects of MgSO₄ in vivo on the P450 activities in rats were investigated. Of six cDNA-expressed rat P450 isoforms tested, CYP3A2 and CYP2C11 had high rates for N-debutlylation and 3′-hydroxylation of bupivacaine, respectively. The liver microsomes prepared from male rats pretreated with intravenous administration of MgSO₄ (a bolus dose of 25 mg/kg, followed by infusion of 2.0 mg/kg/min for 6 h) showed increased V_max values for N-debutylation and 3′-hydroxylaiton of bupivacaine compared to the liver microsomes from control rats. Administration of MgSO₄ also increased the activities of testosterone 6β- and 16α-hydroxylation. Although the level of expression of CYP3A and CYP2C isoforms in the liver microsomes were unchanged, NADPH-P450 reductase and cytochrome b₅ were found to be induced by intravenous administration of MgSO₄. These results suggest that CYP3A and CYP2C isoforms are activated by MgSO₄ in vivo as a consequence of enhanced microsomal electron transfer due to induction of NADPH-P450 reductase and cytochrome b₅, leading to the increased metabolism and clearance of bupivacaine.

View full abstract

  The frequency of the CYP2D6*10 allele (100C>T) in the Japanese is relatively high (0.3-0.4), and the two *10-related genes, Ch1 (currently *10B) and Ch2 (*36), and their tandem arrangement Ch₂-Ch₁ (*36-*10B) have been reported. Although the tandem form of *36-*10 is assumed to be a major form, no detailed information has been reported for its intervening and flanking regions. Thus in this study, the tandem-type *36-*10B and the single-type *10 were analyzed by long-range PCR and sequencing of the subsequent nested PCR products. The sequence of the entire *36-*10 region confirmed the recombination of CYP2D6*10 with CYP2D7P. Also, we found that most of the *10B-harboring haplotypes have the upstream *36 gene and that the majority of the remaining haplotypes are the single-type *10B. Haplotype frequencies of the single-type *10 and *36-*10B were 0.06 and 0.30, respectively, in the subjects analyzed. Additionally, several novel single nucleotide polymorphisms (SNPs) were found in the *36 region and several *36 haplotypes were identified. This sequence information is an important addition to the CYP2D6 sequence data that was obtained by the human genome project.

View full abstract

  Inorganic phosphate in food is absorbed two ways, the transcellular route via the brush border membrane and the paracellular route via tight junctions. NaPi, a sodium-dependent inorganic phosphate transporter, is expressed in rat and human intestine. However, the relative contribution of NaPi to total carrier-mediated transport of physiological concentrations of inorganic phosphate in rat intestine is not clear. Here, we characterized inorganic phosphate transport across the rat small intestine using a voltage-clamp analysis which allowed the diffrentiation of inorganic phosphate permeation through these two (transcellular and paracellular) routes. Results showed that, under a physiologically normal transmucosal electrical potential difference (about 2 mV), permeation of inorganic phosphate by the transcellular route was greater than that by the paracellular route. Further, transport was significantly decreased by the addition to the incubation medium of phosphonoformic acid, a sodium-dependent phosphate transporter inhibitor, and severely inhibited under sodium-free conditions. Similar results were obtained without the voltage-clamp. Together, these results suggest that NaPi-mediated transcellular permeation is the dominant route in the absorption of inorganic phosphate across the small intestine.

View full abstract

  The characteristics of NO donors, NOC5 [3-(2-hydroxy-1-(1-methylethyl-2-nitrosohydrazino)-1-propanamine), NOC12 [N-ethyl-2-(1-ethyl-2-hydroxy-2-nitrosohydrazino)-ethanamine] and SNAP [S-nitroso-N-acetyl-DL-penicillamine] as absorption enhancers for poorly absorbable drugs were examined in rats using an in situ closed loop method. They were compared with a group of conventional absorption enhancers including sodium glycocholate (NaGC), sodium caprate (NaCap), sodium salicylate (NaSal) and n-dodecyl-β-D-maltopyranoside (LM). 5(6)-carboxyfluorescein (CF) was used as a model drug to investigate effectiveness, site-dependency, and concentration-dependency of the tested enhancers. Overall, the NO donors can improve the intestinal absorption of CF at low concentration (5 mM), whereas higher concentration was required for the conventional absorption enhancers to elicit the absorption enhancing effect. In the small intestine, SNAP was the most effective absorption enhancers, although its concentration (5 mM) was lower than the conventional absorption enhancers (20 mM). On the other hand, LM and NaCap as well as the three NO donors were effective to improve the colonic absorption of CF. In the regional difference in the absorption enhancing effects, the NO donors showed significant effects in all intestinal regions, whereas we observed a regional difference in the absorption enhancing effect of the other conventional absorption enhancers. In the conventional enhancers, the absorption enhancing effects were generally greater in the large intestine than those in the small intestine. LM and NaCap were ineffective in the jejunum, although they were effective for improving the absorption of CF in the colon. NaSal was ineffective in both the jejunum and the colon. The absorption enhancement produced by NO donors was greatly affected by increasing the enhancer concentration from 3 to 5 mM, but only a slight increase was obtained when the concentration was raised to 10 mM. Similar results were obtained for the other enhancers over the range of 10 to 20 mM, but the absorption enhancing effects of these enhancers were almost saturated above these concentrations. These results suggest that NO donors possess excellent effectiveness as absorption enhancers for poorly absorbable drugs compared with the conventional enhancers. They can enhance intestinal absorption of CF from all intestinal regions and they are effective at very low concentrations.

View full abstract

  We previously established a in vitro system for assessing early ischemia/reperfusion injury using monolayers of human intestinal epithelial cell line Caco-2, in which lipid peroxidation caused by tertiary-butylhydroperoxide (t-BuOOH), a lipid peroxidation inducer, acts as a trigger of the injury. By now, we have shown that superoxide anion participates in the opening of tight junctions (TJ) induced by reoxygenation following the induction of lipid peroxidation by t-BuOOH at a low concentration. The present objectives are to elucidate the dysfunction of P-glycoprotein (P-gp) in addition to the opening of TJ by t-BuOOH at a high concentration condition using rhodamine123 (Rho123) as a P-gp substrate and cyclosporine A (CyA) as a P-gp inhibitor. Also, we compared the inhibition effect of lutein and other compounds such as biliverdin as a radical scavenger on the opening of TJ and the dysfunction of P-gp. t-BuOOH at a high concentration increased the permeability of Rho123 in the apical to basal direction and decreased basal to apical direction when compared with control conditions. t-BuOOH at a high concentration showed no significant difference between directional transport of Rho123 and no inhibition was observed in the permeability of both directions by CyA. The staining intensity of Western blot was decreased by t-BuOOH at a high concentration. Although lutein and the other compounds had recovery effects on the opening of TJ and P-gp dysfunction induced by t-BuOOH, lutein is more advantageous than other compounds since it has effective effects at the lower concentration. In conclusion, the barrier dysfunction such as the inhibition of P-gp in addition to the opening of TJ was induced by t-BuOOH at a high concentration condition. The above two barrier dysfunctions was ameliorated by antioxidant such as lutein and biliverdin.

View full abstract

  The influence of P-glycoprotein (P-gp) on intestinal absorption of drugs was investigated by comparison of the uptakes of two P-gp substrates, verapamil and vinblastine, using intestinal segments of wild-type and mdr1a/1b gene-deficient (mdr1a/1b^-/-) mice, and Caco-2 cells. When [³H]vinblastine was injected into intestinal segments of wild-type mice, vinblastine was absorbed from duodenum and ileum, but not from jejunum. This difference among intestinal regions could not be explained by segmental differences of mdr1a mRNA expression. In Caco-2 cells, it was found that vinblastine had a high value of efflux/influx ratio (an index of affinity for P-gp) of 12.1, and a low permeability of less than 1×10^-6 cm/sec. The corresponding values for verapamil were 4.9 and 10.6×10^-6 cm/sec, respectively. After oral administration of [³H]vinblastine to mice, the maximum concentration (C_max) and the area under the plasma concentration time-curve from time 0 to 24 hr (AUC_0-24hr) for mdr1a/1b^-/- mice were 1.5 times greater than those for wild-type mice, while these parameters were not significantly different between the two strains in the case of [³H]verapamil. Therefore, P-gp substrates may be classified into at least two types, i.e., verapamil-type, for which the intestinal absorption is unaffected by P-gp, and vinblastine-type, for which the intestinal absorption is influenced by P-gp. Vinblastine-type P-gp substrates, with low permeability and high affinity for P-gp, would be unfavorable candidates for oral drugs.

View full abstract

  We sequenced all exons and exon-intron junctions of the flavin-containing monooxygenase 3 (FMO3) gene from 2 Japanese individuals and their family members, who were case subjects that showed low FMO3 metabolic capacity among a population of self-reported trimethylaminuria Japanese volunteers. We found two novel single nucleotide polymorphisms (SNPs) (21254 C>A and 24006 A>G) causing amino acid substitutions, Thr²⁰¹Lys in exon 5 and Met²⁶⁰Val in exon 6, respectively. The Thr²⁰¹Lys and Met²⁶⁰Val also presented together with known SNPs (Glu¹⁵⁸Lys-Glu³⁰⁸Gly and Val²⁵⁷Met, respectively) in the same alleles of the FMO3 gene to form novel haplotypes. A SNP (30398 C>T) in the FMO3 gene causing a stop codon at Arg⁵⁰⁰ in exon 9 was also discovered.
   These sequences are as follows:
   1) SNP, 060116Shimizu001; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5′-GTGATATTGCCAC/AAGAACTCAGCCG-3′.
   2) SNP, 060116Shimizu002; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5′-TAC(G/A)TGAAGCAGA/GTGAATGCAAGAT-3′.
   3) SNP, 060116Shimizu003; GENE NAME, FMO3; ACCESSION NUMBER, AL021026; LENGTH, 25 base; 5′-CCCATGCAGACAC/TGAGTGGTCGGGA-3′.

View full abstract

  Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8166G>A, -8110A>G, -7947G>A, -7789T>C, -5595G>A, -3803_-3783delTCGGGGAGGTGGCAGTGGGCG, -3548G>C, -3414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1288G>A, 1641C>G, 1703_1704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7947G>A, 0.006 for IVS1+141G>A and 1703_1704delGT, 0.004 for -8166G>A, -8110A>G, -3548G>C, -1355T>C, -34C>G, IVS8+44T>C, and 1812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

View full abstract