It has been reported that nerve cAMP content is reduced in streptozocin-induced diabetic rats and that cAMP might regulate the activity of nerve Na/K-ATPase. To clarify the mechanism by which nerve cAMP content is reduced in diabetes, immunohistochemical and biochemical experiments were conducted. Using polyclonal anti-cAMP antibody, cAMP was shown to be visualized exclusively in axons. The cAMP content was significantly reduced in the distal stumps of transected nerves in which axons were lost due to Wallerian degeneration, but did not differ between control and diabetic nerves. Although adenylate cyclase and cAMP-phosphodiesterase activities were not altered in diabetic nerves, the accumulation of cAMP under isoproterenol stimulation was significantly decreased in diabetic nerves. These results suggest that in diabetes axonal cAMP might be decreased and that altered signal transduction from receptors to adenylate cyclase might be responsible for the reduced nerve cAMP content.

View full abstract

In order to determine whether essential hypertension (EHT) in our country is associated with insulin resistance, we measured insulin sensitivity (glucose clearance) using the Steady State Plasma Glucose (SSPG) method in 9 hypertensives (HT), 10 borderline hypertensives (BLHT) and 7 non-obsese controls (age-, sex-, weight-matched) with normal OGTT. Among HT and BLHT, glucose clearance (GC) was significantly impaired (42.1±4.1 ml/kg/10 min, 54.6±4.2 ml/kg/10 min vs 75.1±6.1 ml/kg/10 min of controls). GC was inversely related to systolic (r=-794, p<0.01), diastolic (r=-0.574, p<0.01) and mean arterial pressure (r=-0.725, p<0.01) However, Basal IRI of 75 gOGTT was related to diastolic (r=0.453, p<0.05) and mean arterial pressure (r=0.429, p<0.05).ΣIRI was also related to diastolic (r=0.423, p<0.05) and mean arterial pressure (r=0.456, p<0.05). Multiple regression analysis indicated that only GC was significantly related to systolic, diastolic or mean arterial pressure. During insulin sensitivity testing, epinephrine and FENa were unchanged. Norepinephrine was significantly depressed. These results indicate that insulin resistance, rather than hyperinsulinemia, is closely associated to EHT. An effort to improve insulin sensitivity in EHT is thus clinically warranted to prevent possible progression to diabetes.

View full abstract

We studied the clinical characteristics of postprandial hypotension and its relation to neurological function in diabetes mellitus. Blood pressure and insulin secretion were monitored for 2 hours before and after a meal in 40 diabetic subjects. PPH was defined as a 20 mmHg or greater decrease in systolic or diastolic blood pressure after the meal. Nerve conduction velocity and autonomic nerve function tests were also performed. The incidence of PPH was 48%, and no correlation was found between postprandial hypotension and insulin response. Neurological functions declined in subjects with PPH as compared to those without PPH, and there was a significant correlation between PPH and orthostatic hypotension (r=0.424, P<0.05), suggesting that PPH reflects sympathetic nerve function. In hypertensive diabetic patients, the incidence of PPH was 79%, and the non-hypertensive patients with PPH were older than those without PPH. There were two non-hypertensive patients with PPH who were younger than 60 years and their glycemic control was very poor.
These results suggest that postprandial hypotension might be affected by hypertension, age and glycemic control.

View full abstract

A 73-year-old man suffering from frequent hypoglycemic attacks with hyperinsulinemia (2660 μU/ml: RIA) was admitted to our hospital on February 10, 1989. He had never been treated with insulin on any other medications containing a sulfhydryl (SH) group. Insulin-binding antibodies found in his serum showed higher affinity to human and porcine insulin than to bovine insulin, and the isotype of the antibodies was IgG and the Kappa light chain was predominant. A diagnosis of insulin autoimmune syndrome was made and methyl-prednisolone pulse therapy was started to suppress the production of insulin-binding antibodies and to prevent the hypoglycemic attacks. Six weeks after the pulse therapy, total insulin levels and the titer of insulin-binding antibodies had fallen significantly and he was free of further spontaneous hypoglycemic attacks.
Scatchard plot analysis of insulin antibodies before and after the pulse therapy showed decreased insulin-binding capacity without change in the affinity constant, suggesting a critical concentration of insulin antibodies might be necessary to produce his spontaneous hypoglycemia.
In conclusion, high dose methyl-prednisolone pulse therapy adequate to suppress the production of insulin-binding antibodies treatment for insulin autoimmune syndrome with persistent hypoglycemic attack.

View full abstract

A 69-year-old woman with NIDDM of more than 15-year duration was admitted to our hospital in February, 1992, because of abdominal distension and persistent constipation. The abdominal symptoms had appeared after a coronary angiographic examination in October, 1989, and thereafter progressed gradually. Abdominal plain X-ray film and CT scanning on admission revealed a multiple polypoid mucosal appearance due to gas-filled cysts in the intestinal wall. The patient was diagnosed as having pneumatosis cystoides intestinalis (PCI). The cysts and the symptoms disappeared with continuous breathing of 40-50 % oxygen for six days and did not recur during the following 15 months.
PCI should be differentiated from diabetic gastroenteropathy, often observed in patients with long-term diabetes, because of the similar symptomatology of these two disorders.

View full abstract

A 58-year-old woman with non-insulin dependent diabetes mellitus (NIDDM), who was not treated for 10 years, complained of sudden rt. hip joint pain when carrying heavy baggage. She then developed cyclic vomiting and a few days later her consciousness diminished. She was hospitalized and diagnosed as having diabetic ketoacidosis, disseminated intravascular coagulation syndrome and shock. Computed tomography showed multiple abscesses in muscles around the rt. sacroiliac joint. The abscesses were surgically drainaged. Cultures of the drained pus and blood cultures were positive for Prevotella bivia. On the second drainage operation, an abscess was also recognized at the sacro-iliac joint. She was thus diagnosed as having pyogenic sacroiliitis which secondarily caused multiple abscesses, sepsis and diabetic ketoacidosis.
Pyogenic sacroiliitis is an uncommon disease and its association with multiple muscle abscesses has not previously been described in the medical literature to our knowledge. In addition, this is the first report of Prevotella vibia as its pathogen. Pyogenic sacroiliitis and multiple muscle abscesses should be considered in poorly-controlled diabetic patients who complain of lumbago and have infectious signs.

View full abstract

We describe a 65-year-old woman who developed insulin-dependent diabetes mellitus of acute onset. In addition to islet cell antibody and islet cell surface antibody, her sera contained autoantibodies to parietal cells, anterior pituitary cells and thyroid microsomes. She had very low glucagon-stimulated serum C-peptide immunoreactivity responses (peak value of 0.5ng/ml) as well as low daily urinary excretion of the peptide (11.5μg/day). We have found only six previous reports in the Japanese literature of patients who developed insulin-dependent diabetes mellitus at 60 years of age or older.

View full abstract

Claims dealing with the precipitation in the syringe and infusion route obstruction during continuous subcutaneous insulin infusion (CSII) have increased since the supply of bufferedfast acting human insulin preparation was withdrawn from the Japanese market.
When the precipitations encountered in the syringes at our institution were examined under a microscope, they were found to be a conglomerate of amorphous particles such as are seen in isoelectric precipitation. The pH of the insulin solution was found to be slightlydiminished. When the CSII syringe and catheter were examined for dissolution of zinc into the insulin solution the zinc ion content was found to be slightly increased. No bufered fast-acting human insulin preparation is currently available in Japan. It is known that, depending on the preservative, the solubility of insulin decreases in response to an increasing concentration of zinc ions in the insulin solution. The present study suggests that the occurrence of precipitation during CSII may be associated with the dissolution of acidic substances and zinc ions from the syringe and catheter used in CSII.

View full abstract

It has been reported that impairment of glycogen synthase, the key enzyme in glycogen synthesis, could be a genomic marker of NIDDM. Groop et al. identified a polymorphism by Xbal digestion of the glycogen synthase gene. We studied 55 unrelated patients with NIDDM and 40 unrelated nondiabetic subjects with no family history of NIDDM. Using PCR on genomic DNA from the leukocytes of these subjects, we amplified a region of the genomic DNA encompassing the Xbal new cleavage site (an intron 302 base pairs upstream from position 1970 of cDNA) with sense and anti-sense primers;5'CTCTCCGACCTTCTGGACTG3'(1935-1954) and 5'GCTCGTAGGTGAAGTGCTCT3'(2014-2033), respectively.
The Xbal new cleavage site in the PCR fragment was found in one of 40 non-diabetic subjects and none of the 55 patients with NIDDM. Therefore, Xbal polymorphism of the glycogen synthase gene is rare in Japanese and can not be used as a genomic marker for Japanese NIDDM.

View full abstract