All issues
Volume 91 (1982)
- Issue 6 Pages 1829-
- Issue 5 Pages 1457-
- Issue 4 Pages 1093-
- Issue 3 Pages 741-
- Issue 2 Pages 427-
- Issue 1 Pages 1-
Volume 91, Issue 4
Displaying 1-46 of 46 articles from this issue
- |<
- <
- 1
- >
- >|
-
Hiroshi HOMMA, Shoshichi NOJIMA1982 Volume 91 Issue 4 Pages 1093-1101
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWhen 2-acyl lysophosphatidylethanolamine, 2-acyl lysophosphatidylglycerol, and 2-acyl lysophosphatidylcholine were incubated with the envelope fraction of Escherichia coli in the presence of Mg2+ ion, they were acylated to the corresponding diacylphospholipids. The inner and outer membrane fractions both had acylation activity. 2-Acyl lysophosphatidylethanolamine was shown to be acylated at the 1-position by an endogenous acyl donor present in the envelope fraction. Under the conditions used, acylation was specific for 2-acyl lysophosphatidylethanolamine, and the 1-acyl isomer was not appreciably acylated.
The acylation was resistant to N-ethylmaleimide and p-chloromercuribenzoate, but was inhibited by Cu2+ and Hg2+ ions. Ca2+ and Mg2+ ions stimulated the activity about 1.5-fold, but EDTA was not inhibitory. The activity had a broad pH optimum between 6 and 8. On boiling the envelope fraction, about 55% of the activity was lost rapidly, while the remainder was lost gradually.
The endogenous acyl donor present in the envelope fraction was shown to be membrane phospholipids. The acylation was not observed with free fatty acids prepared by alkaline hydrolysis of the phospholipids. Studies with purified phospholipids showed that the major phospholipids of E. coli (phosphatidylethanolamine, phosphatidylglycerol, and cardiolipin) and phosphatidic acid acted as acyl donors. Thus, transacylation between diacylphospholipids and 2-acyl lysophospholipids catalyzed by E. coli envelopes was demonstrated.View full abstractDownload PDF (586K) -
Hiroshi HOMMA, Shoshichi NOJIMA1982 Volume 91 Issue 4 Pages 1103-1110
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWhen 2-[14C]acyl lysophosphatidylethanolamine was incubated with the envelope fraction of E. coli in the presence of Mg2+ ion, phosphatidylethanolamine, acylphosphatidylglycerol and free fatty acid were produced. When 2-[14C] acyl lysophos-phatidylglycerol was examined similarly, six phospholipids as well as free fatty acid were produced. These were dilysocardiolipin, lysocardiolipin, phosphatidylglycerol, cardiolipin, bistmonoacylglycero)phosphate and acylphosphatidylglycerol; they were identified by thin layer chromatography, acetolysis and mild alkaline hydrolysis.
Studies with an E. coli mutant which is deficient in cardiolipin synthase showed that dilysocardiolipin, lysocardiolipin and cardiolipin were synthesized by cardiolipin synthase. Bis(monoacylglycero)phosphate as well as acylphosphatidylglycerol was produced by acylphosphatidylglycerol synthase.
While phosphatidylglycerol and cardiolipin were produced predominantly from 2-acyl lysophosphatidylglycerol, almost the same amounts of dilysocardiolipin, lysocardiolipin and bis(monoacylglycero)phosphate were produced from the 1-acyl and 2-acyl isomers. Metabolites of 2-[14C] acyl lysophosphatidic acid were also examined. Phosphatidic acid, acylphosphatidylglycerol, free fatty acid and monoglyceride were produced, together with a small amount of diglyceride.View full abstractDownload PDF (530K) -
Ken HASHIMOTO, Shigeru ITOH, Ken-ichiro TAKAMIYA, Mitsuo NISHIMURA1982 Volume 91 Issue 4 Pages 1111-1120
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESS1. The dependences of the reduction of ferricytochrome c-555 in the reaction center-cytochrome c complex on the redox potential and pH were investigated using N, N, N', N'-tetramethyl-p-phenylenediamine (TMPD), ferrocyanide, and reduced 2, 5- dimethyl-p-quinone as electron donors.
2. In the reduction of cytochrome c-555 by TMPD, the unprotonated form was the exclusive electron donor to the cytochrome with a second-order rate constant of 1.0×105M-1•s-1.
3. Ferrocyanide reduced cytochrome c-555 slowly with a rate constant of 7.8×103M-1•s-1 at infinite salt concentration. The value of -5.2×10-4 elementary charge/Å2 was estimated as the surface charge density in the vicinity of cytochrome c-555 by analyzing the salt effect on the cytochrome reduction using the Gouy-Chapman theory.
4. The characteristics of the dependences of the reduction of cytochrome c-555 by reduced 2, 5-dimethyl-p-quinone on the redox potential and pH were well explained by the redox potential and pH dependences of the formation of the semiquinone. In the neutral-to-alkaline pH range the anionic semiquinone was the main electrondonating species with a second-order rate constant of 6.0×107M-1•s-1.View full abstractDownload PDF (665K) -
Etsuko YASUGI, Etsuko SAITO, Takeshi KASAMA, Hideya KOJIMA, Tamio YAMA ...1982 Volume 91 Issue 4 Pages 1121-1127
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSFour glycolipids (Fr. I, II, III, and IV) were isolated from whale brain and three (Fr. I, II, and III) of them were demonstrated to be galactosyl ceramide combined with fatty acid by ester linkage. Fr. IV was shown to be a monoalkyl monoacyl galactosyl glycerol. For determining the substituted position of the acyl group on the galactose moiety, free hydroxyl groups of ester cerebrosides were protected with dihydropyran, deacylated by milda Ikali treatment, and then subjected to permethylation. Finally, the methylated galactitol acetates obtained by hydrolysis and reduction were detected by gas chromatography and identified by gas chromatography-mass spectrometry. By this procedure, Fr. I was shown to be an acyl ester of kerasine, with the ester group at the 6-position of galactose. Fr. II and III were demonstrated to be acyl esters of phrenosine, in which the acyl groups were attached to the 6- and 2-position of the galactose, respectively. While the esterlinked acyl group of Fr. I, II, and III was composed of only normal fatty acids, predominatly palmitic acid, and the amide-linked fatty acids showed a heterogeneous composition of normal and hydroxy fatty acids, C 16 to C 24.View full abstractDownload PDF (1716K) -
Kimihiko SATOH, Kiyomi SATO1982 Volume 91 Issue 4 Pages 1129-1137
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTwo molecular forms (BE-I and -II) of 1, 4-α-glucan branching enzyme were purified from rat liver by affinity chromatography on glycogen-adipoyldihydrazide-Sepharose 4 B and glycogen-ethylenediamine-Sepharose 4 B, respectively, after hydrophobic chromatography on hexylamine-Sepharose 4 B, as single proteins with the same molecular weight of 82, 000 on SDS-polyacrylamide gel electrophoresis. By comparing their UV spectra and by RNA detection on polyacrylamide gels after electrophoresis, BE-I and -II were identified to be RNA associated and unassociated forms, respectively. The molecular weights of BE-I and -II estimated by Sephadex G-200 gel filtration were 91, 000 and 98, 000, respectively, indicating that both forms consist of a monomer. As BE-II had about half the specific activity of BE-I, the RNA component was not essential for the activity of the rat liver branching enzyme, and it was also dissociable from the protein component (BE-II) on polyacrylamide gel electrophoresis at pH 7.3, whereby BE-II showed a heterogeneity of at least three microspecies as revealed by protein staining as well as by activity staining of the gels. Using the antibody against BE-I, BE-I and -II were indistinguishable on immunodiffusion, and the activity inhibition rate of BE-II by the antibody was almost the same as that of BE-I if their specific activities are considered, indicating that the RNA component may have no effect on the enzyme-antibody reaction. Immunochemically no isoenzyme was detected for this enzyme in rat tissues.View full abstractDownload PDF (1706K) -
Masahiro TATSUMI, Yuji ARM, Tatsuro ITOH1982 Volume 91 Issue 4 Pages 1139-1146
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA lectin was purified from a shellfish, Saxidomus purpuratus, using ion-exchange chromatography on DEAE-cellulose and affinity chromatography on N-acetylglucosamine-Sepharose. The lectin purified by affinity chromatography showed seven protein bands in polyacrylamide gel electrophoresis. The two major lectins (SPA-I and SPA-III) were purified by a second DEAE-cellulose column chromatography. The molecular weights of the lectins were almost the same and were estimated to be around 40, 000 by gel filtration on a Sepharose 6 B column. On SDS-polyacrylamide gel electrophoresis in the presence of 2-mercaptoethanol, the lectins showed molecular weights of 14, 000. The isoelectric points of SPA-I and -III were estimated to be 4.4 and 4.1, respectively. The two lectins (SPA-I and -III) differed slightly in amino acid composition and were glycoproteins containing 2.1 and 3.8 mol of GlcNAc per 40, 000g of the lectin, respectively. The binding constant of SPA-I or SPA-III for methyl N-acetyl-α-D-glucosaminide, the strongest inhibitor of hemagglutination in this experiment, was estimated to be 1.3×103 or 4.2×104M-1, respectively, by the UV difference spectroscopy method.View full abstractDownload PDF (1556K) -
Hung-Tu LEE, Tetsu HASE, Jun MIYOSHI, Kazunori SHIMADA, Yukito MASAMUN ...1982 Volume 91 Issue 4 Pages 1147-1154
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA multicopy plasmid, 4.7 kb in size, was isolated from Shigella sonnei and named pKY1. This plasmid produces a colicin E1-like bacteriocin (colicin E1*) in E. coli cells. The cells harboring pKY1 are immune not only to this bacteriocin but also to colicin E1, and the cells harboring ColE1 show immunity to colicin E1* as well. Although these two plasmid DNAs have different cleavage maps and are compatible with each other, pKY1 shows partial DNA homology with ColE1 DNA. In this paper, we report the isolation and properties of several Tn3 inserted pKY1 mutants, and propose a preliminary genetic map of pKY1. It was also found that this plasmid is not capable of self-transmission and is poorly mobilized by the F factor.View full abstractDownload PDF (3465K) -
Luiz Shozo OZAKI, Akinori KIMURA, Kazunori SHIMADA, Yasuyuki TAKAGI1982 Volume 91 Issue 4 Pages 1155-1162
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSpKY2289, a ColE1:: Tn3 derivative, useful for direct selection of cells carrying a hybrid plasmid, was deleted of its mobility functions and parts of the transposon including the left inverted repeat. This deletion mutant, named pKY2700 expresses low levels of colicin E1 synthesis even in recA cells. A nitrosoguanidine mutant of pKY2289 which shows a high level of constitutive colicin E1 synthesis was also deleted of the same sequences as pKY2700. The second plasmid, named pKY2800, has the same molecular weight (3.8 megadaltons) and almost the same structure as pKY2700, but produces colicin E1 at much higher levels and has a copy number 10 times higher. pKY2800 requires no colicin E1 induction for the direct selection of hybrid clones, while pKY2700 requires mitomycin C at a concentration of 10 ng per ml.
These two ColE1 derivatives are useful as safe and convenient vectors for cloning DNA fragments at the cleavage sites of EcoRl, XmaI, and Sstll of plasmid.View full abstractDownload PDF (485K) -
Hachiro OZAKI, Isamu SHIIO1982 Volume 91 Issue 4 Pages 1163-1171
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSOut of 27 strains of methionine auxotrophs of Brevibacterium flavum, 14 strains did not grow on homoserine but grew on O-acetylhomoserine, and all were found to lack homoserine O-acetyltransferase [EC 2. 3. 1. 31] alone. Another 3 strains did not grow on O-acetylhomoserine but grew on homocysteine, and the two strains tested were found to lack O-acetylhomoserine sulfhydrylase (AHS) alone, without any changes in the activities of cystathionine γ-synthase [EC 4. 2. 99. 9] and β-cystathionase [EC 4. 4. 1. 8]. Prototrophic revertants of the AHS-lacking mutants showed concomitant reversion of AHS activity. None of the methionine auxotrophs grew on cystathionine. From these results it was concluded that the methionine biosynthetic pathway of this bacterium involves formation of O-acetylhomoserine from homoserine by the action of homoserine O-acetyltransferase, and direct formation of homocysteine from O-acetylhomoserine by the AHS reaction. AHS synthesis was strongly repressed by methionine. AHS was purified to 70%, purity. The purified preparation was activated by pyridoxal phosphate after treatment with hydroxylamine. The enzyme showed a molecular weight of 360, 000, an optimum pH of 8.7 for activity, and specifically reacted with O-acetyl-L-homoserine and showed with O-acetyl-L-serine one hundredth as much activity as that with O-acetylhomoserine, but did not show activity with O-succinyl-L-homoserine, homoserine, or serine. The Km values for O-acetylhomoserine and H2S were 2.0mM and 0.08mM, respectively. The enzyme was inhibited 50, 23, and 29% by 10mM L-methionine, L-homoserine, and O-acetyl-L-serine, respectively, but it was not inhibited by cystathionine or S-adenosyl-L-methionine.View full abstractDownload PDF (579K) -
Masako TANIGUCHI, Makoto AIKAWA, Toshio SAKAGAMI1982 Volume 91 Issue 4 Pages 1173-1179
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSProstaglandin E1 was found to reduce the hemolysis rate induced by various factors, such as frequent shakings, treatment with hog pancreatic phospholipase A2, the addition of active oxygens generated by a xanthine oxidase system, and the addition of a prostaglandin antagonist, polyphloretin phosphate (PPP).
Prostaglandin E1 was found to act on the erythrocytes in such a way as to cause the phospholipids in the membrane to become more compactly arranged, thus becoming less susceptible to the attack of hemolytic reagents.
It was observed that the extents of hemolysis were different between erythrocytes from males and females, and furthermore, it was shown that prostaglandin E1 clearly reduced the rate of hemolysis of erythrocytes from males, while, in females, the effects of prostaglandin E1 were less than those in erythrocytes from males.View full abstractDownload PDF (441K) -
Toshiyoshi ARAKI, Manabu KITAMIKADO1982 Volume 91 Issue 4 Pages 1181-1186
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA novel exo-β-mannanase (1, 4-β-D-mannan mannobiohydrolase) was isolated from the culture fluid of strain No. F-25 of Aeromonas hydrophila subspecies anaerogenes, and purified about 4, 000-fold by ammonium sulfate precipitation and successive column chromatographies. The final enzyme preparation appeared to be homogeneous on polyacrylamide gel electrophoresis. The enzyme hydrolyzed the β-1, 4-mannan link in polysaccharides of three or more β-1, 4-linked D-mannose units. The enzyme had a molecular weight of 64, 000, pI of 5.9, pH optimum of 6.0, and was stable in a pH region of 5.0 to 8.5 and at temperatures below 45°C. The Km values of the enzyme were 5.1×10-4M for mannotriose, 2.4×10-4M for mannotetraose and 1.3×10-4M for mannopentaose. The enzyme attacked codium and coffee mannans to give only mannobiose. Mannobiosyl- and mannotetraosyl-mannitol were hydrolyzed to produce mannobiose and mannitol, while mannobiose and mannosylmannitol were released from mannotriosylmannitol. The enzyme did not act on mannobiose, p-nitrophenyl-β-D-mannoside, konjac glucomannan, or guar gum galactomannan. Furthermore, the enzyme catalyzed a transglycosylation reaction.View full abstractDownload PDF (1576K) -
Kurumi YAMADA, Hiroshi ASAI1982 Volume 91 Issue 4 Pages 1187-1195
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSProteins of the contractile spasmoneme from Carchesium polypinum were extracted in 2% SDS, 30% acetic acid, or 8M urea. The proteins extracted in SDS had a wide molecular weight distribution when examined by SDS-polyacrylamide gel electrophoresis. On the other hand, the proteins extracted in urea and acetic acid had three major peaks with molecular weights of about 16, 000, 18, 000, and 22, 000. Most of these proteins were soluble even in the absence of urea and furthermore were found to be monomeric, since the sedimentation coefficient, S20, W, measured by analytical ultracentrifugation was 2.0 S. The electrophoretic mobility of the proteins extracted in urea or in acetic acid was examined on alkaline gels. In the presence of free Ca2+, the mobility was significantly reduced compared with that in the absence of free Ca2+. These Ca-binding proteins were heat-stable and could not interact with troponin I. The implications of these proteins and others in relation to the contractility of the spasmoneme in Carchesium stalk are discussed.View full abstractDownload PDF (2285K) -
Kunihiko GEKKO1982 Volume 91 Issue 4 Pages 1197-1204
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSIn order to clarify the mechanism of polyol-induced stabilization of protein, the thermal denaturation of lysozyme was studied at pH 4 in aqueous mixtures of some polyols (ethylene glycol, glycerol, erythritol, xylitol, and sorbitol) by a differential scanning calorimetry (DSC). The denaturation temperature, Td, increased with increasing the polyol concentration and the number of hydroxymethyl groups per polyol molecule. The calorimetric enthalpy of denaturation, ΔHcat, increased with the increase in polyol concentration, but it was not significantly affected by the chain length of the polyol: ΔHcat was about 30 kcal/mol larger in 30% (w/w) aqueous polyols than in water. The standard thermodynamic parameters for denaturation, ΔG°, ΔS°, andΔH°, which were calculated for glycerol and sorbitol systems using Td and ΔHcat and assuming a constant heat capacity change, were an increasing function of polyol concentration. According to the thermodynamics of three component systems, it appeared that one or two polyol molecules are preferentially excluded from the domain of this protein on thermal denaturation. These thermodynamic data support the hypothesis that the thermal stabilization of lysozyme by polyols is due to a preferential solvent interaction effect which strengthens the hydrophobic interaction of the protein.View full abstractDownload PDF (486K) -
Masahiro IWAKURA, Yukio SHIMURA, Keishiro TSUDA1982 Volume 91 Issue 4 Pages 1205-1212
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSResistant strains for trimethoprim, a potent inhibitor of dihydrofolate reductase, were obtained by transforming the ligated products of Escherichia coli K12 DNA and plasmid pBR 322 BamH I fragments. The strains carry a 13.6 kbp plasmid, pTP 1, which contains the trimethoprim- and ampicillin-resistance determinant genes. The trimethoprim-resistance determinant gene was estimated to consist of more than 500 nucleotides and less than 1, 500 nucleotides and was restricted by EcoR I and Sal I.
Trimethoprim-, ampicillin-, and tetracycline-resistant plasmids were made in the following way, and the resultant plasmids contained a unique EcoR I “insertional inactivation” site for trimethoprim resistance: the DNA sequences extraneous to the determinant gene of the trimethoprim resistance on BamH I fragment of pTP 1 were eliminated by digestion with a double-strand-specific exonuclease BAL 31, and the resultant fragments were ligated with pBR 322 which had been digested by EcoR I and a single-strand-specific nuclease Sl.
The strains carrying pTP 1 or trimethoprim-resistant plasmids produced about 10 times more dihydrofolate reductase than control strains. The enhancement of the enzyme production, which is due to an increase in the copy number of the enzyme gene, seems to be responsible for the trimethoprim resistance of the transformed cells.View full abstractDownload PDF (1771K) -
Hideo IWAHASHI, Hideo AKUTSU, Yuji KOBAYASHI, Yoshimasa KYOGOKU, Takeo ...1982 Volume 91 Issue 4 Pages 1213-1221
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe λ tof repressor protein was purified from E. coli cells retaining λdv plasmids by applying DNA-cellulose chromatography. 3H-labeled λdv and λimm21dv DNA, carrying and lacking λ operators, respectively, were prepared and the binding activity of the λ tof protein to the DNA was examined. Non-specific binding to λimm21dv DNA is completely lost at 30°C, whereas specific binding to the DNA carrying the operators is retained even above 40°C.
The conformation of the λ tof protein was analysed by means of circular dichroism and 1H-NMR spectra. The change in the molar ellipticity at 222 nm vs. temperature in CD spectra indicated a transition between two states with Tm at 42°C. The 360 MHz 1H-NMR spectra revealed the presence at 20°C of another change in local conformation or interaction which was not detected by the CD spectra. 1H-NMR also indicated the coexistence of thermal transitions with exchange rates faster and slower than the NMR time scale at about 50°C, which is explained by the presence of domain structures. The NMR titration curve of the His residue gave a normal pK value showing its location on the surface of the λ tof protein. These conformational behaviors are well correlated to the specific and non-specific DNA binding activity of the λ tof protein. The assignments of 1H resonance signals to some specific residues, including His 35 and Tyr 26, were established. It will be useful to determine the tof-DNA interaction.View full abstractDownload PDF (966K) -
Takehiko KOIDE, Yohsuke OHTA, Shoji ODANI, Teruo ONO1982 Volume 91 Issue 4 Pages 1223-1229
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSChicken antithrombin was purified from fresh chicken plasma by affinity chromatography using heparin-agarose, and its amino acid and carbohydrate compositions, amino-terminal sequence, inhibition of human thrombin, and immunological properties were studied and compared with previously studied mammalian antithrombins (human, pig, rabbit, and rat), and also with chicken ovalbumin.
Chicken antithrombin is a single-chain glycoprotein with a total carbohydrate content of 17.5%, including 6.0% N-acetylglucosamine, 8.7% hexose, and 2.8% N-acetylneuraminic acid. The molecular weight estimated from sodium dodecyl sulfate ISDS)-polyacrylamide gel electrophoresis was 60, 000.
The amino-terminal sequence has been determined as Ala-Pro-Tyr-Ala-Val-Glu-Asp-Ile-Cys-Thr-Ala-Lys-Pro-Thr-Asp-Ile-Pro-Val-Asn, which is highly homologous to the terminal sequences of mammalian antithrombins, although the first 4 residues are quite different from those of mammalian species.
Chicken antithrombin showed a stoichiometric inhibition against human thrombin. The apparent dissociation constant (K1) for the complex was 6.4×10-8M. No immunological cross-reactivity was observed between chicken and mammalian antithrombins. Ovalbumin, which Hunt and Dayhoff (Biochem. Biophys. Res. Commun. 95, 864-871, 1980) proposed should be grouped in the same superfamily as antithrombin, showed neither immunological cross-reactivity with antithrombin or with its carboxymethylated derivative, nor any effect on the thrombin-antithrombin interaction. Ovalbumin showed no inhibitory effect on porcine elastase, either.View full abstractDownload PDF (1779K) -
Akio INOUE, Yuji TONOMURA1982 Volume 91 Issue 4 Pages 1231-1239
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSPreviously, several workers reported that at very low ionic strength and in the presence of ATP, the extent of binding of S-1 with the F-actin-tropomyosin-troponin complex or regulated actin (FA-TM-TN) is unaffected by removal of However, in this study we found that during the ATPase reaction at physiological ionic strength, the extent of binding of HMM with FA-TM-TN decreased markedly upon removal of Ca2+. Therefore, the effects of Ca2+ were studied on the intermediate steps in the acto-HMM or acto-S-1 ATPase reaction. 1. The nucleotideinduced dissociation of acto-S-1 was studied using AMPPNP as substrate. The extent of binding of S-1 with regulated actin in the presence of Mg2+-AMPPNP increased in a sigmoidal manner as the S-1 concentration increased. When the molar ratio of actin monomer to S-1 was higher than 5-10, the removal of Ca2+-shifted the equilibrium of the dissociation reaction, FA-S-1-AMPPNP_??_FA+ S-1-AMPPNP, to the right. 2. The recombination rate of HMMADPP or S-1ADPP with regulated actin in the absence of free Mg2+-ATP was estimated by measuring the time course of recovery in light-scattering intensity after addition of ATP. The rate decreased upon removal of Ca2+, when the molar ratio of actin monomer to S-1 was higher than 5-10. 3. The decomposition rate of HMMADPP was measured in the presence of Mg2+-ATP. In the absence of Ca2+, regulated actin did not affect this rate, whereas in its presence, regulated actin markedly accelerated the rate. These findings clearly indicated that at physiological ionic strength, removal of Ca2+-affects various elementary steps in the ATPase reaction to promote the dissociation of myosin heads from FA-TM-TN.View full abstractDownload PDF (499K) -
Kazuko OGAWA, Makoto KAWAKAMI, Yoshiko SHIMIZU, Shosuke TAKEMURA1982 Volume 91 Issue 4 Pages 1241-1248
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSProline tRNA from Torulopsis (Candida) utilis was purified by chromatography on columns of DEAE-Sephadex A-50 at pH 7.6 and 4.0, DEAE-Sephadex A-50 at pH 6.0, and RPC-5 at pH 4.0. This tRNA was sequenced by combining conventional chromatographic methods with rapid read-out chemical and enzymatic gel sequencing methods. The tRNA consists of 75 nucleotides and has the following sequence: pG-G-C-Cm-G-C-G-U-C-ψ-A-G-D-G-G-D-A-U-A-C-U-C-G-C-U-U-N-G-G-m1 G-ψ-G-T-G-A-G-U-G-m7G-D-m5C-m5C-A-G-G-G-T-ψ-C-A-m1A-U-U-C-C-C-U-G-C-U-C-G-G-C-C-C-C-C-A. An unknown nucleotide in the first position of the anticodon was shown to be an uridine derivative by UV-spectrum, mobility on thin-layer chromatogram, and preliminary measurement of NMR spectrum. The specificity of this tRNA for codon recognition was studied by the ribosomal binding technique. Three out of four proline codons were recognized: CCA and CCU preferentially, and CCC weakly. Unexpectedly, CCG failed to bind this tRNA to ribosomes.View full abstractDownload PDF (1142K) -
Noriko SUENAGA, Iwao OHTSUKI1982 Volume 91 Issue 4 Pages 1249-1256
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSEffects of troponin (TN) components and tropomyosin (TM) on the interactions between actin filament and cytochalasin B (CB) at low ionic strength were investigated using electron microscopy and viscometry. CB decreased the viscosity of the actin filament and this effect became apparent at 10 μM CB and reached the maximum at 40 μM. CB (40 μM) shortened the average actin filament length from 0.50 to 0.25 μM as observed electron microscopically. Presence of TN components and TM diminished the effect of CB on both viscosity and filament length. TN-T but not TN-I had an inhibitory effect on the decrease of the viscosity of the A+TM filament induced by CB. TN-T1 but not TN-T2, one of two chymotryptic subfragments of TN-T1 had the same inhibitory effect seen with TN-T. Thus, the cooperation between the T1 region of TN-T and TM is probably essential for the inhibitory action on CB-actin interactions.View full abstractDownload PDF (1827K) -
Masaru TANOKURA, Yuriko TAWADA, Iwao OHTSUK1982 Volume 91 Issue 4 Pages 1257-1265
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSChymotryptic subfragments from rabbit skeletal troponin T were purified using column chromatography. Molecular weight values on SDS gel electrophoresis, tryptophan contents, N- and C-terminal residues, and amino acid compositions were examined for each subfragment. Based on these findings, the positions of the subfragments in the sequence of troponin T were determined as follows: Nterminal acetylserine-l-tyrosine-158 for troponin T1 (MW 18, 700); serine-156-Cterminal lysine-259 for troponin T2α5 (MW 12, 200); leucine-159-C-terminal lysine-259 for troponin T2 (or troponin T2α) (MW 11, 900); leucine-159-phenylalanine-242 for troponin T2βI (MW 10, 200); leucine-159-tyrosine-227 for troponin T2βII (MW 8, 400); leucine-159-leucine-222 for troponin T2βIII (MW 7, 700); and serine-243-Cterminal lysine-259 for troponin T2γ (MW 1, 800).
The pathway of chymotryptic digestion of troponin T was also investigated and the results are discussed in relation to the higher structure of troponin T. The interaction of some chymotryptic subfragments with tropomyosin was also investigated by affinity chromatography.View full abstractDownload PDF (1539K) -
Shinji YOKOYAMA, Shoji TAJIMA, Akira YAMAMOTO1982 Volume 91 Issue 4 Pages 1267-1272
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSHuman plasma apolipoprotein A-I (apoA-I) has been studied in an aqueous solution by the techniques of high performance liquid chromatography (HPLC), circular dichroic spectroscopy, and sedimentation equilibrium ultracentrifugation. The results indicate that an oligomer is formed as an intermediate step of dissolving lyophilized apoA-I. The process of further dissolution of this oligomer is an irreversible, temperature-dependent dissociation. The half-life of this intermediate oligomer is 3min at 37°C and 80 h at 30°C. The completely dissolved apoA-I in an aqueous buffer self-associates with conformational alteration. The self-association equilibrium is too rapid to be demonstrated by HPLC.View full abstractDownload PDF (393K) -
Shoji TAJIMA, Shinji YOKOYAMA, Yoshiko KAWAI, Akira YAMAMOTO1982 Volume 91 Issue 4 Pages 1273-1279
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe behavior of human apolipoprotein C-II (apoC-II; molecular weight, 8, 837) has been studied in an aqueous solution by using gel permeation chromatography, sedimentation equilibrium ultracentrifugation, and circular dichroic (CD) spectroscopy. The elution volume of apoC-II was equivalent to that of standard proteins with molecular weights of 30, 000 and 17, 800 by high performance liquid chromatography (HPLC) on TSK-GEL G 3000 SW and by gel permeation chromatography on Sephadex G-75, respectively. Sedimentation equilibrium experiments in a tabletop high-speed air turbine centrifuge and in an analytical ultracentrifuge showed values of 9, 400 and 7, 900, respectively, for the molecular weight of apoC-II in the absence of any denaturants or surfactants. The CD spectrum of apoC-II in the far-ultraviolet region indicated that it had a highly disordered structure. These results showed that the apoC-II molecule, when in dilute solution, is dominantly monomeric with an extended and loosely folded structure. The concentration dependence of the ellipticities at 220 nm and of the molecular weight in the sedimentation equilibrium experiment suggests that apoC-II self-associates weakly in an aqueous solution. The disordered state of apoC-II was highly stable. However, helical conformation was induced by sodium dodecylsulfate, trifluoroethanol, and phosphatidylcholine vesicles.View full abstractDownload PDF (471K) -
Norihiro OKADA, Kazuichi SAKAMOTO, Yasuaki ITOH, Yasumi OHSHIMA1982 Volume 91 Issue 4 Pages 1281-1291
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSUsing post-labeling techniques, the nucleotide sequence of a major species of U5 RNA isolated from rat liver was determined to be: XpppAmUmACUCUGGUUUCUCUUCAGAUCGUAUAAAUCUUUCGmCCUUmUψACmNAAAGAUψUCCGUGGAGAGGAACAACUCUGAGUCUUAAACCAAUUUUUUGAGGCCUUGUCUUGA(G)CAAGGCUOH. The 5'-end of the RNA is blocked with a cap structure. In addition to the modified nucleotides around the 5'-end (XpppAmUmA), U5 RNA contains Gm at position 38, Urn at position 42, ψ at position 44, Cm at position 46, N at position 47, and ψ at position 54 as modified nucleotides. U5 RNA is present as a mixture of several species with microheterogeneity, whose lengths are 117, 118, or 119 nucleotides. The major species, with 117 nucleotides, comprised approximately 60% of the total U5 RNA. A region near the 3'-end forms a stable secondary structure, which causes sequence compression on electrophoresis in polyacrylamide gel. To surmount with this obstacle, we developed a chemical modification procedure with sodium bisulfite prior to partial hydrolysis in formamide, which allows denaturation of the secondary structure in polyacrylamide gel containing 7M urea. The procedure provides a good system for checking RNA sequences determined by electrophoresis in polyacrylamide gel which might have apparent deletions on account of sequence compression.View full abstractDownload PDF (2789K) -
Takanori KAWAMURA, Katsuhisa TAWADA1982 Volume 91 Issue 4 Pages 1293-1298
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSIn the presence of vanadate (Vi) and ADP, myosin ATPase forms a stable inactive complex (myosin•ADP•Vi) at the active site. To elucidate the nature of the inactive complex, we studied the effect of Vi plus ADP on the interaction of heavy meromyosin (HMM) with F-actin.
1) Viscosity measurements showed that the actin-HMM rigor complex was dissociated into actin and HMM by Vi and ADP (both 10-3M range).
2) When the HMM•ADP•Vi complex isolated by gel filtration was mixed with actin in the absence of free Vi, about 60% of the added HMM formed a complex with actin, and more than 70% of the HMM bound to actin released Vi and ADP.
3) When a mixture of the isolated HMM•ADP•Vi complex with actin was dialyzed against a buffer without free Vi and free ADP, only less than 10% of Vi and ADP, which were originally bound to the HMM, were retained in the dialysis tube after 4 days. In contrast, if actin was omitted, about 80% of Vi and ADP were retained.
4) These results indicate that the HMM•ADP•Vi complex is dissociated from actin, and that Vi and ADP originally trapped at the HMM active site can be almost completely released from the active site by actin if free (released) Vi and ADP are concomitantly removed.View full abstractDownload PDF (371K) -
Takeo YAMAGUCHI, Masato KOGA, Yoshinori FUJITA, Eiji KIMOTO1982 Volume 91 Issue 4 Pages 1299-1304
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe effects of pH on the membrane fluidity of intact human erythrocytes, ghosts, and their lipid vesicles were studied by spin label techniques in the range of pH 3.0 to 9.1. Two fatty acid spin labels, 5-nitroxide stearic acid (5 NS) and 12-nitroxide stearic acid (12 NS), and a maleimide spin label were used for the labeling of the membrane lipids and proteins, respectively. The outer hyperfine splitting (T//) was measured as a parameter of membrane fluidity.
In the case of 5 NS, the T// values for intact erythrocytes and ghosts remained almost constant over the entire pH range at 22°C but those for their lipid vesicles changed slightly, indicating the vertical displacement of the labels in lipid bilayers. On the other hand, the ESR spectra of 12 NS incorporated into intact erythrocytes and ghosts, as compared with their lipid vesicles, showed marked pH dependence. By means of spin labeling of membrane proteins, the conformational changes of the proteins were observed in the pH range mentioned above. These results suggest a possible association between the strong pH dependence of the T// values and the conformational changes of membrane proteins.
The pH dependence of the membrane fluidity was also investigated in cholesterol-enriched and -depleted erythrocytes. The effects of cholesterol demonstrated that the membrane fluidity was significantly mediated by cholesterol at low pH, but not at high pH.View full abstractDownload PDF (384K) -
Hiromi TAKANO-OHMURO, Takashi OBINATA, Tomoh MASAKI, Takashi MIKAWA1982 Volume 91 Issue 4 Pages 1305-1311
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe patterns of myosin isozymes in embryonic and adult chicken pectoralis muscle were examined by electrophoresis in a non-denaturing gel system (pyrophosphate acrylamide gel electrophoresis), and both light chains and heavy chains of embryonic and adult myosin isozymes were compared. In pyrophosphate acrylamide gel electrophoresis, the predominant isozyme component in embryonic pectoralis myosin could be clearly distinguished from adult myosin isozymes. SDS-polyacrylamide gel electrophoresis indicated that the light chain composition of embryonic myosin was also different from that of adult myosin. The pattern of peptide fragments produced by myosin digestion with α-chymotrypsin differed significantly between embryonic and adult skeletal myosin. These results suggest that myosin in the embryonic pectoralis muscle is different in both light and heavy chain com-
position from myosin in the same adult tissue.View full abstractDownload PDF (2147K) -
Kenji SOBUE, Kouichi MORIMOTO, Keiko KANDA, Shiro KAKIUCHI1982 Volume 91 Issue 4 Pages 1313-1320
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe binding of calmodulin to a brain microsomal fraction rich in synaptic membranes and vesicles was studied using 3H-labeled calmodulin. The binding was Ca2+-dependent and highly specific to calmodulin since it was competitively displaced only by unlabeled calmodulin and not by 200-4, 000-fold excesses of other proteins that included troponin-C and S-100 protein. Within the physiological pH range, the specific binding, defined as the amount of bound [3H] calmodulin which is displacable by the addition of an excess of unlabeled calmodulin, agreed well with the Ca2+-dependent binding defined as the difference between the total binding in the presence of Ca2+ and the binding obtained with EGTA in place of Ca2+. Both binding activities appeared to be greatest at about pH 7.0. The binding, either specific or Ca2+-dependent, is a calmodulin concentration-dependent saturable process. The dose-dependent curve obtained for increasing concentrations of UHF calmodulin agreed well with that obtained for mixtures of a fixed concentration of [3H] calmodulin and increasing concentrations of unlabeled calmodulin over the entire concentration range examined. The results serve as the basis for using [3H]-calmodulin in binding studies. Scatchard plot analysis of the curve gave two different Kd values for calmodulin, 8.2×10-8 and 5.3×10-7M. The corresponding maximum binding capacities were 1.0×1014 and 1.6×1014 calmodulin molecules per mg of microsomal protein, respectively. The binding ability of the microsomal fraction was completely abolished by prior treatment with proteolytic enzymes.View full abstractDownload PDF (487K) -
Koei HAMANA, Shigeru MATSUZAKI1982 Volume 91 Issue 4 Pages 1321-1328
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSSeven phyla of eukaryotic algae were analyzed to determine their contents of diamines and polyamines. The algae examined included Rhodophyta, Pyrrophyta, Chrysophyta, Phaeophyta, Euglenophyta, Chlorophyta, and Charophyta. Both putrescine and spermidine were detected in all the algae studied, while appreciable amounts of spermine were detected only in a few species of algae. 1, 3-Diaminopropane, norspermidine, and norspermine, which are chemical analogs of putrescine, spermidine, and spermine, respectively, were widely distributed in various species of algae. There was no parallelism between the distribution patterns of putrescine derivatives and those of 1, 3-diaminopropane derivatives. Cadaverine and agmatine were detected in multicellular marine algae. Homospermidine was detected sporadically in some algae. The biological and phylogenetical significance of polyamines in these lower eukaryotes is discussed.View full abstractDownload PDF (527K) -
Hiromichi KUMAGAI, Eisuke NISHIDA, Hikoichi SAKAI1982 Volume 91 Issue 4 Pages 1329-1336
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWe reported previously that calmodulin binds to tubulin in a Ca2+-dependent manner, thereby inhibiting microtubule assembly. In this work, we quantitatively investigated the binding between calmodulin and tubulin by applying two analytical methods. One was the frontal analysis using affinity chromatography originally developed by Kasai and Ishii (J. Biochem. 84, 1061-1069, 1978). The use of tubulin-Sepharose columns gave a dissociation constant of 4.0 μM. The other was the equilibrium gel filtration developed by Hummel and Dreyer (Biochim. Biophys. Acta 63, 532-534, 1962). This method using a Sephadex G-100 column provided a dissociation constant of 3.5 μM under the same medium conditions as in the frontal analysis, and it was found that 2 mol calmodulin could bind to 1 mol tubulin. Furthermore, the frontal analysis method was convenient for studies on the effect of temperature and ionic strength on the binding. Upon elevating the temperature, the dissociation constant increased. Increase in the ionic strength also increased the dissociation constant.View full abstractDownload PDF (529K) -
Hideki FUKATA, Hirosuke FUKASAWA1982 Volume 91 Issue 4 Pages 1337-1342
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSDNA topoisomerases which remove superhelical turns in closed circular DNA have been isolated from cauliflower inflorescences using polyethylene glycol fractionation, ammonium sulfate precipitation, and column chromatography on CM-Sephadex or CM-cellulose and DNA-cellulose. Two distinct enzymes, topoisomerase-I and ATP-dependent topoisomerase, were separated clearly by CM-Sephadex or CM-cellulose, and partially characterized using agarose gel electrophoresis with plasmid pBR 322 DNA. Topoisomerase-I acts like other eucaryotic DNA topoisomerases in the absence of ATP, is stimulated by spermidine and inhibited by EDTA. The ATP-dependent topoisomerase acts like topoisomerase-I only in the presence of ATP in the reaction medium, is inhibited by spermidine and EDTA, and does not introduce supertwists into closed duplex DNA or produce catenate aggregates under the present reaction conditions.View full abstractDownload PDF (1706K) -
Hayao TAGUCHI, Minoru YAMASHITA, Hiroshi MATSUZAWA, Takahisa OHTA1982 Volume 91 Issue 4 Pages 1343-1348
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSHeat-stable L-lactate dehydrogenase [EC 1. 1. 1. 27] was purified from an extremely thermophilic bacterium belonging to the genus Thermos, and it showed an allosteric nature dependent on fructose 1, 6-bisphosphate as an effector. The enzyme had a molecular weight of approximately 120, 000 with a subunit molecular weight of 31, 000. For pyruvate reduction, the optimal pH was found to be 4.5. At neutral pH, which is a more physiological region, little enzyme activity was observed, but marked reaction resulted from the addition of fructose 1, 6-bisphosphate. This addition stabilized the enzyme toward heat treatment at up to 95°C. The optimal temperature for the enzyme reaction was approximately 80°C for pyruvate reduction and 95°C for lactate oxidation.View full abstractDownload PDF (396K) -
Wataru KAMIIKE, Fusao WATANABE, Tadao HASHIMOTO, Kunio TAGAWA, Yoshika ...1982 Volume 91 Issue 4 Pages 1349-1356
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe cellular levels of adenine nucleotides and their metabolites in ischemic rat liver were assayed by high pressure liquid chromatography with high theoretical plate numbers. The method was sensitive enough to measure all the metabolites in about 1mg of tissue, and to examine changes in their levels in a single liver in ischemia. In ischemia the cellular level of ATP decreased rapidly. Concomitantly there was a transitory increase in AMP, followed by its degradation to allantoin via adenosine with accumulation of all species of purine catabolites. NAD was also degraded gradually with concomitant accumulation of nicotinamide. Thus, the level of total adenine nucleotides decreased during ischemia and the amount of this decrease was equal to the sum of the amounts of catabolites produced. The ATP level was rapidly restored on recirculation after an ischemic period of less than 15min. However, recovery of the ATP level was depressed by prolonged ischemia and was not observed after an ischemic period of 2 h. Intermediate purine catabolites that accumulated in ischemia were also cleared during recirculation either by their removal in the blood flow or by further oxidative degradation, but they were not salvaged for reuse until the cellular level of ATP was restored. Administration of allopurinol resulted in marked accumulation of hypoxanthine in ischemic liver, but neither this drug nor chlorpromazine had any appreciable effect on recovery of the ATP level during recirculation.View full abstractDownload PDF (542K) -
Kunio MATSUI, Kyoko SUGIMOTO, Sabu KASAI1982 Volume 91 Issue 4 Pages 1357-1362
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe association constants of hen egg yolk riboflavin binding protein with 8-substituted riboflavins were measured using a fluorometric titration method in the range of 10-40°C, and thermodynamic parameters were calculated using ordinary methods. The flavins used were riboflavins whose 8-methyl group was substituted with HRN, RR'N, RO type groups, or halogen atoms. From a plot of ΔH° against ΔSu (unitary entropy change), the flavins were classified into four groups, i.e., HRN, RR'N, RO, and halogen type substituents. In each group, the linear free energy relationship, ΔH°=u•ΔS+v (u and v were constants specific for each group), was found to be similar to that for egg white riboflavin binding protein, though with different specific constants for each egg protein. The relation between ΔSu and the bulkiness (molecular volume) of 8-substituents suggested burying of the 8-substituents in a cavity of the protein similar to that of the egg white protein, but of smaller volume. The behavior of the halogen group was similar to that of the other three groups, and could be explained in terms of the bulkiness of the substituents rather than by assuming electric repulsion between halogen substituents and the binding site, which is in contrast with the case of egg white protein. A linear relation between v value and the wavelength of the visible absorption peak of flavins was also found.View full abstractDownload PDF (344K) -
Junji SAGARA, Kazuhiro NAGATA, Yasuo ICHIKAWA1982 Volume 91 Issue 4 Pages 1363-1372
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSChanges in cellular myosin were followed during the differentiation into macrophages of a myeloid leukemia cell line (Ml) which can be induced by conditioned medium (CM) from a rat embryo culture. To extract the myosin, we used three different procedures, all of which gave a lower yield of myosin for the differentiated than for the undifferentiated Ml cells. This low extractability we attributed to increased binding of the myosin to the plasma membrane. Taking the different extractabilities into consideration, we calculated the myosin contents in the total cellular protein from the densitometry of SDS-polyacrylamide electrophoresis, 0.6%, for the untreated Ml cells and 1.0% for the differentiated ones. The three ATPase activities of the Ml cell myosin were in the order, K--EDTA-=Ca2+- Mg2+-ATPase in the presence of 0.6M KCl, whether or not there was treatment with CM. Myosin was purified through fractionation with 25-55% saturated ammonium sulfate, then gel filtration with Sepharose 4 B followed by affinity chromatography on F actin-Sepharose 4 B. The Ml cell myosin consists of I heavy chain (H) and 3 light chains (L1. L2, L3), with molecular ratios of L1+L2/H_??_1 and L3/H_??_1. The ratio of L1/L2 was about 1.2 for the untreated Ml cells, but it decreased to about 0.7 after differentiation.View full abstractDownload PDF (1698K) -
Seiichi HASHIDA, Eiki KOMINAMI, Nobuhiko KATUNUMA1982 Volume 91 Issue 4 Pages 1373-1380
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSE-64 is a specific thiol proteinase inhibitor which inhibits lysosomal cathepsins B and L in vitro and in vivo [Hashida, S., Towatari, T., Kominami, E., & Katunuma, N. (1980) J. Biochem. 88, 1805-1811]. This work showed that E-64 administered in vivo penetrates into lysosomes of the liver, possibly by permeation rather than by endocytosis. When [3H] E-64 was injected into rats i. p., high radioactivity was observed in the serum after a short time and it decreased rapidly. Incorporation of [3H] E-64 into the cytosol fraction of liver also began to decrease 1 h after the injection. Radioactivity in the mitochondrial-lysosomal fraction increased to a maximum after 6 h and then gradually decreased until 72 h. Dose-dependent incorporation of [3H] E-64 into the serum and liver cytosol was observed at all doses tested, but that into the lysosomal fraction increased linearly with doses of only up to 0.5mg/100 body weight of E-64. E-64 in the serum and liver cytosol was mostly present in the free form, whereas that in the lysosomal fraction was mostly protein-bound. The time course and dose-response of lysosomal cathepsin B activity to E-64 were closely related to the radioactivity in the protein-bound fraction of the lysosomes.
These results suggest that E-64 was transported to the liver cytosol in the free form in the blood and permeated into the lysosomes, where it bound to, and inactivated, E-64 sensitive proteinases.View full abstractDownload PDF (473K) -
Mitsuyo OKAZAKI, Noriko HAGIWARA, Ichiro HARA1982 Volume 91 Issue 4 Pages 1381-1389
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA determination method for choline-containing phospholipids in serum lipoproteins was established by application of the HPLC method [Hara et al. (1980) J. Biochem. 87, 1863-1865; (1981) 89, 879-887] developed for cholesterol quantitation. The concentration of choline-containing phospholipids in the fraction separated by HPLC using gel permeation columns was determined through colorimetric detection using a commercial enzymatic kit.
The optimum conditions for enzymatic reaction in the flow diagram were examined. The concentration calculated from the A500 peak area was found to reflect very precisely the concentration of choline-containing phospholipids in all lipoprotein fractions, and the quantitation of each lipoprotein fraction can be performed with only 10-20 μl of whole serum.
Monitoring the elution patterns by detecting choline-containing phospholipids can give much more information about lipoprotein distributions according to particle size than analyses done by detecting cholesterol.View full abstractDownload PDF (613K) -
Maki TOMINAGA, Hitomi TAKEDA, Mutumi MURAMATU1982 Volume 91 Issue 4 Pages 1391-1401
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSOne molecule of UTI68, a trypsin inhibitor purified from urine of healthy men, inhibited four molecules of bovine trypsin. This finding suggests the formation of various complexes of UTI68 with 1 to 4 molecules of trypsin. However, SDS polyacrylamide gel electrophoresis of the reaction products of UTI68 with trypsin showed that, at molecular ratios of UTI68 to trypsin of 1:1 to 1:3, UTI68 was rapidly cleaved by trypsin to form two proteins, Protein I and Protein II, whose molecular weights were estimated as 49, 000 and 25, 000, respectively, while at a ratio of 1:4, UTI68 was converted to Protein III with a molecular weight of about 30, 000 and a smaller protein (s) than trypsin. These results were supported by gel filtration of the reaction products of UTI68 with trypsin on a Sephadex G-100 column at pH 3.0. Protein I and Protein II were separated, and Protein I was named UTI49. Protein II was separated from trypsin on a QAE-Sephadex column, and it had no inhibitory activity. Since one molecule of UTI49 inhibited about three molecules of trypsin, its interaction with trypsin was examined. On addition of one and two molecules of trypsin to one molecule of UTI49 at pH 8.0 complexes were formed consisting of one and two molecules of trypsin, respectively, with one molecule of UTI49, and both complexes were dissociated to their components at pH 3.0. Addition of three molecules of trypsin brought about further fragmentation of UTI49, and the split products formed a complex (es) with trypsin at pH 8.0, which dissociated at pH 3.0.View full abstractDownload PDF (2513K) -
Satoru OKA, Hidenori SUZUKI, Moriyasu TSUJI, Toshihiko JYO1982 Volume 91 Issue 4 Pages 1403-1409
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSTwo antisera were prepared in rabbits against substantially purified preparations of sea-squirt antigens, Gi-rep and Ei-M, which were apparently discriminated from each other in antigenic behavior in radioimmunoassay experiments. Radioimmunometric analysis of the interaction between the two anti-sea-squirt sera and the two antigens revealed that Gi-rep induced in rabbit only one type of antibody (type A) which reacted with Gi-rep and Ei-M in common, while Ei-M induced not only type A antibody having the common reactivity but also another antibody (type B) which was strictly specific to Ei-M. This observation supported the preceding suggestion that Gi-rep and Ei-M carried a common antigenic determinant (type α) but that Ei-M had an additional determinant (type β) specific to Ei-M. In this connection, in view of the similarity of type A antibody in specificity to the blocking antibody induced in asthmatic patients with sea-squirt allergy on hyposensitization therapy with these antigen preparations, it was suggested that the presumed allergenic substance in sea-squirt also carries the type α determinant.View full abstractDownload PDF (439K) -
Hideyuki TANAKA, Ikuharu SASAKI, Kanzo YAMASHITA, Yuhsi MATUO, Jinpei ...1982 Volume 91 Issue 4 Pages 1411-1417
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESS1. It has been reported that DNase I can be highly purified from pancreas extract by affinity chromatography on a dDNA-Sepharose column under non-digestive conditions. In the present study, the adsorption-elution of other nucleases on the column under non-digestive conditions was studied.
2. All the seven kinds of nucleases tested were adsorbed when applied on a dDNASepharose column under conditions which did not allow the enzymes to hydrolyze the DNA. The non-digestive conditions were as follows. i) For DNase II (pI=10.2), pH 3.0 in the presence of 50mM sodium sulfate (inhibitor), ii) for micrococcal nuclease (pI=9.6), pH 4.0 in the absence of Ca2+ (activator), iii) for restriction endonucleases Eco RI (pI=5+1), Hind III (pI=5+1). and Barn HI (pI=5+1), pH 4.0 in the presence of 20% glycerol and 0.1% Neopeptone (stabilizers), and iv) for nucleases S1 (pI=5+1) and nuclease P1 (pI=4.5), pH 7.0. At the respective pH's, the enzymes other than nucleases S1 and P1 were cationic so as to exhibit electrostatic attraction to the anionic dDNA-Sepharose. Although S1 and P1 were anionic, they still adsorbed to the column.
3. All the adsorbed nucleases described above were eluted by a concentration gradient of KCI without changing pH. The ionic strengths required for elution were 0.19 for DNase II, 0.53 for micrococcal nuclease, 0.73 for Eco RI, 0.72 for Hind III, 0.37 for Barn HI, 0.17 for P1, and 0.13 for S1. The fact that the ionic strength required for the elution of DNase I (pI=5.0) was 0.39 at pH 4.0 indicates that the former five enzymes except DNase II can be chromatographed with almost the same or higher efficiency than DNase I, because the proteins adsorbed with non-specific affinity could be mostly eluted at lower ionic strength. On the other hand, the fact that nucleases P1 and S1 were adsorbed in spite of electrostatic repulsion suggests that these two enzymes can also be effectively chromatographed, especially when other cationic proteins are previously removed by an appropriate method such as adsorption to a typical cation exchanger.View full abstractDownload PDF (447K) -
Hideto KUWAYAMA, Tohru KANAZAWA1982 Volume 91 Issue 4 Pages 1419-1426
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSHighly purified vesicles of cardiac sarcolemma were prepared from a homogenate of canine ventricular muscle by density gradient centrifugation. The preparation showed an extremely high content of (Na+, K+)-ATPase. The steady state levels of Na+-dependent phosphoenzyme formation in the presence of Triton X-100 and the specific ouabain binding in the absence of Triton X-100 were, respectively, 773 and 907 pmol•mg-1 under the optimum conditions. On the other hand, the amount of Ca2+-dependent phosphoenzyme formed in the absence of Triton X-100 was less than 2 pmol•mg-1. This demonstrates that the preparation was virtually free of contaminant sarcoplasmic reticulum fragments. The preparation showed ATPdependent Ca2+ uptake. Almost all the Ca2+ accumulated on the addition of ATP was rapidly released by the subsequent addition of NaCI. This finding gives evidence that the ATP-driven Call pump exists in the cardiac sarcolemma. The Ca2+ uptake was unaffected by 2 μM digitoxin, 1 μM monesin, and 200 μM dinitrophenol. These results exclude the possibility that transmembrane gradients of Na+ and H+ were involved in this Ca+ uptake. The Ca+ pump was activated by calmodulin. The concentration of calmodulin giving a half-maximum activation was 0.05 μg•ml-1, which is equivalent to 3 nM. This activation was removed by addition of trifluoperazine, a specific inhibitor of calmodulin.View full abstractDownload PDF (484K) -
Shigemi NORIOKA, Kaoru OMICHI, Tokuji IKENAKA1982 Volume 91 Issue 4 Pages 1427-1434
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSFive protease inhibitors were isolated from peanut seeds and named A-I, A-II, B-I, B-II, and B-III. These inhibitors seemed to be Bowman-Birk type inhibitors judging from their low molecular weights and high cystine contents.
All the inhibitors inhibited both bovine trypsin and chymotrypsin at ratios of 1:2 and 1:1, respectively, but not simultaneously. The complexes of the inhibitors and trypsin no longer inhibit chymotrypsin. On the other hand, their complexes with chymotrypsin inhibit trypsin with a slow release of chymotrypsin.View full abstractDownload PDF (1102K) -
Reuven TIROSH, Avraham OPLATKA1982 Volume 91 Issue 4 Pages 1435-1440
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSSolutions containing heavy meromyosin, actin, native tropomyosin, and Mg-ATP exhibited streaming in horizontally placed glass microcapillaries. Up-hill streaming could also be observed when the capillaries were at an inclined position; this served for the clear distinction between active and passive streaming provided surface tension effects were eliminated. The presence of native tropomyosin and actinactivation of the ATPase activity of HMM were essential for the reconstitution of active streaming. The significance of the results for cytoplasmic streaming and muscle contraction is discussed.View full abstractDownload PDF (434K) -
Tetsuo MESHI, Takeshi OHNO, Yoshimi OKADA1982 Volume 91 Issue 4 Pages 1441-1444
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSThe nucleotide sequence of cloned cDNA copies of the common strain of tobacco mosaic virus RNA corresponding to the 2, 000 nucleotides at the 3'-end was determined. The 30 K protein cistron was revealed to be located at residues 687-1, 493 from the 3'-end. The 30 K protein is composed of 267 amino acids and is probably a basic protein. The 5' flanking regions of both the coat protein and the 30 K protein cistrons were very U-rich, and a homology was found between the sequence around the capping site of the coat protein mRNA and the sequence upstream from the 30 K protein cistron.View full abstractDownload PDF (249K) -
Itaru MIYAMOTO, Sumi NAGASE1982 Volume 91 Issue 4 Pages 1445-1447
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSA new electrophoretic method is presented for the determination of glucosamine and galactosamine. The technique is quite simple and rapid, it involves cellulose acetate electrophoresis in borate buffer (200 V, 15min) and silver nitrate staining. Hexosamine samples of 0.36-1.80 μg were separated and stained within 30min. This method was applied for the hexosamine analysis of glycosaminoglycans.View full abstractDownload PDF (1339K) -
Eisaku KATAYAMA, Sukekatsu NOZAKI1982 Volume 91 Issue 4 Pages 1449-1452
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESSWe have chemically synthesized two peptides corresponding to the binding regions of troponin-I for troponin-C. Electrophoretic analysis has shown that one of the two peptides binds Ca2+-dependently to troponin-C and the other Ca2+-independently. The biological significance of the results is discussed. The interaction of the peptides with calmodulin was different from that with troponin-C.View full abstractDownload PDF (971K) -
Michinao MIZUGAKI, Tomoko NISHIMAKI, Hirotaka YAMAMOTO, Sumiko NISHIMU ...1982 Volume 91 Issue 4 Pages 1453-1456
Published: April 01, 1982
Released on J-STAGE: November 18, 2008
JOURNAL FREE ACCESS2, 4-Dienoyl-CoA reductase has been detected in crude extracts of E. coli. The reductase was shown to be induced many fold when the cells were grown in the presence of linoleic or oleic acid. The activity profile of the reductase on gel filtration was different from those of other enoyl reductases. These results suggest that there are two pathways even in E. coli for the degradation of cis-4-decenoyl-CoA, which is an intermediate in the β-oxidation of linoleic acid, as recently proposed in rat liver.View full abstractDownload PDF (205K)
- |<
- <
- 1
- >
- >|